Способ получения плазмидной днк фармацевтического качества

Есть еще 22 страницы.

Смотреть все страницы или скачать PDF файл.

Формула / Реферат

1. Устройство для лизиса клеток, включающее:

а) средство для создания турбулентного потока с целью быстрого смешивания клеточной суспензии с раствором, который лизирует клетки, и

б) средство для создания ламинарного потока, соединенное со средствами создания турбулентного потока для того, чтобы обеспечить инкубацию смеси, образующейся в средстве создания турбулентного потока, без существенного перемешивания.

2. Устройство по п.1, дополнительно включающее средство для добавления второго раствора, который нейтрализует лизирующий раствор, соединенное со средством создания ламинарного потока.

3. Способ выделения плазмидной ДНК из клеток с помощью устройства по п.2, включающий:

а) смешивание клеток с щелочным лизирующим раствором в средстве для создания турбулентного потока; и

б) нейтрализацию щелочного лизирующего раствора путем добавления кислотного раствора.

4. Устройство для непрерывного щелочного лизиса клеток, включающее

первый смеситель или инжектор, способный впрыскивать щелочную жидкость в направлении, противоположном впрыскиванию клеточной суспензии;

первую трубку малого диаметра для того, чтобы создавать в смеси турбулентный поток;

вторую трубку большого диаметра для того, чтобы создавать в смеси ламинарный поток;

второй смеситель или инжектор для впрыскивания нейтрализующего раствора на одном конце и сбора смеси на другом конце.

5. Устройство по п.4, где диаметр трубок и инжекторов выбран таким образом, чтобы контролировать скорости потока смесей в турбулентном и ламинарном потоках.

6. Устройство для непрерывного щелочного лизиса клеток по п.4 или 5, дополнительно включающее насос для впрыскивания или закачивания клеточной суспензии для контакта в направлении, противоположном щелочному раствору.

7. Устройство по любому из пп.4-6, где первый смеситель или инжектор представляет собой смеситель или инжектор, расположенный на одной линии.

8. Устройство по любому из пп.4-7, где первый смеситель представляет собой Т-образную трубку.

9. Устройство по любому из пп.4-8, где первая трубка имеет диаметр менее 1 см, предпочтительно от 2 до 8 мм и более предпочтительно примерно 6 мм и длину от 1 до 10 м, предпочтительно от 2 до 6 м.

10. Устройство по любому из пп.4-9, где вторая трубка представляет собой спиральный трубопровод, способный создавать ламинарный поток для того, чтобы обеспечить непрерывный контакт щелочного раствора и клеточной суспензии и гарантировать полный лизис клеток.

11. Устройство по любому из пп.4-10, где вторая трубка имеет диаметр менее 1 см, предпочтительно от 10 до 20 мм или от 12,5 до 19 мм и более предпочтительно равный 16 мм и длину от 5 до 30 м и предпочтительно от 13 до 23 м.

12. Устройство по любому из пп.4-11, где третья трубка имеет диаметр менее 1 см, предпочтительно от 2 до 10 мм, более предпочтительно от 5 до 8 мм и длину от 1 до 10 м и более предпочтительно от 2 до 4 м.

13. Устройство по любому из пп.4-12, где второй смеситель или инжектор имеет Y-образную форму и расположен на одной линии с лизируемыми клетками для впрыскивания раствора, приводящего к осаждению геномной ДНК, РНК и белков.

14. Устройство по любому из пп.4-13, которое снабжено средством для функционального соединения с емкостью для ферментации.

15. Способ лизиса клеток, включающий пропускание клеток через средство для создания турбулентного потока с целью быстрого перемешивания клеточной суспензии с раствором, который лизирует клетки; и средство для создания ламинарного потока с целью обеспечения инкубации образующейся смеси без существенного перемешивания.

16. Способ по п.15, где смесь подвергают воздействию турбулентного потока в течение 1-10 с, предпочтительно 2-5 с и более предпочтительно 2,5 с.

17. Способ по п.15 или 16, где лизирующий раствор представляет собой щелочную жидкость, а период непрерывного контакта его с клеточной суспензией в средстве создания ламинарного потока составляет от 30 с до 2 мин, предпочтительно от 1 мин до 1 мин 30 с и предпочтительно 1 мин 20 с.

18. Способ по любому из пп.15-17, дополнительно включающий протекание инкубированной смеси из средства создания ламинарного потока в средство для добавления второго раствора, который нейтрализует лизирующий раствор.

19. Способ высвобождения плазмид из клеток, содержащих плазмиды, включающий пропускание клеток через средство для создания турбулентного потока с целью быстрого перемешивания клеточной суспензии с раствором, который лизирует клетки, пропускание клеток через средство для создания ламинарного потока с целью обеспечения инкубации образующейся смеси без существенного перемешивания и приведение в контакт инкубированной смеси с раствором, который нейтрализует лизирующий раствор.

20. Способ по любому из пп.15-19, где лизирующий раствор представляет собой раствор, содержащий лизирующий агент, выбранный из группы, состоящей из щелочи, детергента, органического растворителя и фермента или их смеси.

21. Способ по любому из пп.15-20, дополнительно включающий по меньшей мере две стадии хроматографирования инкубированной смеси, выбранные из анионообменной хроматографии, аффинной хроматографии с образованием тройной спирали и гидрофобной хроматографии.

22. Способ по п.21, где осуществляют анионообменную хроматографию, затем аффинную хроматографию с образованием тройной спирали и затем гидрофобную хроматографию.

23. Способ по п.21, где перед первой хроматографией проводят фильтрацию лизата.

24. Способ по п.21, где перед первой хроматографией проводят удаление хлопьевидного осадка.

25. Способ по п.21, включающий стадию анионообменной хроматографии в сочетании с хроматографией с образованием тройной спирали.

26. Способ по п.25, который дополнительно включает стадию гидрофобной хроматографии.

27. Способ крупномасштабного производства высокоочищенной плазмидной ДНК, при котором клетки хозяина, содержащие плазмиду, пропускают через средство для создания турбулентного потока с целью быстрого смешивания клеточной суспензии с раствором, который лизирует клетки, затем клетки пропускают через средство для создания ламинарного потока с целью обеспечения инкубации образующейся смеси без существенного перемешивания, приводят в контакт инкубированную смесь с раствором, который нейтрализует лизирующий раствор, и плазмиды, высвобожденные из клеток, разделяют анионообменной хроматографией, затем аффинной хроматографией с образованием тройной спирали и затем гидрофобной хроматогафией.

28. Способ получения и очистки плазмидной ДНК фармацевтического качества, включающий стадию получения клеток, содержащих плазмидную ДНК, стадию получения лизата, содержащего плазмидную ДНК, путем разрушения клеток способом непрерывного щелочного лизиса, стадию концентрирования путем осаждения подходящим агентом, стадию анионообменной хроматографии, стадию хроматографии с образованием тройной спирали, стадию гидрофобной хроматографии и конечную стадию диафильтрации и/или буферного обмена.

29. Способ по любому из пп.15-28, дополнительно включающий предварительную стадию удаления хлопьевидного осадка путем пропускания раствора через сетчатый фильтр и посредством объемной фильтрации.

30. Способ по любому из пп.15-29, дополнительно включающий стадию диафильтрации после последней стадии хроматографии.

31. Способ по п.30, где стадию диафильтрации используют для достижения подходящих целевых концентраций соли, буфера и значения pH.

32. Способ по п.30 или 31, где стадия диафильтрации включает следующие стадии:

сбор раствора с последней хроматографической стадии;

осуществление первой стадии диафильтрации против буфера Трис/NaCl;

осуществление второй стадии диафильтрации против солевого раствора в условиях, подходящих для контролирования конечной концентрации буфера и для стабилизации pH конечного препарата плазмидной ДНК.

33. Способ по любому из пп.15-32, где хроматографические стадии осуществляют на твердом носителе, который представляет собой любой органический, неорганический или композиционный материал, пористыщ, сверхпористый или непористый, подходящий для хроматографического разделения, который дериватизирован поли(алкенгликолями), алканами, алкенами, алкинами, аренами или другими молекулами, которые придают этому носителю гидрофобный характер.

34. Способ по любому из пп.15-32, где гидрофобную хроматографию проводят в неподвижном слое или во вспученном слое.

Рисунок 1

 

Текст

Смотреть все

009447 Область изобретения Данное изобретение относится к получению высокоочищенной плазмидной ДНК и, в частности, к получению и выделению плазмидной ДНК фармацевтического качества для применения в плазмидной терапии. Предшествующий уровень техники Разработки в молекулярной биологии ясно свидетельствуют о том, что плазмидная терапия, особенно в области вакцин и генной терапии человека, может быть эффективным способом лечения заболеваний. Однако значительным препятствием для этой технологии является нахождение эффективных способов доставки интересующего гена в клетку. Одним из многообещающих способов безопасной и эффективной доставки нормального гена в человеческие клетки является доставка с помощью плазмидной ДНК. Плазмидная ДНК представляет собой замкнутую, кольцевую форму бактериальной ДНК, в которую можно вставлять интересующую последовательность ДНК. Сразу после доставки в человеческую клетку, пДНК начинает реплицироваться и производить копии встроенной последовательности ДНК. Таким образом, исследователи рассматривают плазмидную ДНК в качестве многообещающего носителя для доставки нормальных генов в человеческие клетки с целью лечения целого ряда болезненных состояний. Огромные количества плазмидной ДНК необходимы для развития исследований с целью осуществления этой новой технологии и терапии человека. Так как плазмидная ДНК, используемая в генной терапии и других клинических применениях, обычно продуцируется бактериями, такими как Eschehchia coli(E. coli), нужны способы эффективного отделения плазмидной ДНК от геномной ДНК (гДНК) бактериальной клетки, а также от эндотоксина и белков в бактериальной клетке. Таким образом, существует растущая потребность в простых, надежных и масштабных способах очистки, которые можно использовать для выделения больших количеств плазмидной ДНК из бактериальных клеток. Важной стадией в любом способе очистки плазмид является лизис бактериальных клеток с целью высвобождения клеточного содержимого, из которого затем можно выделить пДНК. На самом деле, сначала необходимо выполнить три стадии ресуспендирования клеток, лизис клеток и нейтрализацию, а также осаждение примесей из хозяина. При ресуспендировании клеток обычно применяют перемешивание вручную или магнитную мешалку, и гомогенизатор или лопастную мешалку для ресуспендирования клеток в буфере для ресуспендирования. Лизис клеток можно осуществлять путем перемешивания вручную или перемешивания с помощью магнитной мешалки для того, чтобы смешать ресуспендированные клетки с лизирующим раствором (состоящим из разбавленной щелочи (основания) и детергентов); затем выдерживания смеси при комнатной температуре (20-25C) или на льду в течение периода времени, например 5 мин, до полного лизиса. Как указано выше, перемешивание вручную и перемешивание с помощью магнитной мешалки не являются масштабируемыми. Третьей стадией является нейтрализация и осаждение примесей из хозяина. Лизат, полученный на второй стадии, обычно смешивают с холодным нейтрализующим раствором путем мягкого перемешивания или перемешивания с помощью магнитной мешалки для подкисления лизата перед помещением на лед на 10-30 мин с целью облегчения денатурации и осаждения высокомолекулярной хромосомной ДНК, белков хозяина и других молекул хозяина. И перемешивание вручную, и перемешивание с помощью магнитной мешалки не являются масштабируемыми. Обычно клеточную стенку переваривают путем обработки лизоцимом в течение короткого периода времени или путем обработки щелочью или ацетатом калия (КОАс). Обычно также добавляют РНКазу для деградации РНК бактериальной суспензии. Эти химические стадии могут быть эффективными при лизисе клеток в малом масштабе. Однако увеличение вязкости делает очень сложной обработку в большом масштабе. Альтернативный простой и быстрый способ получения плазмид включает обработку бактерий лизоцимом, затем кипячение при примерно 100 С в подходящем буфере в течение 20-40 с с образованием нерастворимого сгустка геномной ДНК, белка и дебриса, оставляя плазмиду в растворе с РНК в качестве основной примеси. Далее добавляют смешанный раствор NaOH и додецилсульфата натрия(ДСН) с целью растворения цитоплазматической мембраны. NaOH частично денатурирует ДНК и частично деградирует РНК, а ДСН действует, растворяя мембрану и денатурируя белки. Комплекс ДСНбелок и клеточный дебрис осаждают путем добавления 5 н. ацетата калия (рН 4,8). В это время рН важен как для нейтрализации NaOH, используемого в указанной процедуре, так и для ренатурации плазмиды. Однако эта методика не подходит для осуществления бактериальных ферментации в большом объеме и предназначена для ферментации с объемом менее пяти литров. Затем применяют центрифугирование для удаления осадков, получая, таким образом, целевые плазмиды в супернатанте. Эти серии манипуляций также требуют медленного и тщательного перемешивания во избежание разрезания бактериальной хромосомной ДНК на маленькие фрагменты и агрегаты, приводящие к загрязнению плазмиды, и затрудняют осуществление крупномасштабной обработки. Один из обычных альтернативных способов лизиса клеток, известный как щелочной лизис, заключается в смешивании суспензии бактериальных клеток (раствор 1) с щелочным лизирующим раствором(раствор 2). Раствор 2 состоит из детергента, например, додецилсульфата натрия (ДСН), для лизиса бак-1 009447 териальных клеток и высвобождения внутриклеточного материала, и щелочи, например гидроксида натрия, для денатурации белков и нуклеиновых кислот клеток (особенно гДНК и РНК). По мере того как клетки лизируются и ДНК денатурирует, вязкость раствора резко увеличивается. После денатурации добавляют кислотный раствор, например ацетат калия (раствор 3), для нейтрализации гидроксида натрия,индуцируя ренатурацию нуклеиновых кислот. Длинные фрагменты гДНК вновь ассоциируют случайным образом и образуют сети, которые осаждаются в виде хлопьев, захватывающих белки, липиды и другие нуклеиновые кислоты. Калиевая соль додецилсульфата также осаждается, унося белки, с которыми она ассоциирована. Две цепи пДНК (плазмидной ДНК), переплетенные друг с другом, обычно снова ассоциируют с образованием исходной плазмиды, которая остается в растворе. В предшествующем уровне техники этот способ лизиса обычно описывают как периодический, т.е. когда различные растворы смешивают путем последовательного добавления растворов в сосуды или емкости. Так как щелочной лизат представляет собой вязко-эластичную жидкость, которой очень трудно манипулировать, то одна из трудностей при осуществлени этого способа возникает во время смешивания различных растворов. Так как напряжение сдвига вызывает фрагментацию гДНК, которую затем чрезвычайно трудно отделить от пДНК, необходимы способы, позволяющие избежать приложения силы сдвига к жидкости. Кроме того, большие пДНК (т.е. более примерно 10 т.п.н.) также подвержены повреждению при сдвиге во время процесса смешивания. После того как раствор, содержащий клеточную суспензию,смешали с лизирующим раствором, вязко-эластичный щелочной лизат смешивают с нейтрализующим раствором. Этот способ смешивания снова является проблематичным из-за вязко-эластичных свойств раствора. Кроме того, другой проблемой при масштабировании процесса периодического лизиса является эффективность перемешивания различных жидкостей при одновременной попытке ограничить силу сдвига, во избежание фрагментации гДНК. Как указано ранее, хроматографическое поведение фрагментированной геномной ДНК очень похоже на поведение пДНК в том, что фактически невозможно избавиться от нее стандартными методами очистки. Таким образом, некоторые ограничения применения периодического способа лизиса бактериальных клеток являются очевидными, такие как увеличение масштаба, плохое качество выделенной пДНК из-за загрязнения фрагментированной гДНК и относительно низкое количество полученной пДНК. В качестве альтернативы периодическому способу были предложены также несколько способов непрерывного смешивания различных лизирующих растворов с применением ряда статических смесителей. Согласно этим способам, раствор клеточной суспензии и лизирующий раствор одновременно добавляют в статический смеситель. Раствор лизированных клеток, который выходит из первого статического смесителя, и осаждающий раствор затем одновременно добавляют во второй статический смеситель. Раствор, который выходит из этого второго смесителя, содержит осажденный лизат и плазмиды (WO 97/23601). Другие непрерывные способы лизиса клеток включают применение проточного теплообменника, где суспендированные клетки нагревают до 70-100 С. После лизиса клеток в теплообменнике выходящий поток подвергают либо центрифугированию с непрерывным протоком, либо центрифугированию порциями, во время которых клеточный дебрис и геномная ДНК осаждаются, оставляя плазмидную ДНК в супернатанте. Поэтому крупномасштабное выделение и очистка плазмидной ДНК из большого объема микробных ферментации требуют разработки улучшенного способа получения плазмид. Несмотря на многочисленные способы, используемые в настоящее время для лизиса бактериальных клеток, ни один из них не решает проблем, вызванных вязко-эластичными свойствами жидкостей и напряжениями сдвига, имеющими место во время стадий перемешивания. Таким образом, настоящее изобретение относится к новому способу непрерывного щелочного лизиса суспензии бактериальных клеток в большом масштабе и дает главное преимущество в ограничении сил сдвига. Другой важной стадией в получении плазмидной ДНК является выделение плазмид, или выделение и очистка. Классические методы выделения и очистки плазмидной ДНК из бактериальных ферментаций подходят для получения плазмид в небольшом или лабораторном масштабе. После разрушения бактериальных клеток-хозяев, содержащих плазмиду, с последующей нейтрализацией ацетатом, вызывающим осаждение геномной ДНК и белков клеток-хозяев, их обычно удаляют, например, центрифугированием. Жидкая фаза содержит плазмидую ДНК, которую осаждают спиртом и затем подвергают изопикническому центрифугированию с использованием CsCl в присутствии бромистого этидия для выделения различных форм плазмидной ДНК, т.е. суперскрученной, кольца с однонитевыми разрывами и линеаризованной. Требуется дополнительная экстракция бутанолом для удаления остаточного бромистого этидия,затем осаждение ДНК с использованием спирта. Следуют дополнительные стадии очистки для удаления белков клеток-хозяев. Эти современные способы выделения плазмидной ДНК имеют некоторые ограничения. Например,способы очистки, которые включают применение больших количеств горючих органических растворителей (например этанола и изопропанола) и токсичных химических веществ, например бромистого этидия, фенола и хлороформа, обычно являются нежелательными для крупномасштабного выделения и очистки плазмидной ДНК. Для очистки плазмидной ДНК можно использовать способы, альтернативные-2 009447 центрифугированию в хлориде цезия, такие как гель-фильтрация, хроматография на гидроксиапатите и различные хроматографические методы, основанные на обращенной фазе и обмене анионами. Эти альтернативные методы могут быть адекватными для получения небольших количеств исследовательского материала в лабораторном масштабе, но обычно не являются легко масштабируемыми и не позволяют получать большие количества плазмидной ДНК. С помощью ряда манипуляций, описанных выше, можно получить плазмиду с относительно высокой чистотой (далее в данном описании указанный способ выделения и очистки нуклеиновых кислот упоминается как способ химического выделения). Однако при способе химического выделения процесс выделения и очистки является сложным и требует использования большого количества органического растворителя, следовательно, он поднимает многие проблемы переработки отработанных растворителей и другие проблемы. Кроме способа химического выделения и очистки существует способ выделения плазмид с помощью электрофореза. Электрофоретический способ включает электрофорез на бумаге и гельэлектрофорез, и гель-электрофорез является обычным в настоящее время. Электрофоретический способ имеет преимущество, состоящее в получении плазмиды с высокой чистотой, однако, он имеет много проблем, таких как длительное выделение, сложный сбор (образцов), малая загрузка образцов и т.д. Поэтому современная ситуация такова, что электрофоретическое разделение используют только тогда, когда чистоту плазмидной фракции, очищенной указанным способом химического разделения и очистки,желают дополнительно улучшить. В имеющихся в настоящее время способах разделения двух форм плазмидной ДНК используют ионообменную хроматографию (Duarte et al., Journal of Chromatography A, 606 (1998), 31-45) или гельфильтрацию (Prazeres, D.M., Biotechnology Techniques Vol. 1, No. 6, June 1997, p 417-420) в сочетании с применением добавок, таких как полиэтиленгликоль (ПЭГ), детергенты и другие компоненты, такие как гексамин кобальта, спермидин и поливинилпирролидон (ПВП). Однако известные в настоящее время способы не могут обеспечить эффективное и дешевое выделение суперскученной ДНК и ДНК с однонитевыми разрывами (или релаксированной). Кроме того, многие из известных способов страдают от недостатков использования ПЭГ или других добавок, которые могут быть нежелательными при производстве плазмидной ДНК, так как они требуют дополнительного отделения, способов контроля удаления и качества, которые могут быть сложными, требующими больше времени и более дорогими. В альтернативных разновидностях известных способов разделения суперскрученной и релаксированной форм плазмидной ДНК используют очень дорогие фирменные смолы, с которыми в процессе обработки также используют растворители, такие как ацетонитрил, этанол и другие компоненты, подобные триэтиламину и тетрабутиламмония фосфату. Дополнительные способы разделения суперскрученной и релаксированной ДНК основаны на гель-фильтрации, которая включает разделение двух форм плазмидной ДНК на основании небольшого различия в размере. Эти колонки имеют тенденцию быть относительно длинными, что затрудняет масштабирование, делая невозможным осуществление крупномасштабного производства. Кроме того, для способов гель-фильтрации нужны концентрированные растворы образцов, которые невозможно получить из растворов плазмидной ДНК из-за высоковязкой природы ДНК. Препараты плазмидной ДНК, которые получают из бактериальных препаратов и которые часто содержат смесь релаксированной и суперскученной плазмидной ДНК, часто требуют удаления эндотоксина, как того требует FDA (Food and Drug Administration, Департамент по контролю за качеством пищевых продуктов,медикаментов и косметических средств), так как известно, что эндотоксины, продуцируемые многими бактериями-хозяевами, вызывают у хозяина, получающего плазмидную ДНК, воспалительные реакции,такие как лихорадка или сепсис. Эти эндотоксины обычно представляют собой липополисахариды или их фрагменты, которые являются компонентами наружной мембраны грамотрицательных бактерий и которые присутствуют в препарате ДНК клеток-хозяев и в мембранах или макромолекулах клетокхозяев. Поэтому удаление эндотоксинов является ключевой и необходимой стадией при очистке плазмидной ДНК для терапевтического или профилактического применения. При удалении эндотоксина из растворов плазмидной ДНК сначала использовали отрицательно заряженную структуру эндотоксинов. Однако плазмидная ДНК также является отрицательно заряженной, и поэтому разделение обычно осуществляют на анионообменных смолах, которые связывают обе эти молекулы и в определенных условиях предпочтительно обеспечивают элюцию плазмидной ДНК с одновременным связыванием эндотоксинов. Такое разделение приводит только к частичному удалению, так как значительные количества эндотоксинов элюируются с плазмидной ДНК и/или достигается очень низкий выход плазмидной ДНК. Таким образом, крупномасштабное выделение и очистка плазмидной ДНК из больших объемов микробных ферментаций требует разработки улучшенного способа получения плазмид. Также требуется более простой и быстрый способ разделения и очистки большого количества плазмидной ДНК. Для исследования и плазмидной терапии также желательно, чтобы нуклеиновые кислоты можно было разделить и очистить, сохраняя ту же самую структуру, воспроизводимым способом, и для того, чтобы избежать вредного влияния примесей на человеческий организм, требуется, чтобы нуклеиновые кислоты были разделены и очищены с высокой степенью чистоты. Однако с указанным традиционным способом существует проблема в том, что нуклеиновые кисло-3 009447 ты достаточно высокой чистоты, в особенности, плазмидные ДНК, не могут быть получены в большом количестве. Поэтому настоящее изобретение направлено на обеспечение способа разделения, в котором используют по меньшей мере две хроматографические стадии, которые делают возможным разделение больших количеств плазмидных ДНК за короткое время и с наиболее высокой степенью чистоты. Краткое описание сущности изобретения Изобретение основано на открытии способа получения и выделения высокоочищенной плазмидной ДНК. Плазмидная ДНК, полученная и выделенная способом по изобретению, содержит очень низкие уровни загрязняющих хромосомных ДНК, РНК, белка и эндотоксинов. Плазмидная ДНК, полученная согласно изобретению, имеет достаточную чистоту для плазмидной терапии. Таким образом, изобретение охватывает способ получения и выделения высокоочищенной плазмидной ДНК, который включает стадию лизиса клеток, на которой имеется (а) средство для создания турбулентного потока с целью быстрого смешивания клеточной суспензии с раствором, который лизирует клетки; и (б) средство для создания ламинарного потока с целью обеспечения инкубации смеси, образованной в (а), без существенного встряхивания, где смесь, образовавшаяся в (а), течет из средства для создания турбулентного потока в средство для создания ламинарного потока. В дополнительном воплощении изобретения данное устройство может дополнительно включать средство для добавления второго раствора, который нейтрализует лизирующий раствор, где смесь, инкубируемая в (б), течет из средства для создания ламинарного потока в средство для добавления второго раствора. В еще одном воплощении может быть использовано устройство для выделения плазмидной ДНК из клеток в способе, включающем: (а) смешивание клеток с щелочным лизирующим раствором в средстве для создания турбулентного потока и (б) нейтрализацию щелочного лизирующего раствора путем добавления кислотного раствора. Изобретение дополнительно охватывает способ получения и выделения высокоочищенной плазмидной ДНК, которая по существу не содержит примеси и, таким образом, представляет собой ДНК фармацевтического качества. Другая цель настоящего изобретения относится к способу разделения и очистки нуклеиновых кислот и плазмидной ДНК. Более подробно, она относится к способу разделения нуклеиновых кислот и плазмидной ДНК фармацевтического качества, которая является полезной для исследования и плазмидной терапии. Препарат плазмидной ДНК, выделенный согласно способам по изобретению, может быть подвергнут стадиям очистки, которые включают по меньшей мере хроматографию с образованием тройной спирали и дополнительно могут включать анионообменную хроматографию и гидрофобную хроматографию. Таким образом, эти способы включают стадию непрерывного щелочного лизиса, раскрытую в данном описании, в сочетании с последующей анионообменной хроматографией и хроматографией с образованием тройной спирали, и дополнительно гидрофобной хроматографией. Эти способы, таким образом, также включают стадию непрерывного щелочного лизиса, раскрытую в данном описании, в сочетании с последующими стадиями анионообменной хроматографии и хроматографии с образованием тройной спирали, и в сочетании с гидрофобной хроматографией. Фильтрация лизата или другое удаление хлопьевидного осадка может предшествовать первой хроматографической стадии. Другая цель изобретения состоит в максимизации выхода плазмидной ДНК из комбинации клеткахозяин/плазмидная ДНК. Другая цель изобретения состоит в получении препарата плазмидной ДНК, который, по существу,не содержит РНК бактериального хозяина. Другая цель изобретения состоит в получении препарата плазмидной ДНК, который, по существу,не содержит белок бактериального хозяина. Другая цель изобретения состоит в получении препарата плазмидной ДНК, который, по существу,не содержит хромосомную ДНК бактериального хозяина. Другая цель изобретения состоит в получении препарата плазмидной ДНК, который, по существу,не содержит эндотоксины бактериального хозяина. Другая цель изобретения состоит в том, чтобы предложить способ получения плазмидной ДНК фармацевтического качества с высокой степенью чистоты для применения в научном исследовании и плазмидной терапии, поддающийся масштабированию до крупномасштабного производства. Изобретение, таким образом, охватывает плазмидную ДНК фармацевтического качества, которая,по существу, не содержит примесей, высокоочищенную и интактную, и имеет преимущества над предшествующим уровнем техники, ДНК, которая включает векторную основу, терапевтический ген и связанные с ним регуляторные последовательности. Настоящее изобретение также относится к жидкому препарату плазмидной ДНК, который является стабильным и не деградирует при комнатной температуре в течение длительного периода времени и,таким образом, является полезным для хранения плазмидной ДНК, которую используют в научном исследовании и связанной с ним терапии человека.-4 009447 Наконец, настоящее изобретение относится к устройству для непрерывного щелочного лизиса клеток, включающему первый смеситель или инжектор, способный впрыскивать щелочную жидкость в направлении, противоположном движению клеточной суспензии, первую трубку малого диаметра для того,чтобы создавать турбулентный поток в смеси, вторую трубку большого диаметра для того, чтобы создавать ламинарный поток в жидкости, второй смеситель или инжектор для впрыскивания нейтрализующего раствора на одном конце и сбора смеси на другом конце. Дополнительные цели и преимущества изобретения будут изложены частично в описании, которое следует ниже, а частично будут очевидны из описания, или их можно узнать путем применения изобретения на практике. Цели и преимущества изобретения будут воплощены и достигнуты с помощью элементов и комбинаций, конкретно указанных в прилагаемой формуле изобретения. Следует понимать, что как вышеизложенное общее описание, так и последующее подробное описание являются лишь примерными и поясняющими и не ограничивают заявленное изобретение. Сопровождающие рисунки, которые включены в это описание и составляют его часть, иллюстрируют одно (несколько) воплощение (воплощений) изобретения и вместе с описанием служат для объяснения принципов изобретения. Краткое описание графических материалов На фиг. 1 представлена схема прибора, который можно использовать для непрерывного способа лизиса клеток по изобретению. На фиг. 2 - схема смесителя М 1 в приборе для непрерывного лизиса клеток. На фиг. 3 представлена таблица сравнения выходов очистки в отношении гДНК, РНК, белков, эндотоксиновых примесей, с применением одной стадии анионообменной хроматографии (АЕС), или двухстадийного способа со стадией анионообменной хроматографии в сочетании с аффинной хроматографией с образованием тройной спирали (ТНАС), и трехстадийного способа, включающего стадию анионообменной хроматографии, стадию аффинной хроматографии с образованием тройной спирали в сочетании со стадией гидрофобной хроматографии (HIC). НО означает не обнаружен: аналитические методы низкой чувствительности. На фиг. 4 - таблица сравнения различных способов разделения и очистки плазмидной ДНК, таких как анионообменная хроматография (АЕС), НАС, гидроксиапатитная хроматография (НАС), гидрофобная хроматография (HIC), обращенно-фазная хроматография (RPC), гель-фильтрация (SEC), аффинная хроматография с образованием тройной спирали (ТНАС) отдельно или в сочетании, и способ по настоящему изобретению. Результаты представлены здесь с точки зрения качества очищенной плазмидной ДНК. НО - не обнаружен (аналитические методы низкой чувствительности). На фиг. 5 А и 5 Б представлены графики, показывающие скорости депуринизации и образования однонитевых разрывов (образование открытой кольцевой формы плазмиды) плазмидной ДНК, хранящейся при +25 С и +5 С в течение вплоть до 90 дней. Определения Кислотный означает относящийся к кислоте или содержащий кислоту; имеющий рН менее 7. Щелочной означает относящийся к щелочи или основанию, или содержащий щелочь или основание; имеющий рН более 7. Непрерывный означает не прерываемый, не имеющий перерывов. Геномная ДНК означает ДНК, которая происходит из хромосомы или находится в хромосоме. Ламинарный поток означает тип потока в токе воды раствора, в котором каждая частица движется в направлении, параллельном каждой частице. Лизат означает материал, образующийся в процессе лизиса клеток. Термин лизис относится к действию разрушения клеточной стенки и/или клеточной мембраны клетки, которая находится в забуференном растворе (т.е. клеточная суспензия), посредством химической обработки с использованием раствора,содержащего лизирующий агент. Лизирующие агенты включают, например, щелочь, детергенты, органические растворители и ферменты. В предпочтительном воплощении клеточный лизис осуществляют для высвобождения интактных плазмид из клеток-хозяев. Нейтрализует, чтобы сделать (раствор) нейтральным или чтобы вызвать нейтрализацию (кислоты или основания/щелочи). Под этим термином авторы подразумевают, что нечто, нейтрализующее раствор,доводит рН раствора до рН от 5 до 7, и предпочтительно приблизительно 7 или более, предпочтительно ближе к 7, чем ранее. Ньютоновская жидкость представляет собой жидкость, в которой напряжение сдвига пропорционально градиенту скорости и перпендикулярно плоскости сдвига. Константа пропорциональности известна как вязкость. Примеры ньютоновских жидкостей включают жидкости и газы. Неньютоновская жидкость представляет собой жидкость, в которой напряжение сдвига не пропорционально исключительно градиенту скорости и перпендикулярно плоскости сдвига. Неньютоновские жидкости могут не иметь точно определенной вязкости. Неньютоновские жидкости включают пластичные твердые вещества, жидкости, подчиняющиеся экспоненциальному закону, вязко-эластичные жидкости (имеющие как вязкие, так и эластичные свойства) и жидкости с вязкостью, зависящей от времени. Плазмидная ДНК означает маленькое клеточное включение, состоящее из кольца ДНК, которое не-5 009447 является хромосомой, которое может обладать способностью включать фрагмент неэндогенной ДНК. Методы конструирования плазмид включают методы, описанные у Maniatis и др., Molecular Cloning, ALaboratory Manual, 2d, Cold Spring Harbor Laboratory Press (1989). Для целей настоящего изобретения термин поток относится к пропусканию жидкости с конкретной скоростью потока (например, литры в минуту) через смеситель, обычно под действием насоса. Следует отметить, что считают, что скорость потока через смеситель влияет на эффективность лизиса, осаждения и перемешивания."ДНК с однонитевыми разрывами" (nicked) и "релаксированная ДНК" означает, что ДНК не является суперскрученной. "Суперскрученная" ДНК представляет собой термин, хорошо понятный в данной области."Загрязняющая примесь" представляет собой любое вещество, от которого желательно отделить или выделить ДНК. Загрязняющие примеси включают, но не ограничиваются, белки клетки-хозяина,эндотоксин, ДНК и/или РНК клетки-хозяина. Понятно, что то, что рассматривают в качестве загрязняющей примеси, может зависеть от контекста, в котором используют на практике способы по изобретению."Загрязняющая примесь" может происходить или может не происходить из клетки-хозяина, т.е. она может быть или может не быть примесью клетки-хозяина."Выделение" или "очистка" первого компонента (такого как ДНК) означает обогащение первого компонента из других компонентов, с которыми первоначально обнаружен первый компонент. Степени желательной и/или получаемой очистки представлены в данном описании. Термины по существу не содержит и высокоочищенный определяют как примерно на 95% и предпочтительно более чем на 98,99% чистый или свободный от примесей, или содержащий менее 5% и предпочтительно менее 1-2% примесей. ДНК фармацевтического качества определяют в данном описании как препарат ДНК, который содержит не более примерно 5%, и предпочтительно не более примерно 1-2% клеточных компонентов, таких как мембраны клеток. Плазмидную ДНК фармацевтического качества определяют в данном описании как препарат ДНК,который содержит часть на миллион или млн-1 ( 0,0001%, т.е.0,0001 мг на 100 мг плазмидной ДНК) геномной ДНК, РНК или белковых примесей. Более точно, плазмидная ДНК фармацевтического качества означает в данном описании препарат ДНК, который содержит менее примерно 0,01%, или менее 0,001% и предпочтительно менее 0,0001%,или предпочтительно менее 0,00008% ( 0,00008%, т.е.0,00008 мг на 100 мг плазмидной ДНК) хромосомной ДНК или геномной ДНК. Плазмидная ДНК фармацевтического качества означает в данном описании препарат ДНК, который содержит менее примерно 0,01%, или менее 0,001% и предпочтительно менее 0,0001%, или предпочтительно менее 0,00002% ( 0,00002%, т.е.0,00002 мг на 100 мг плазмидной ДНК) примесей РНК. Плазмидная ДНК фармацевтического качества означает в данном описании препарат ДНК, который содержит менее примерно 0,0001%, и наиболее предпочтительно менее 0,00005% ( 0,00005%, т.е.0,00005 мг на 100 мг плазмидной ДНК) белковых примесей. ДНК фармацевтического качества означает в данном описании препарат ДНК, который содержит менее 0,1 EU (эндотоксиновая единица)/мг эндотоксинов. ДНК фармацевтического качества означает в данном описании препарат ДНК, который предпочтительно преобладает в кольцевой форме и более точно, который содержит более 80, 85, 90, 95 или более 99% замкнутой кольцевой формы плазмидной ДНК. Т-трубка относится к Т-образной конфигурации трубопровода, где Т-форма образована одной частью трубопровода, созданной в этой конфигурации, или более чем одной частью трубопровода, объединенной с образованием этой конфигурации. Т-трубка имеет три рукава и центральную часть, где рукава соединяются. Т-трубку можно использовать для смешивания ингредиентов, так как каждая из двух жидкостей может затекать в один из рукавов Т, сливаться в центральной части и вытекать из третьего рукава. Смешивание происходит при слиянии жидкостей. Турбулентный поток означает нерегулярное случайное движение частиц жидкости в направлении,поперечном направлению основного потока, при котором скорость в данной точке неравномерно изменяется по величине и направлению. Термин вязко-эластичный относится к жидкостям, имеющим как вязкие, так и эластичные свойства. Подробное описание изобретения Изобретение основано на открытии масштабируемого способа получения высокого выхода плазмидной ДНК фармацевтического качества. В частности, изобретение основано на открытии способа получения и выделения высокоочищенной плазмидной ДНК с использованием непрерывного щелочного лизиса клеток-хозяев. На первой стадии клетки-хозяева инокулируют, т.е. клетки, трансформированные плазмидной ДНК в фазе экспоненциального роста, высевают штрихом в чашки, содержащие среду LB, содержащую антибиотики, такие как тетрациклин. Затем каждую из одиночных колоний из чашки инокулируют в 20 мл-6 009447 среды LB, дополненной подходящим антибиотиком тетрациклином, в отдельную стерильную пластиковую колбу Эрленмейера и выращивают в течение 12-16 ч при 37C во встряхиваемом инкубаторе. Одну из этих культур затем использовали для инокуляции 200 мл стерильной среды LB, добавленной в 2 л колбы Эрленмейера. Ее выращивали при 37 С и 200 об./мин во встряхиваемом инкубаторе и использовали для инокуляции двух 5 л колб Эрленмейера, и выращивали при 30 С и 200 об./мин во встряхиваемом инкубаторе и использовали для инокуляции ферментера, когда клетки находились в средней фазе экспоненциального роста, через 5 ч и при OD600 нм, составляющей 2 единицы. Культуры клеток-хозяев и инокуляция хорошо известны в данной области. Обычно клетки-хозяева выращивают до тех пор, пока они не достигают большой биомассы, и клетки находятся в фазе экспоненциального роста для того, чтобы иметь большое количество плазмидной ДНК. Можно использовать два различных способа, например периодическое культивирование и периодическое культивирование с подпиткой. Периодическое культивирование позволяет контролировать скорость роста посредством манипуляции температурой роста и используемым источником углерода. Термин "периодическое культивирование", используемый в данном описании, означает способ культивирования клеток, при котором все питательные вещества, необходимые для роста клеток и для получения плазмид, содержащихся в культивируемых клетках, находятся в сосуде во время инокуляции в большом избытке (например, 10-кратное превышение концентраций питательных веществ над концентрациями питательных веществ из предшествующего уровня техники), посредством чего устраняется необходимость делать добавки в стерильный сосуд после пост-стерилизационных добавок и необходимость в сложных моделях и стратегиях подпиток. Другим типом культивирования, полезным согласно изобретению, является культивирование с подпиткой, при котором скорость роста клеток контролируют добавлением питательных веществ в культуру в течение роста клеток. Термин "культивирование с подпиткой", используемый в данном описании,относится к способу культивирования клеток, при котором скорость роста контролируют при помощи тщательно отслеживаемых добавок метаболитов в культуру в процессе культивирования. Культивирование с подпиткой согласно изобретению позволяет культуре клеток достигать более высокой биомассы,чем периодическое культивирование. Примеры способа культивирования и примерные скорости добавления подпиток описаны ниже для 50 л препарата. Однако, используя примерные скорости подпиток, описанные ниже, также можно обрабатывать и другие объемы, например, 10 л, 50 л или более 500 л, в зависимости от размера обрудования. Периодическое культивирование в высокообогащенной среде и культивирование в среде с подпиткой являются подходящими для получения культуры клеток с высокой плотностью с максимизацией специфического выхода плазмиды и обеспечением сбора клеток при высокой биомассе, которые все еще находятся в фазе экспоненциального роста. При культивировании с подпиткой в качестве источника углерода используют глюкозу или глицерин. Культивирование с подпиткой протекает до тех пор, пока не будет израсходован первоначальный углеродный субстрат (глюкоза). Эту точку замечают по внезапному увеличению DO (растворенного кислорода, dissolved oxygen) и подтверждают анализом на глюкозу образца, взятого сразу после этого события. Затем запускают насос, заранее наполненный подпиточной средой. Скорость насоса определяют с помощью модели, описанной Curless и др. (Bioeng. 38:1082-1090, 1991), которая целиком включена в данное описание изобретения посредством ссылки. Модель предназначена для того, чтобы облегчить контроль за фазой подпитки в способе культивирования с подпиткой. При исходном периодическом способе неингибирующая концентрация субстрата потребляется клетками, растущими с максимальной для них специфической скоростью роста (max), давая быстрое увеличение уровней биомассы после инокуляции. Культура не может расти с этой скоростью неопределенно долго из-за накопления токсических метаболитов (Fieschio et al., "Fermentation Technology Using Recombinant Microorganisms." In Biotechnology,eds. H. J. Rhem and G. Reed. Weinheim: VCH Verlagsgesellschaft mbH 7b: 117-140, 1989). Для обеспечения непрерывного логарифмического роста в этой модели рассчитывают зависимую от времени скорость подпитки рост-лимитирующим углеродным субстратом без необходимости контроля по типу обратной связи, чтобы задать рост во время фазы подпитки на уровне, установленном оператором. Его выбирают на уровне, который не приводит к образованию ингибирующих катаболитов и является достаточным для получения высокой биомассы. Обычно при периодическом культивировании используют высокие уровни (например, в 4 раза более высокие концентрации, чем концентрации, известные из уровня техники) предшественников, присутствующих в обогащенной среде для подпитки. В частности, количества дрожжевого экстракта в среде для подпитки увеличивали от 5 г/л (как в среде LB) до 20 г/л, обеспечивая, таким образом, огромные количества ростовых факторов и предшественников нуклеиновых кислот. Среду также дополняли сульфатом аммония (5 г/л), который действует в качестве источника органического азота. Добавки предшественников (органического азота в форме сульфата аммония) в процессе подпитки при культивировании с подпиткой предназначены для предупреждения вредных воздействий на качество плазмид.-7 009447 Одним из важных аспектов способа по настоящему изобретению является лизис клеток. Таким образом, настоящее изобретение охватывает способ продуцирования и выделения высокоочищенной плазмидной ДНК, который включает стадию лизиса клеток, при котором имеется (а) средство для создания турбулентного потока с целью быстрого смешивания клеточной суспензии (раствор 1 на фиг. 1), с раствором, который лизирует клетки (раствор 2 на фиг. 1); и (б) средство для создания ламинарного потока с целью обеспечения инкубации смеси, образующейся в (а), без существенного встряхивания, где смесь,образующаяся в (а), течет из средства для создания турбулентного потока в средство для создания ламинарного потока. Согласно одному воплощению изобретения, устройство может дополнительно включать средство для добавления второго раствора, который нейтрализует лизирующий раствор (раствор 3 на фиг. 1), где смесь, инкубируемая в (б), течет из средства для создания ламинарного потока в средство для добавления второго раствора. В еще одном воплощении может быть использовано устройство в способе выделения из клеток плазмидной ДНК, включающем: (а) смешивание клеток с щелочным лизирующим раствором в средстве для создания турбулентного потока; и (б) нейтрализацию щелочного лизирующего раствора путем добавления кислотного раствора. Несмотря на многочисленные способы, используемые в настоящее время для лизиса бактериальных клеток, ни один из них не решает проблем, вызванных вязко-эластичными свойствами жидкостей и напряжениями сдвига, возникающими во время стадий перемешивания. Одной из целей настоящего изобретения является способ применения Т-трубок для однородного и очень быстрого смешивания клеточной суспензии (раствор 1) и щелочного раствора (раствор 2) перед тем, как появится вязко-эластичная жидкость. Таким образом, непрерывный лизис согласно настоящему изобретению обеспечивает главное преимущество в ограничении сил сдвига. Т-трубки обычно имеют малый диаметр трубок, обычно диаметр менее 1 см, предпочтительно примерно от 2 до 8 мм, и наиболее предпочтительно приблизительно 6 мм для того, чтобы увеличить время контакта перемешиваемых жидкостей, но в этом способе не используют перемешивание, индуцированное пропусканием через трубку. В табл. 1 здесь ниже показано изменение параметров В 1 а, B1b, B2, соответственно, средства для создания турбулентного потока, ламинарного потока и турбулентного потока и соответствующие им скорости потока S1, S2 и S3, как показано на фиг. 1. Таблица 1 Другим объектом настоящего изобретения является смеситель или инжектор с трубками вместо Ттрубки, которые обеспечивают диспергирование клеток в лизирующем растворе. Соответственно, механическое напряжение, действующее на жидкости, которые проходят через трубки, значительно снижено по сравнению с тем, когда жидкости перемешивают, например, при помощи лопастей в емкостях. Первоначальная эффективность перемешивания приводит даже к большей эффективности в последующие секунды, так как эта жидкость еще не имеет вязко-эластичных свойств, и перемешивание, осуществляемое с помощью трубки малого диаметра, является очень эффективным. Напротив, когда для перемешивания используют Т-трубку, первоначальное перемешивание является только умеренным, в то время как жидкости быстро становятся вязко-эластичными, что приводит к значительным проблемам при протекании в трубке. Это частичное перемешивание приводит к лизису лишь части клеток и, следовательно, может высвобождать только часть плазмид перед нейтрализацией. Согласно настоящему изобретению, авторы идентифицировали две фазы во время лизиса, названные фазой I и фазой II. Эти две фазы соответствуют I) лизису клеток и II) денатурации нуклеиновых кислот, вызывающей сильное изменение реологического поведения, которое дает в результате вязкоэластичную жидкость. Коррекция диаметров трубок делает возможным их соответствие требованиям этих двух фаз. В трубке малого диаметра (В 1 а) перемешивание усиливается. Это конфигурация, используемая для фазы I. В трубке большого диаметра (В 1b) перемешивание (и, таким образом, напряжение сдвига) ослабевает. Это конфигурация, используемая для фазы II. Соответственно, авторы изобретения используют смеситель, названный М 1, как изображено на фиг. 2. Для обеспечения диспергирования клеточной суспензии согласно настоящему изобретению также можно использовать любое Т-образное устройство. С помощью этого смесителя раствор 1 впрыскивают против тока в щелочной лизирующий раствор через одно или более чем одно отверстие малого диаметра для того, чтобы обеспечить эффективное диспергирование. Диаметры этих отверстий в изображенной конфигурации составляют примерно от 0,5 до 2 мм и предпочтительно примерно 1 мм. Смесь выходит из смесителя М 1 для того, чтобы пройти через трубку малого диаметра (фиг. 1) за-8 009447 короткий период времени (примерно 2,5 с). Комбинацию диаметра и времени потока можно легко рассчитать с целью поддержания турбулентного потока. Примеры изменений этих параметров даны в табл. 1. Во всех ссылках на диаметр трубки дается внутренний диаметр трубки, а не наружный диаметр, который включает толщину стенок самой трубки. Это короткое время пребывания в трубке обеспечивает очень быструю гомогенизацию растворов 1 и 2. Полагая, что раствор 1 и раствор 2 все еще являются ньютоновскими жидкостями во время фазы I, тип потока в течение фазы гомогенизации является турбулентным. На выходе из этой трубки растворы 1 и 2 являются гомогенизированными, и в суспензии начинается лизис клеток. Гомогенизированная смесь затем проходит через вторую трубку (В 1b) значительно большего диаметра (фиг. 1), в которой происходит лизис клеток и образование вязко-эластичной жидкости. Во время этой фазы перемешивание может быть минимизировано и раствору можно дать "успокоиться" с целью ограничения турбулентности насколько это возможно и с тем, чтобы уменьшить любое напряжение сдвига, которое в противном случае фрагментировало бы гДНК. В одном воплощении настоящего изобретения для завершения лизиса клеток и для денатурации нуклеиновых кислот достаточным является время контакта примерно от 1 до 3 мин, приблизительно 2 мин и предпочтительно 1 мин 20 с. Во время фазы денатурации тип потока жидкости является ламинарным, что способствует медленной диффузии ДСН и гидроксида натрия в клеточные компоненты. Полученный таким образом лизат и нейтрализующий раствор 3 затем смешивают при помощи Yсмесителя, названного М 2. В одном воплощении настоящего изобретения внутренний диаметр Yсмесителя составляет примерно от 4 до 15 мм или примерно от 6 до 10 мм и может составлять приблизительно 6 мм или приблизительно 10 мм. Трубка малого диаметра (например, примерно 6 мм трубка) расположена на выходе из Y-смесителя с целью обеспечения быстрого (менее 1 с) и эффективного смешивания лизата с раствором 3. Нейтрализованный раствор затем собирают в сборной емкости. Во время нейтрализации быстрое снижение рН индуцирует образование хлопьевидного осадка (т.е. образование комков или масс). С другой стороны, частично денатурированная плазмида очень быстро ренатурирует и остается в растворе. Хлопья постепенно оседают в сборной емкости, унося с собой основную массу примесей. На схематическом чертеже на фиг. 1 показано одно из воплощений системы непрерывного лизиса(НЛ). Непрерывный лизис можно использовать сам по себе или с дополнительными процессами. Способ по настоящему изобретению можно использовать для лизиса любого типа клеток (т.е. прокариотических или эукариотических) для любой цели, относящейся к лизису, такой как высвобождение желательной плазмидной ДНК из целевых клеток для последующей очистки. В предпочтительном воплощении способ по настоящему изобретению используют для лизиса клеток-хозяев, содержащих плазмиды, с высвобождением плазмид. Способ непрерывного щелочного лизиса согласно настоящему изобретению можно осуществлять на клетках, собранных из культуры, которую выращивали до биомассы клеток, которые еще не достигли стационарной фазы и, таким образом, находятся на стадии экспоненциального роста (2-10 г сухой массы/л). Стадию непрерывного щелочного лизиса также можно осуществлять на клетках, собранных из культуры, которую выращивали до высокой биомассы клеток, и которые больше не находятся на стадии экспоненциального роста, но достигли стационарной фазы, с концентрацией клеток приблизительно 10200 г сухой массы на литр и предпочтительно 10-60 г сухой массы на литр. Изобретение дополнительно охватывает способ получения и выделения высокоочищенной плазмидной ДНК, которая, по существу, не содержит примеси и, таким образом, представляет собой ДНК фармацевтического качества. Плазмидная ДНК, полученная и выделенная способом по изобретению,содержит очень низкие уровни, т.е. часть на миллион (млн-1) загрязняющих хромосомной ДНК, РНК,белка и эндотоксинов, и содержит, главным образом, замкнутую кольцевую форму плазмидной ДНК. Плазмидная ДНК, полученная согласно изобретению, имеет достаточную чистоту для применения в научном исследовании и плазмидной терапии. Способ по изобретению включает стадии очистки, включающие аффинную хроматографию с образованием тройной спирали с дополнительной стадией ионообменной хроматографии, и дополнительно может включать гидрофобную хроматографию или гель-фильтрацию. Стадия ионообменной хроматографии может представлять собой как ионообменную хроматографию в псевдоожиженном слое, так и аксиальную и/или радиальную анионообменную хроматографию высокого разрешения. Таким образом, этот способ включает стадию щелочного лизиса, раскрытую в данном описании, в сочетании с последующими стадиями ионообменной хроматографии, аффинной хроматографии с образованием тройной спирали и гидрофобной хроматографии, осуществляющимися в указанном порядке. Фильтрация лизата или иное удаление хлопьевидного осадка могут предшествовать первой хроматографической стадии. Способы по изобретению для очистки плазмидной ДНК, раскрытые в данном описании, являются масштабируемыми и, таким образом, подходящими для расширения до крупномасштабного производства. В некоторых воплощениях изобретения непрерывный лизис можно комбинировать с дополнительными стадиями очистки для того, чтобы получить продукт с высокой степенью чистоты, содержащий-9 009447 пДНК. Его можно, например, комбинировать, по меньшей мере, с удалением хлопьевидного осадка (таким как фильтрация лизата, осаждение отстаиванием или центрифугирование), ионообменной хроматографией (такой как катионо- или анионообменная), триплексной аффинной хроматографией и гидрофобной хроматографией. В одном воплощении после непрерывного лизиса следуют анионообменная хроматография, триплексная аффинная хроматография и гидрофобная хроматография в указанном порядке. В другом воплощении после непрерывного лизиса следуют фильтрация лизата, анионообменная хроматография, триплексная аффинная хроматография и гидрофобная хроматография в указанном порядке. Эти стадии обеспечивают действительно масштабный способ производства плазмид, с помощью которого можно получать большие количества пДНК беспрецедентной чистоты. ДНК и РНК хозяина, а также белки находятся в интервале очень низких концентраций. В способе по настоящему изобретению также можно использовать дополнительные стадии гельфильтрации, обращенно-фазной хроматографии, гидроксиапатитной хроматографии и т.д. в сочетании со стадиями, раскрытыми в данном описании согласно настоящей заявке. Удаление хлопьевидного осадка можно использовать для обеспечения более высокой чистоты получаемого в результате продукта пДНК. Эту стадию можно использовать для удаления основной массы выпавшего в осадок материала (флокулята). Один способ удаления хлопьевидного осадка осуществляют посредством стадии фильтрации лизата, например, через 1-5 мм и предпочтительно через 3,5 мм сетчатый фильтр с последующей объемной фильтрацией в качестве конечной стадии фильтрации. Другие способы удаления хлопьевидного осадка осуществляют посредством центрифугирования или осаждения отстаиванием. Ионообменную хроматографию можно использовать для обеспечения более высокой чистоты получаемого в результате продукта пДНК. Анионообменная хроматография может быть выбрана в зависимости от свойств примесей и рН раствора. Анионообменную хроматографию можно использовать для обеспечения более высокой чистоты получаемого в результате продукта пДНК. Анионообменная хроматография функционирует путем связывания отрицательно заряженных (или кислотных) молекул с носителем, который является положительно заряженным. Использование ионообменной хроматографии затем делает возможным разделение молекул на основе их заряда. Семейства молекул (кислотные вещества, щелочные вещества и нейтральные вещества) можно легко разделить с помощью этой методики. Можно использовать схемы ступенчатой элюции, при этом многочисленные примеси элюируются в ранних фракциях, а пДНК элюируется в более поздних фракциях. Анионообменная хроматография является очень эффективной для удаления белка и эндотоксина из препарата пДНК. Что касается ионообменной хроматографии, то наполнитель и способ получения такого материала,а также способ получения, полимеризации и функционализации анионообменной хроматографии, и элюция, и разделение плазмидной ДНК посредством этого хорошо известны в данной области. Соединения, которые используются для синтеза основных материалов, используемых в качестве наполнителя для анионообменной хроматографии, могут представлять собой любые соединения, если различные функциональные группы, проявляющие гидрофобность, или различные ионообменные группы могут быть введены в них посредством последующей реакции после того, как будут синтезированы основные материалы. Примеры монофункциональных мономеров включают в себя стирол, ортогалогенометилстирол, мета-галогенометилстирол, пара-галогенометилстирол, орто-галогеноалкилстирол,мета-галогеноалкилстирол,пара-галогеноалкилстирол,-метилстирол,-метил-орто-галогенометилстирол, -метил-мета-галогенометилстирол, -метил-пара-галогенометилстирол, -метил-ортогалогеноалкилстирол, -метил-мета-галогеноалкилстирол -метил-пара-галогеноалкилстирол, ортогидроксиметилстирол,мета-гидроксиметилстирол,пара-гидроксиметилстирол,орто-гидроксиалкилстирол,мета-гидроксиалкилстирол,пара-гидроксиалкилстирол,-метил-орто-гидроксиметилстирол, -метил-мета-гидроксиметилстирол, -метил-пара-гидроксиметилстирол, -метил-ортогидроксиалкилстирол, -метил-мета-гидроксиалкилстирол, -метил-пара-гидроксиалкилстирол, глицидилметакрилат, глицидилакрилат, гидроксиэтилакрилат, гидроксиметакрилат и винилацетат. Наиболее предпочтительными соединениями являются галогеноалкильные группы, замещенные на ароматическом кольце, галогены, такие как Cl, Br, I и F, и насыщенные углеводороды с прямой или разветвленной цепью с количеством атомов углерода от 2 до 15. Примеры полифункциональных мономеров включают в себя дивинилбензол, тривинилбензол, дивинилтолуол, тривинилтолуол, дивинилнафталин, тривинилнафталин, этиленгликольдиметакрилат, этиленгликольдиакрилат, диэтиленгликольдиметакрилат, диэтиленгликольдиакрилат, метиленбисметакриламид и метиленбисакриламид. Различные ионоообменные группы могут быть введены с помощью последующей реакции. Получение основного материала включает первую стадию, где монофункциональный мономер и полифункциональный мономер взвешивают в подходящем соотношении и добавляют точно взвешенный разбавитель или растворитель, которые используются в целях регуляции размера пор в образующихся частицах,и, аналогично, точно взвешенный инициатор полимеризации, с последующим тщательным перемешиванием. Смесь затем подвергают полимеризации суспензии типа масло в воде, где смесь добавляют в зара- 10009447 нее точно взвешенный стабилизатор суспензии, растворенный в водном растворе, и капельки масла желательного размера образуются путем перемешивания мешалкой, и полимеризацию осуществляют путем постепенного нагревания перемешанного раствора. Отношение монофункционального мономера к полифункциональному мономеру обычно составляет приблизительно 1 моль монофункционального мономера и примерно от 0,01 до 0,2 моль полифункционального мономера для того, чтобы получить мягкие частицы основного материала. Также нет особых ограничений для инициатора полимеризации, и используют обычно применяемые инициаторы азобис типа и/или пероксидного типа. Для предотвращения агрегации между самими капельками масла также можно использовать стабилизаторы суспензии, такие как ионные поверхностно-активные вещества, неионные поверхностноактивные вещества, полимеры с амфипатическими свойствами и их смеси. Предпочтительно, чтобы наполнитель, используемый для ионообменной хроматографии для очистки плазмидных ДНК, имел относительно большой диаметр пор, особенно в интервале от 1500 до 4000 . Поверхностные модификации для введения ионообменных групп в основные материалы хорошо известны в данной области. Для ионообменной хроматографии можно использовать два типа элюентов. Можно использовать первый элюент, содержащий низкую концентрацию соли, и второй элюент, содержащий высокую концентрацию соли. Способ элюции состоит в ступенчатом переходе от первого элюента ко второму элюенту или в способе градиентной элюции, непрерывно изменяющем состав от первого элюента до второго элюента. Можно использовать буферы и соли, которые обычно используют в этих элюентах для ионообменной хроматографии. Для первого элюента, содержащего низкую концентрацию соли, особенно предпочтительным является водный раствор с концентрацией буфера от 10 до 50 мМ и значением рН от 6 до 9. Для второго элюента, содержащего высокую концентрацию соли, особенно предпочтительным является водный раствор с 0,1-2 М натриевой солью, добавленной к элюенту. Что касается натриевых солей,можно использовать хлорид натрия и сульфат натрия. Кроме того, для ингибирования деградации плазмид, обусловленной ферментами, разрушающими ДНК в лизате Escherichia coli, можно использовать хелатирующий агент для ионов двухвалентных металлов, такой как, например, этилендиаминтетрауксусная кислота. Концентрация хелатирующего агента для ионов двухвалентных металлов предпочтительно составляет от 0,1 до 100 мМ. Для применения в настоящем изобретении подходит широкий спектр имеющихся в продаже анионообменных матриц, включая, но не ограничиваясь этим, матрицы, доступные от POROS Anion ExchangeResins, Qiagen, Toso Haas, Sterogene, Spherodex, Nucleopac и Pharmacia. Например, колонку (Poros II Pl/M,4,5 мм 100) сначала уравновешивают 20 мМ Bis/Трис-пропаном при рН 7,5 и 0,7 М NaCl. Образец наносят и промывают тем же исходным буфером. Затем применяют градиент элюции от 0,5 М до 0,85 М NaCl примерно в 25 объемах колонки и собирают фракции. Предпочтительная анионообменная хроматография включает Fractogel TMAE HiCap. Согласно предпочтительному воплощению способа разделения и очистки плазмидной ДНК, настоящее изобретение относится к способу разделения и очистки нуклеиновых кислот и/или плазмидной ДНК с помощью ионообменной хроматографии в сочетании с хроматографией с образованием тройной спирали для эффективного получения нуклеиновых кислот с высокой чистотой и в большом количестве. Аффинная хроматография с образованием тройной спирали описана, в частности, в патентах США 6319672, 6287762, а также в международной заявке на патент данного заявителя, опубликованной под номером WO 02/77274. Аффинная хроматография с образованием тройной спирали основана на специфической гибридизации олигонуклеотидов и целевой последовательности в двухцепочечной ДНК. Эти олигонуклеотиды могут содержать следующие основания: тимидин (Т), который может образовывать триплеты с дублетами А.Т двухцепочечной ДНК (Rajagopal et al., Biochem 28 (1989) 7859); аденин (А), который может образовывать триплеты с дублетами А.Т двухцепочечной ДНК; гуанин (G), который может образовывать триплеты с дублетами G.C двухцепочечной ДНК; протонированный цитозин (С+), который может образовывать триплеты с дублетами G.C двухцепочечной ДНК (Rajagopal et al., loc. cit); урацил (U), который может образовывать триплеты с парами оснований A.U или А.Т. Предпочтительно используемый олигонуклеотид содержит обогащенную цитозином гомопиримидиновую последовательность, а специфическая последовательность, присутствующая в ДНК, представляет собой гомопурин-гомопиримидиновую последовательность. Присутствие цитозинов делает возможным образование тройной спирали, которая стабильна при кислом рН, когда цитозины протонированы, и дестабилизируется при щелочном рН, когда цитозины нейтрализуются. Олигонуклеотид и специфическая последовательность, присутствующая в ДНК, предпочтительно являются комплементарными для того, чтобы обеспечить образование тройной спирали. Лучшие выходы и лучшую селективность можно получить, используя олигонуклеотид и специфическую последовательность, которые являются полностью комплементарными. Например, олигонуклеотид поли(СТТ) и специфическая последовательность поли(GAA). Предпочтительные олигонуклеотиды имеют последова- 11009447 тельность 5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (GAGG(CTT)7 (SEQ ID NO:1), в которой основанияGAGG не образуют тройной спирали, но позволяют олигонуклеотиду находиться на некотором расстоянии от связывающего плеча; последовательность (СТТ)7. Эти олигонуклеотиды способны образовывать тройную спираль со специфической последовательностью, содержащей комплементарные единицы(GAA). Рассматриваемая последовательность может, в частности, представлять собой область, содержащую 7, 14 или 17 единиц GAA, как описано в примерах. Другой последовательностью, представляющей особый интерес, является последовательность 5'AAGGGAGGGAGGAGAGGAA-3' (SEQ ID NO: 2). Эта последовательность образует тройную спираль с олигонуклеотидами 5'-AAGGAGAGGAGGGAGGGAA-3'NO: 3) или 5'TTGGTGTGGTGGGTGGGTT-3' (SEQ ID NO: 4). В этом случае олигонуклеотид связывается с полипуриновой цепью в антипараллельной ориентации. Эти тройные спирали стабильны только в присутствииMg2+ (Vasquez et al., Biochemistry, 1995, 34, 7243-7251; Beal and Dervan, Science, 1991, 251, 1360-1363). Как указано выше, специфическая последовательность может быть природной последовательностью, присутствующей в двухцепочечной ДНК, или синтетической последовательностью, искусственно введенной в последнюю. Особенно полезным является применение олигонуклеотида, способного образовывать тройную спираль с природной последовательностью, присутствующей в двухцепочечной ДНК,например, в точке инициации репликации плазмиды или в маркерном гене. В этом отношении из анализа последовательности известно, что некоторые области этих ДНК, особенно в точке инициации репликации, могут обладать гомопурин-гомопиримидиновыми участками. Синтез олигонуклеотидов, способных образовывать тройные спирали с этими природными гомопурин-гомопиримидиновыми участками, преимущественно делает возможным применение способа по изобретению к немодифицированным плазмидам, в частности, к коммерческим плазмидам типа pUC, pBR322, pSV и тому подобного. Среди гомопурин-гомопиримидиновых последовательностей, имеющихся в природе в двухцепочечной ДНК, можно упомянуть последовательность,содержащую всю или часть последовательности 5'CTTCCCGAAGGGAGAAAGG-3' (SEQ ID NO: 5), присутствующей в точке инициации репликации плазмиды ColE1 E. coli. В этом случае олигонуклеотид, образующий тройную спираль, обладает последовательностью: 5'-GAAGGGCTTCCCTCTTTCC-3' (SEQ ID NO: 6) и связывается поочередно с двумя цепями двойной спирали, как описано Beal and Dervan (J. Am. Chem. Soc. 1992, 114, 4976-4982) и Jayasena andJohnston (Nucleic Acids Res. 1992, 20, 5279-5288). Также можно упомянуть последовательность 5'GAAAAAGGAAGAG-3' (SEQ ID NO: 7) -лактамазного гена плазмиды pBR322 (Duval-Valentin et al.,Proc. Natl. Acad. Sci. USA, 1992, 89, 504-508). Подходящие целевые последовательности, которые могут образовывать триплексные структуры с конкретными олигонуклетидами, были идентифицировали в точках инициации репликации плазмидColE1, а также плазмид pCOR. Плазмиды pCOR представляют собой плазмиды с условной точкой инициации репликации и, в частности, описаны в US 2004/142452 и US 2003/161844. Происходящие из(SEQ ID NO: 8), картированную выше от транскрипта RNA-II, участвующего в репликации плазмиды(Lacatena et al., 1981, Nature, 294, 623). Эта последовательность образует стабильную триплексную структуру с 12-мерным комплементарным олигонуклеотидом 5'-ТСТТТТТТТССТ-3' (SEQ ID NO: 9). ОсноваpCOR содержит гомопуриновый отрезок из 14 неповторяющихся оснований (5'-AAGAAAAAAAAGAA3' (SEQ ID NO: 10), расположенный в А+Т-богатом участке точки инициации репликации у репликонаpCOR (Levchenko et al., 1996, Nucleic Acids Res., 24, 1936). Эта последовательность образует стабильную триплексную структуру с 14-мерным комплементарным олигонуклеотидом 5'-ТТСТТТТТТТТСТТ-3'(SEQ ID NO: 11). Соответствующие олигонуклеотиды 5'-ТСТТТТТТТССТ-3' (SEQ ID NO: 8) и 5'ТТСТТТТТТТТСТТ-3' (SEQ ID NO: 11) эффективно и специфически выявляют их соответствующие комплементарные последовательности, локализованные в точке инициации репликации либо ColE1 ori,либо pCOR (ori). На самом деле, одиночная неканоническая триада (TGC или САТ) может приводить к полной дестабилизации триплексной структуры. Применение олигонуклеотида, способного образовывать тройную спираль с последовательностью,находящейся в точке инициации репликации или в маркерном гене, является особенно полезным, так как оно делает возможным очистку любой ДНК, содержащей указанную точку инициации репликации или указанный маркерный ген, с использованием одного и того же олигонуклеотида. Следовательно, нет необходимости модифицировать плазмиду или двухцепочечную ДНК для того, чтобы включить в нее искусственную специфическую последовательность. Хотя полностью комплементарные последовательности и являются предпочтительными, однако понятно, что допустимы некоторые ошибочные спаривания оснований между последовательностью олигонуклеотида и последовательностью, присутствующей в ДНК, при условии, что они не приводят к слишком большой потере сродства. Можно упомянуть последовательность 5'AAAAAAGGGAATAAGGG-3' (SEQ ID NO: 12), присутствующую в -лактамазном гене Е. coli. В этом случае тимин, прерывающий полипуриновую последовательность, может быть распознан гуанином третьей цепи, в результате чего образуется триплет GTA, который стабилен в том случае, когда он- 12009447 фланкирован двумя триплетами ТАТ (Kiessling et al., Biochemistry, 1992, 31, 2829-2834). Согласно конкретному воплощению, олигонуклеотиды по изобретению содержат последовательность (ССТ)n, последовательность (СТ)n или последовательность (СТТ)n, в которых п представляет собой целое число от 1 до 15 включительно. Особенно полезным является применение последовательностей типа (СТ)n или (СТТ)n. В действительности заявитель показал, что на выход очистки влияло количество С в олигонуклеотиде. В частности, как показано в примере 7, выход очистки возрастает, когда олигонуклеотид содержит меньше цитозинов. Понятно, что олигонуклеотиды по изобретению также могут объединять единицы (ССТ), (СТ) или (СТТ). Используемый олигонуклеотид может быть природным (состоящим из немодифицированных природных оснований) или химически модифицированным. В частности, олигонуклеотид может преимущественно содержать определенные химические модификации, позволяющие увеличивать его устойчивость или его защиту против нуклеаз, или его сродство к специфической последовательности. Также понятно,что олигонуклеотид подразумевает любую связанную последовательность нуклеозидов, которая подверглась модификации скелета с целью сделать ее более устойчивой к нуклеазам. Среди возможных модификаций могут быть упомянуты фосфоротиоаты, которые способны образовывать тройные спирали с ДНК (Xodo et al., Nucleic Acids Res., 1994, 22, 3322-3330), а также олигонуклеотиды, обладающие формацетальными или метилфосфонатными скелетами (Matteucci et al., J. Am. Chem. Soc, 1991, 113, 77677768). Также можно использовать олигонуклеотиды, синтезированные с -аномерами нуклеотидов, которые также образуют тройные спирали с ДНК (Le Doan et al., Nucleic Acids Res., 1987, 15, 7749-7760). Другой модификацией скелета является фосфорамидатная связь. Например, можно упомянуть N3'-P5' межнуклеотидную фосфорамидатную связь, описанную Gryaznov и Chen, которая дает олигонуклеотиды,образующие особенно стабильные тройные спирали с ДНК (J. Am. Chem. Soc, 1994, 116, 3143-3144). Среди других модификаций скелета также можно упомянуть применение рибонуклеотидов, 2'-Ометилрибозы, фосфодизфира и т.д. (Sun and Helene, Curr. Opinion Struct. Biol., 116, 3143-3144). Наконец,скелет на основе фосфора можно заместить полиамидным скелетом, как в ПНК (пептидные нуклеиновые кислоты), которые также могут образовывать тройные спирали (Nielsen et al., Science, 1991, 254, 14971500; Kim et al., J. Am. Chem. Soc, 1993, 115, 6477-6481), или скелетом на основе гуанидина, как в ДНГ(дезоксирибонуклеиновый гуанидин, Proc. Natl. Acad. Sci. USA, 1995, 92, 6097-6101), или поликатионными аналогами ДНК, которые также образуют тройные спирали. Тимин третьей цепи также можно заместить 5-бромурацилом, который увеличивает сродство олигонуклеотида к ДНК (Povsic and Dervan, J. Am. Chem. Soc, 1989, 111, 3059-3061). Третья цепь также может содержать неприродные основания, среди которых можно упомянуть 7-деаза-2'-дезоксиксантозин(Milligan et al., Nucleic Acids Res., 1993, 21, 327-333), 1-(2-дезоксиD-рибофуранозил)-3-метил-5-амино 1H-пиразоло[4,3-d]пиримидин-7-он (Koh and Dervan, J. Am. Chem. Soc, 1992, 114, 1470-1478), 8 оксоаденин, 2-аминопурин, 2'-О-метилпсевдоизоцитидин или любую другую модификацию, известную специалисту в данной области (для обзора см. Sun and Helene, Curr. Opinion Struct. Biol., 1993,3,345-356). Другой тип модификации олигонуклеотида имеет более конкретную цель улучшения взаимодействия и/или сродства между олигонуклеотидом и специфической последовательностью. В частности, более предпочтительная модификация согласно изобретению состоит в метилировании цитозинов олигонуклеотида. Олигонуклеотид, метилированный таким образом, проявляет замечательное свойство образовывать стабильную тройную спираль со специфической последовательностью в интервале рН, более близком к нейтральному ( 5). Следовательно, он позволяет работать при более высоких значениях рН, чем олигонуклеотиды, известные из предшествующего уровня техники, то есть, при значениях рН, где риски деградации плазмидной ДНК намного меньше. Длина олигонуклеотида, используемого в способе по изобретению, составляет от 5 до 30 оснований. Преимущественно используют олигонуклеотид с длиной более 10 оснований. Длина может быть адаптирована специалистом в данной области для каждого индивидуального случая для того, чтобы она подходила для желательной селективности и стабильности взаимодействия. Олигонуклеотиды по изобретению могут быть синтезированы любым известным методом. В частности, они могут быть получены с помощью синтезаторов нуклеиновых кислот. Вполне очевидно, что может быть использован любой другой способ, известный специалисту в данной области. Для обеспечения ковалентного связывания олигонуклеотида с носителем, его обычно функционализируют. Так, он может быть модифицирован тиольной, амино- или карбоксильной концевой группой в положении 5' или 3'. В частности, добавление тиольной, амино- или карбоксильной группы делает возможным, например, связывание олигонуклеотида с носителем, несущим дисульфидные, малеимидные,амино-, карбоксильные, эфирные, эпоксидные, бромциановые или альдегидные функциональные группы. Эти связи формируются путем установления дисульфидных, тиоэфирных, эфирных, амидных или аминных связей между олигонуклеотидом и носителем. Можно использовать любой другой способ, известный специалисту в данной области, такой как, например, с применением бифункциональных связывающих реагентов. Кроме того, для улучшения гибридизации со связанным олигонуклеотидом может быть полезным,- 13009447 чтобы олигонуклеотид содержал последовательность оснований "плеча" и "спейсера". Применение плеча, в действительности, делает возможным связывание олигонуклеотида на выбранном расстоянии от носителя, обеспечивая улучшение условий его взаимодействия с ДНК. Плечо преимущественно состоит из линейной углеродной цепи, содержащей от 1 до 18 и предпочтительно от 6 до 12 групп (СН 2), и амина,который обеспечивает связывание с колонкой. Плечо связывается с фосфатом олигонуклеотида или"спейсера", состоящего из оснований, которые не препятствуют гибридизации. Таким образом, спейсер" может содержать пуриновые основания. В качестве примера, "спейсер" может содержать последовательность GAGG. Плечо преимущественно состоит из линейной углеродной цепи, содержащей 6 или 12 атомов углерода. Триплексная аффинная хроматография является очень эффективной для удаления РНК и геномной ДНК. Предпочтительно используют хроматографические носители. Они могут представлять собой функционализированные хроматографические носители без упаковки или предварительно упакованные в колонку, функционализированные пластиковые поверхности или функционализированные латексные шарики, магнитные или иные. В качестве примера, хроматографические носители, которые можно использовать, представляют собой агарозу, акриламид или декстран, а также их производные (такие какSephadex, Sepharose, Superose и т.д.), полимеры, такие как поли(стирол/дивинилбензол), или, например,привитый или непривитый диоксид кремния. Хроматографические колонки могут работать в диффузионном или перфузионном режиме. Для получения лучших выходов очистки особенно полезным является применение в плазмиде последовательности, содержащей несколько положений для гибридизации с олигонуклеотидом. Присутствие нескольких позиций гибридизации в действительности стимулирует взаимодействия между указанной последовательностью и олигонуклеотидом, что приводит к улучшению выходов очистки. Таким образом, для олигонуклеотида, содержащего n повторов мотивов (ССТ), (СТ) или (СТТ), предпочтительно использовать последовательность ДНК, содержащую по меньшей мере n комплементарных мотивов, и предпочтительно n+1 комплементарный мотив. Последовательность, несущая n+1 комплементарный мотив, таким образом, дает две позиции гибридизации с олигонуклеотидом. Преимущественно, последовательность ДНК содержит вплоть до 11 позиций гибридизации, то есть n+10 комплементарных мотивов. Способ по настоящему изобретению можно использовать для очистки любого типа двухцепочечной ДНК. Примером последней является кольцевая ДНК, такая как плазмида, обычно несущая один или более чем один терапевтически важный ген. Эта плазмида также может нести точку инициации репликации, маркерный ген и тому подобное. Способ по изобретению можно применять непосредственно к клеточному лизату. В этом воплощении плазмиду, амплифицированную путем трансформации с последующим культивированием клеток, очищают сразу же после лизиса клеток. Способ по изобретению также можно применять к осветленному лизату, то есть к супернатанту, полученному после нейтрализации и центрифугирования клеточного лизата. Вполне очевидно, что его можно применить также к раствору,предварительно очищенному известными способами. Этот способ также позволяет очищать линейную или кольцевую ДНК, несущую важную последовательность, из смеси, содержащей ДНК различных последовательностей. Способ по изобретению также можно использовать для очистки двухцепочечной ДНК. Клеточный лизат может представлять собой лизат прокариотических или эукариотических клеток. Что касается прокариотических клеток, то в качестве примеров можно упомянуть бактерии Е. coli,В. subtilis, S. typhimurium или Streptomyces. Что касается эукариотических клеток, то можно упомянуть клетки животных, дрожжи, грибы и тому подобное и, более конкретно, дрожжи Kluyveromyces или Saccharomyces или клетки COS, CHO (клетки яичника китайского хомячка), С 127, NIH3T3 и тому подобное. Способ по настоящему изобретению, который включает, по меньшей мере, стадию триплексной аффинной хроматографии, может быть использован для получения более высокой чистоты получаемого в результате продукта пДНК. В триплексной аффинной хроматографии олигонуклеотид связывают с носителем, таким как хроматографическая смола или другой матрикс. Образец, который очищают, затем смешивают со связанным олигонуклеотидом, например, путем нанесения образца на хроматографическую колонку, содержащую олигонуклеотид, связанный с хроматографической смолой. Желательная плазмида в образце будет связываться с олигонуклеотидом, образуя триплекс. Связи между олигонуклеотидом и плазмидой могут представлять собой связи Хугстина (Hoogsteen). Эта стадия может происходить при рН не более 5, при высокой концентрации соли в течение времени контакта 20 мин или более. Можно использовать стадию промывки. Наконец, в нейтральном буфере происходит депротонирование цитозина, элюция плазмиды из смолы со связанным олигонуклеотидом. Согласно наиболее предпочтительному воплощению, способ разделения и очистки нуклеиновых кислот и/или плазмидных ДНК включает стадии ионообменной хроматографии в сочетании с аффинной хроматографией с образованием тройной спирали и гидрофобной хроматографией. При гидрофобной хроматографии используются гидрофобные группы на субстрате для привлечения гидрофобных участков в молекулах в образце для очистки. Следует отметить, что эти носители HIC работают за счет эффекта "кластеризации"; при ассоциации этих молекул ковалентные или ионные связи не образуются и не задействованы. Гидрофобная хроматография является полезной, так как она очень- 14009447 эффективно удаляет формы плазмид с открытым кольцом и другие примеси, такие как гДНК, РНК и эндотоксин. Синтез основных материалов для гидрофобной хроматографии, также как и способ получения, полимеризации и функционализации гидрофобной хроматографии, элюции и разделения плазмидной ДНК посредством ее, являются хорошо известными в данной области и среди прочих описаны в патенте США 6441160, который включен в данное описание изобретения посредством ссылки. Соединениями, используемыми для синтеза основных материалов, которые применяют для набивочного материала для гидрофобной хроматографии, могут быть любые соединения, если различные функциональные группы, проявляющие гидрофобность, или различные ионообменные группы, могут быть введены путем последующей реакции после того, как будут синтезированы основные материалы. Примеры монофункциональных мономеров включают стирол, орто-галогенометилстирол, метагалогенометилстирол, пара-галогенометилстирол, орто-галогеноалкилстирол, мета-галогеноалкилстирол,пара-галогеноалкилстирол,-метилстирол,-метил-орто-галогенометилстирол,-метил-метагалогенометилстирол, -метил-пара-галогенометилстирол, -метил-орто-галогеноалкилстирол, -метилмета-галогеноалкилстирол, -метил-пара-галогеноалкилстирол, орто-гидроксиметилстирол, метагидроксиметилстирол,пара-гидроксиметилстирол,орто-гидроксиалкилстирол,мета-гидроксиалкилстирол,пара-гидроксиалкилстирол,-метил-орто-гидроксиметилстирол,-метил-метагидроксиметилстирол, -метил-пара-гидроксиметилстирол, -метил-орто-гидроксиалкилстирол, метил-мета-гидроксиалкилстирол, -метил-пара-гидроксиалкилстирол, глицидилметакрилат, глицидилакрилат, гидроксиэтилакрилат, гидроксиметакрилат и винилацетат. Наиболее предпочтительными соединениями являются галогеноалкильные группы, замещенные на ароматическом кольце, галогены, такие как Cl, Br, I и F, и насыщенные углеводороды с прямой или разветвленной цепью с числом атомов углерода от 2 до 15. Примеры полифункциональных мономеров включают дивинилбензол, тривинилбензол, дивинилтолуол, тривинилтолуол, дивинилнафталин, тривинилнафталин, этиленгликольдиметакрилат, этиленгликольдиакрилат, диэтиленгликольдиметакрилат, диэтиленгликольдиакрилат, метиленбисметакриламид и метиленбисакриламид. С помощью последующей реакции можно вводить различные гидрофобные функциональные группы или различные ионообменные группы. Для того чтобы минимизировать влияние на целевые продукты, которые желательно разделить, обусловленное гидрофобностью, проявляемой самим основным материалом, или набуханием, или сокращением самого основного материала из-за изменения концентрации соли и изменения значения рН, основной материал предпочтительно приготавливают, используя относительно гидрофильные мономеры, такие как глицидилметакрилат, глицидилакрилат, гидроксиэтилакрилат, гидроксиметакрилат и винилацетат. Получение основного материала включает первую стадию, на которой монофункциональный мономер и полифункциональный мономер взвешивают в подходящем соотношении и добавляют точно взвешенный разбавитель или растворитель, которые используют с целью регуляции размера пор образующихся частиц, и аналогичным образом точно взвешенный инициатор полимеризации с последующим тщательным перемешиванием. Смесь затем подвергают полимеризации суспензии типа масло в воде, где смесь добавляют в заранее точно взвешенный стабилизатор суспензии,растворенный в водном растворе, и капельки масла целевого размера образуются с помощью перемешивания мешалкой, а полимеризацию проводят, постепенно нагревая перемешанный раствор. Отношение монофункционального мономера к полифункциональному мономеру обычно составляет примерно 1 моль монофункционального мономера и примерно от 0,01 до 0,2 моль полифункционального мономера для того, чтобы получить мягкие частицы основного материала. Отношение полифункционального мономера можно увеличить примерно до 0,2-0,5 моль для того, чтобы получить твердые частицы основных материалов. Можно использовать один полифункциональный мономер для того, чтобы получить еще более твердые частицы. Также нет особых ограничений для инициатора полимеризации, и используют обычно применяющиеся инициаторы азобис типа и/или пероксидного типа. Для предотвращения агрегации между самими капельками масла также можно использовать стабилизаторы суспензии, такие как ионные поверхностно-активные вещества, неионные поверхностноактивные вещества и полимеры с амфипатическими свойствами или их смеси. Диаметр образующихся частиц обычно составляет примерно от 2 до 500 мкм. Предпочтительный диаметр частиц составляет от 2 до 30 мкм и более предпочтительно примерно от 2 до 10 мкм. Когда целью является крупномасштабная очистка нуклеиновых кислот с высокой чистотой, то он составляет примерно от 10 до 100 мкм, при выделении целевого продукта из неочищенного исходного раствора он может составлять от 100 до 500 мкм, более предпочтительно примерно от 200 до 400 мкм. Для подведения диаметра частиц можно регулировать скорость вращения мешалки во время полимеризации. Когда нужны частицы с малым диаметром, можно повысить число оборотов, а когда желательны большие частицы, можно уменьшить число оборотов. В данном описании выбор разбавителя является особенно важным, так как разбавитель, который будут использовать, применяют для регуляции размера пор в обра- 15009447 зующихся частицах. В качестве фундаментальной идеи относительно растворителя, который будут использовать для полимеризации, регуляцию осуществляют, комбинируя различным образом растворитель, который является плохим растворителем для мономера, с растворителем, который является хорошим растворителем для мономера. Размер диаметра пор можно выбрать подходящим образом в зависимости от размера молекул нуклеиновых кислот, которые предполагается разделять, но он предпочтительно находится в интервале от 500 до 4000 для набивочного материала для гидрофобной хроматографии, и в интервале от 1500 до 4000 для набивочного материала для ионообменной хроматографии. В гидрофобной хроматографии для разделения нуклеиновых кислот с различной гидрофобностью,предпочтительно, соответственно, с применением набивочных материалов с различной гидрофобностью,важным является модификация поверхности основного материала. Гидрофобные группы могут быть выбраны среди углеводородных групп с длинной или разветвленной цепью, включая насыщенные углеводородные группы или ненасыщенные углеводородные группы, с числом атомов углерода от 2 до 20. В углеводородной группе также может содержаться ароматическое кольцо. Гидрофобные группы также можно выбрать среди соединений, имеющих следующую формулу: где n составляет от 0 до примерно 20, и метиленовая группа может принадлежать прямой или разветвленной цепи, m составляет от 0 до примерно 3, и углеводородная группа может быть прямой или разветвленной цепью, и А представляет собой группу С=О или эфирную группу, но метиленовая группа может быть связана непосредственно с основным материалом без А. Гидрофобные группы могут дополнительно включать эфирную группу алкиленгликоля с 2-20 углеродными атомами, которая состоит из 0-10 повторяющихся единиц, где противоположный конец функциональной группы, прореагировавшей с основным материалом, может быть группой ОН, оставшейся в таком виде, или она может быть завершена алкильной группой с числом атомов углерода от 1 до 4. Описанные выше гидрофобные группы могут быть использованы по одиночке или в смеси для модификации поверхности. Цепь алкильных групп с 6-20 атомами углерода является предпочтительной из-за низкой гидрофобности, подобной гидрофобности плазмид. Длинная цепь алкильных групп, имеющих от 2 до 15 атомов углерода, подходит для разделения соединений с высокой гидрофобностью, таких как РНК, происходящая из Escherichia coli, и РНК в клетках человека и животных. Алкильные группы с 4-18 атомами углерода подходят для разделения соединений с относительно низкой гидрофобностью, таких как ДНК, происходящие из Escherichia coli, и ДНК в клетках человека и животных. При разделении этих веществ можно подходящим образом выбрать соединения для модификации поверхности, не ограничиваясь указанным пояснительным примером. В действительности, степень гидрофобности набивочного материала варьирует в зависимости от концентрации соли в среде или концентрации соли в элюенте для адсорбции. Кроме того, степень гидрофобности набивочного материала различается в зависимости от количества групп, введенных в основной материал. Особенно предпочтительно, чтобы диаметр пор основного материала для гидрофобной хроматографии составлял от 500 до 4000 , но его можно выбрать соответствующим образом из указанного интервала, в зависимости от размера молекул нуклеиновых кислот, которые желательно разделить. В общем, поскольку удерживание нуклеиновых кислот в набивочном материале и способность к адсорбции(продвижение образца) различаются в зависимости от диаметра пор, предпочтительно использовать основной материал с большим диаметром пор для нуклеиновых кислот с большим размером молекул и основной материал с маленьким диаметром пор для нуклеиновых кислот с маленьким размером молекул. Например, можно провести реакцию стирольного основного материала с гидрофобной группой, содержащей длинную цепь алкильных групп, с использованием галогенсодержащего соединения и/или карбонилгалоида и катализатора, такого как FeCl3, SnCl2 или AlCl3, и используя реакцию ФриделяКрафта, можно непосредственно добавлять ее к ароматическому кольцу в основном материале в виде дегалогенированного и/или ацилированного соединения. В случае, если основной материал представляет собой частицы, содержащие галогеновую группу, функциональную группу можно вводить через эфирную связь, например, применяя соединения с ОН, содержащейся в функциональной группе, которую нужно добавить, подобные бутанолу, и используя реакцию Вильямсона с щелочным катализатором, таким как NaOH или КОН. В случае, если функциональной группой, которую желательно добавить, является соединение, содержащее аминогруппу, подобное гексамину, ее можно добавить, применяя щелочной катализатор, такой как NaOH или КОН, и используя реакцию удаления галоидной кислоты. Наоборот, в случае основного материала, содержащего группу ОН, при предварительном введении эпоксигруппы, галогеновой группы или карбонилгалоидной группы в функциональную группу, которую желательно добавить, функциональную группу можно вводить через простую эфирную или сложноэфирную связь. В случае основного материала, содержащего эпоксигруппу, при реакции с соединением с группой- 16009447 ОН или аминогруппой, содержащейся в функциональной группе, которую желательно добавить, функциональную группу можно вводить через простую эфирную или аминосвязь. Кроме того, в случае, если функциональная группа, которую желательно добавить, содержит галогеновую группу, функциональную группу можно добавить через простую эфирную связь, используя кислотный катализатор. Так как на относительное содержание функциональных групп, которые необходимо ввести в основной материал,влияет гидрофобность подвергаемого реакции продукта, который желательно разделить, ее невозможно ограничить, но обычно подходящим является набивочный материал с примерно 0,05-4,0 ммоль функциональной группы, добавленной на 1 г сухого основного материала. Что касается модификации поверхности, то способ добавления функциональной группы через последующую реакцию после образования основного материала или частиц является таким, как описано. Модификацию поверхности проводят согласно тому же самому способу, где основной материал образуется после полимеризации с использованием мономеров с указанными функциональными группами, добавленными перед полимеризацией. Основным материалом также может быть пористый силикагель. Способ изготовления силикагеля включает связывание силана с использованием такого соединения, как алкилтриметоксисилан, непосредственно на частицах, изготовленных согласно способу, описанному в "Latest High-Speed Liquid Chromatography", стр. 289 и следующие страницы (написано Toshio Nambara и Nobuo Ikegawa, опубликованоTokyo Hirokawa Bookstore в 1988 г.). Функциональную группу можно добавить согласно вышеупомянутому способу перед или после связывания силана с использованием агента сочетания силана, содержащего эпоксигруппу. Подходящей является относительно содержание функциональной группы, которую вводят, примерно от 0,05 до 4,0 ммоль функциональной группы, добавленной на 1 г сухого основного материала. На стадии разделения или очистки гидрофобной хроматографией используют элюенты. Обычно используют два типа элюентов. Один элюент содержит высокую концентрацию соли, тогда как второй элюент содержит низкую концентрацию соли. Способ элюции включает ступенчатый переход от элюента, имеющего высокую концентрацию соли, к элюенту, имеющему низкую концентрацию соли, и можно использовать способ градиентной элюции, непрерывно меняющий состав от одного элюента к другому. Что касается буферов и солей, можно использовать буферы и соли, обычно применяемые для гидрофобной хроматографии. Что касается элюента, содержащего высокую концентрацию соли, то особенно предпочтительным является водный раствор с концентрацией соли от 1,0 до 4,5 М и значением рН от 6 до 8. Что касается элюента, содержащего низкую концентрацию соли, особенно предпочтительным является водный раствор с концентрацией соли от 0,01 до 0,5 М и значением рН от 6 до 8. Обычно в качестве солей могут быть использованы сульфат аммония и сульфат натрия. Стадию очистки плазмидной ДНК гидрофобной хроматографией можно проводить, комбинируя набивочный материал со введенной функциональной группой слабой гидрофобности с набивочным материалом с введенной функциональной группой сильной гидрофобности. В действительности, клеткиEscherichia coli, культивируемые в среде, содержат в большом количестве различные компоненты, отличающиеся по гидрофобности, такие как полисахариды, геномную ДНК Escherichia coli, РНК, плазмиды и белки. Также известно, что есть различия в гидрофобности даже среди самих нуклеиновых кислот. Белки, которые становятся примесями, имееют более высокую гидрофобность по сравнению с плазмидами. В продаже доступны многие смолы для гидрофобной хроматографии, такие как Fractogel propyl,Toyopearl, Source isopropyl или любые другие смолы, имеющие гидрофобные группы. Наиболее предпочтительными смолами являются полимерные среды в виде массы Toyopearl. Toyopearl представляет собой метакрилатный полимер, сочетающий высокую механическую и химическую стабильность. Смолы доступны в виде нефункционализированной серии смол "HW", и на их основе могут быть получены производные с поверхностными химическими группами для ионообменной хроматографии или гидрофобных взаимодействий. Можно использовать четыре типа смол Toyopearl для HIC, имеющих различную химию поверхности и уровни гидрофобности. Гидрофобность смол Toyopearl для HIC возрастает в серии: Ether,Phenyl, Butyl и Hexyl. Структуры предпочтительных смол Toyopearl для HIC, т.е. Toyopearl HW-65,имеющих диаметр пор 1000 , показаны ниже: Описанные выше смолы Toyopearl могут иметь различный класс крупности частиц. Toyopearl 650C имеет размер частиц примерно от 50 до 150 мкм, предпочтительно примерно 100 мкм, тогда какToyopearl 650M имеет размер частиц примерно от 40 до 90 мкм, предпочтительно примерно 65 мкм, иToyopearl 650S имеет размер частиц примерно от 20 до 50 мкм, предпочтительно примерно 35 мкм. Хорошо известно, что размер частиц влияет на разрешение, т.е. разрешение улучшается в зависимости от класса крупности частиц от С к М к S и, таким образом, возрастает с уменьшением размера частиц. Наиболее предпочтительной смолой Toyopearl, используемой на стадии гидрофобной хроматографии в способе разделения и очистки плазмидной ДНК согласно настоящему изобретению, является Toyopearl butyl-650S, которую продает Tosoh Bioscience. Согласно предпочтительному воплощению проводят дополнительную стадию диафильтрации. Для применения в этом способе подходят стандартные, имеющиеся в продаже материалы для диафильтрации, согласно стандартным методикам, известным в данной области. Предпочтительным способом диафильтрации является диафильтрация с использованием ультрафильтрационной мембраны, имеющей порог отсечения молекулярной массы в интервале от 30000 до 500000, в зависимости от размера плазмиды. На этой стадии диафильтрации осуществляют обмен буфера, а затем концентрирование. Элюат со стадии 12 концентрируют в 3-4 раза с помощью проточной фильтрации вдоль потока (порог отсечения мембраны 30 кДа) до целевой концентрации примерно от 2,5 до 3,0 мг/мл, и концентрат обменивают с буфером путем диафильтрации при постоянном объеме с 10 объемами солевого раствора и доводят солевым раствором до целевой концентрации плазмиды. Концентрацию NV1FGF рассчитывают из поглощения образцов концентрата при 260 нм. Раствор NV1FGF фильтруют через 0,2 мкм капсульный фильтр и делят на несколько аликвот, которые хранят в контейнерах в холодном помещении при 2-8 С до дополнительной обработки. Это дает очищенный концентрат с концентрацией плазмидной ДНК суперскрученной плазмиды приблизительно 70, 75, 80, 85, 90, 95 и предпочтительно 99%. Общий выход плазмиды с помощью этого способа составляет по меньшей мере 35, 40, 45, 50, 55, 60, 65, 70 и 80%, со средним выходом 60%. Согласно этому воплощению стадию диафильтрации выполняют согласно следующим условиям: используют буфер для стадии а) и для стадии б): 1) первая диафильтрация (стадия а) против 12,5-13,0 объемов 50 мМ Трис/HCl,150 мМ NaCl, pH 7,4(названный как буфер I) и 2) проводят вторую диафильтрацию ретентата со стадии (а) выше, (стадия б), против 3,0-3,5 объемов солевого эксципиента (150 мМ NaCl). Эта предпочтительная стадия диафильтрации по настоящему изобретению эффективно и тщательно удаляет сульфат аммония и ЭДТА. Также, после этих стадий диафильтрации, получают подходящую физиологическую концентрацию NaCl (примерно 150 мМ) и конечную концентрацию Трис ниже 1 мМ (от 200 мкМ до 1 мМ). Препарат плазмидной ДНК, полученный таким способом с использованием этой стадии диафильтрации, содержит NaCl в виде солевого эксципиента и подходящую концентрацию Трис-буфера для того,чтобы поддерживать или контролировать величину рН от 7 до 7,5. Препараты плазмидной ДНК по настоящему изобретению являются особенно полезными, так как неожиданно их плазмидную ДНК можно хранить в стабильной недеградированной форме в этих условиях в течение длительного периода времени при 5 С и вплоть до 25 С, то есть при комнатной температуре. Как описано, согласно способу изобретения для разделения, плазмидную ДНК с высокой чистотой и в большом количестве можно получить с помощью более простой манипуляции по сравнению с традиционным способом. Способ очистки плазмид можно использовать после способа непрерывного лизиса, как описано выше, или любых альтернативных способов лизиса, которые хорошо известны в данной области. Например, можно использовать проточный лизис с нагреванием микробных клеток, содержащих плазмиду. Этот способ описан, в частности, в международной публикации WO 96/02658. Конкретный теплообменник состоял из трубки из нержавеющей стали размером 10 футов (3,048 м) х 0,25 дюйма (0,635 см) (на- 18009447 ружный диаметр) в форме спирали. Спираль полностью погружают в водную баню с постоянной высокой температурой. Удерживаемый объем спирали составляет примерно 50 мл. Термопары и термометр использовали, соответственно, для измерения температур на входе и выходе и температуры водной бани. Поток продукта закачивают в нагревающую спираль с использованием перистальтического насоса Masterflex с силиконовой трубкой. Лизат клеток выходит из спирали, и затем его центрифугируют в центрифуге периодического действия Beckman J-21 для осветления. После центрифугирования плазмидную ДНК можно очистить, используя способ очистки по настоящему изобретению. При альтернативном способе лизиса клеток можно использовать статические смесители последовательно. В действительности, как описано в WO 97/23601 (включена в данное описание посредством ссылки), первый статический смеситель для лизиса клеток в первом статическом смесителе и для осаждения лизата клеток с помощью второго статического смесителя можно использовать в качестве альтернативного способа лизиса клеток перед способом очистки плазмидной ДНК по настоящему изобретению. Большие объемы клеток можно мягко и непрерывно лизировать на одной линии, используя статический смеситель и другие статические смесители, расположенные на одной линии для выполнения других функций, таких как разбавление и осаждение. Подходящие статические смесители, полезные в способе по настоящему изобретению, включают любые проточные устройства, именуемые в данной области как статические или неподвижные смесители, с длиной, достаточной для обеспечения способов по настоящему изобретению. Например, для того чтобы лизировать клетки, статическому смесителю нужно было бы иметь длину, которая обеспечила бы достаточное время контакта между лизирующим раствором и клетками для того, чтобы вызвать лизис данных клеток во время пропускания через смеситель. В предпочтительном воплощении подходящие статические смесители содержат внутреннюю спиральную структуру, которая заставляет две жидкости приходить в контакт друг с другом в противоположно направленном вращающемся потоке, вызывающем смешивание жидкостей вместе в турбулентном потоке. Способ разделения и очистки плазмидной ДНК согласно настоящему изобретению может быть использован для разделения и очистки любых типов векторов любых размеров. Диапазон размеров плазмидных ДНК, которые можно разделять способом по настоящему изобретению, составляет примерно от 5 т.п.н. до примерно 50 т.п.н., предпочтительно от 15 т.п.н. до 50 т.п.н., причем ДНК включает векторную основу размером примерно 3 т.п.н., терапевтический ген и связанные с ним регуляторные последовательности. Таким образом, векторная основа, полезная в изобретении, сможет нести вставки размером примерно 10-50 т.п.н. или больше. Вставка может включать ДНК из любого организма, но предпочтительно будет происходить из млекопитающих и может включать, кроме гена, кодирующего терапевтический белок, регуляторные последовательности, такие как промоторы, последовательности полиаденилирования, энхансеры, области контоля локусов и пр. Ген, кодирующий терапевтический белок, может быть геномного происхождения и, следовательно, может содержать экзоны и интроны, как отражено в его геномной организации, или может происходить из комлементарной ДНК. Такие векторы могут включать, например, векторную основу, реплицируемую посредством репликации с получением большого числа копий, имеющую полилинкер для вставки терапевтического гена, ген, кодирующий селективный маркер, например, SupPhe tRNA, ген устойчивости к тетрациклину и канамицину, и является физически маленькой и стабильной. Векторная основа плазмиды преимущественно позволяет осуществлять вставки фрагментов ДНК млекопитающих, других эукариот, прокариот или вурусов, и полученную плазмиду можно очистить и использовать в плазмидной терапии in vivo или ex vivo. Векторы, имеющие относительно высокое число копий, например, в интервале от 20-40 копий/клетку вплоть до 1000-2000 копий/клетку, можно разделять и очищать способом по настоящему изобретению. Например, вектор,который включает точку инициации репликации pUC, является предпочтительным согласно способу по изобретению. Точка инициации репликации pUC обеспечивает более эффективную репликацию плазмидной ДНК и приводит к десятикратному увеличению числа копий плазмиды/клетку по сравнению,например, с точкой инициациим репликации pBR322. Предпочтительно, плазмидную ДНК с условной точкой инициации репликации или pCOR, как описано в US 2003/1618445, можно разделять с помощью способа по настоящему изобретению. Полученное высокое число копий значительно увеличивает отношение плазмидной ДНК к хромосомной ДНК, РНК, клеточным белкам и кофакторам, улучшает выход плазмиды и облегчает последующую очистку. Соответственно, согласно изобретению можно использовать любой вектор (плазмидную ДНК). Репрезентативные векторы включают, но не ограничиваются этим, плазмиду NV1FGF. Плазмида NV1FGF, кодирующая кислый фактор роста фибробластов или фактор роста фибробластов 1-го типа (FGF-1), полезная при лечении пациентов с последней стадией окклюзии периферических артерий (ОПА) или с заболеванием периферических артерий (ЗПА), удовлетворяет требованиям безопасности. Camerota и др. (J Vase. Surg., 2002, 35, 5: 930-936) описывают, что 51 пациенту с неизлечимой конечной стадией ЗПА, имеющих боль в состоянии покоя или некроз тканей, внутримышечно инъецировали возрастающие одноразовые или повторные дозы NV1FGF в ишемизированные бедро или икру. Затем оценивали различные параметры, такие как чрескожное давление кислорода, брахиальные индексы лодыжки и пальцев ног, оценка болей и излечение язвы. После введения NV1FGF наблюдали значительное увеличение брахиальных индексов, уменьшение боли, сокращение размера язвы и улучшенную перфузию.- 19009447 Клетки-хозяева, полезные согласно изобретению, могут представлять собой любой бактериальный штамм, т.е. как грамположительные, так и грамотрицательные штаммы, такие как Е. coli и Salmonellatyphimurium, или Bacillus, которые способны поддерживать высокое число копий плазмид, описанных выше; например, 20-200 копий. Хозяйские штаммы Е. coli могут быть использованы согласно изобретению и включают НВ 101, DH1 и DH5F, XAC-1 и XAC-1pir 116, ТЕХ 2 и TEX2pir42 (WO 04/033664). Штаммы, содержащие F плазмиду или производные F плазмиды (например, JM109), обычно не являются предпочтительными, так как F плазмида может совместно очищаться с терапевтическим плазмидным продуктом. Согласно другому аспекту, в настоящем изобретении также предложена композиция, содержащая высокоочищенную плазмидную ДНК, которая, по существу, не содержит примесей или содержит очень низкие концентрации примесей и, таким образом, представляет собой ДНК фармацевтического качества. Композиция плазмидной ДНК фармацевтического качества по настоящему изобретению, таким образом,содержит очень низкие концентрации ( 0,0001%, т.е.0,0001 мг на 100 мг плазмидной ДНК) гДНК,РНК и белковых примесей. Композиция плазмидной ДНК фармацевтического качества, таким образом, содержит менее примерно 0,01 или менее 0,001%, и предпочтительно менее 0,0001%, или предпочтительно менее 0,00008%( 0,0008%, т.е.0,0008 мг на 100 мг плазмидной ДНК) хромосомной ДНК или геномной ДНК. Композиция плазмидной ДНК фармацевтического качества, таким образом, содержит менее примерно 0,01 или менее 0,001%, и предпочтительно менее 0,0001 или предпочтительно менее 0,00002% ( 0,0002%, т.е.0,0002 мг на 100 мг плазмидной ДНК) примесей РНК. Композиция плазмидной ДНК фармацевтического качества, таким образом, содержит менее примерно 0,0001%, и наиболее предпочтительно менее 0,00005% белковых примесей. Композиция плазмидной ДНК фармацевтического качества, таким образом, содержит менее 0,1 МЕ/мг эндотоксинов. Композиция плазмидной ДНК фармацевтического качества, таким образом, содержит преимущественно кольцевую форму и, более конкретно, содержит более 80, 85, 90, 95 или 99% замкнутой кольцевой формы плазмидной ДНК. Настоящее изобретение также относится к жидкому препарату плазмидной ДНК, который является стабильным и не деградирует при комнатной температуре в течение длительного периода времени и,таким образом, является полезным для хранения плазмидной ДНК, которую используют в научном исследовании и в связанной с ним терапии человека. Настоящее изобретение, таким образом, относится к препарату стабильной плазмидной ДНК, содержащему плазмидную ДНК, очень разбавленный буферный раствор и солевой эксципиент, где буферный раствор присутствует в такой концентрации, чтобы поддерживать рН указанного препарата или композиции в интервале от 7 до 7,5. Буферные растворы, которые способны поддерживать рН композиции в интервале от 7 до 7,5, состоят либо из системы кислота/основание, включающей Трис [трис(гидроксиметил)-аминометан] или лизин, и кислоту, выбранную из сильной кислоты (например, соляной кислоты) или слабой кислоты (например, малеиновой кислоты, яблочной кислоты или уксусной кислоты), или из системы кислота/основание, включающей Hepes [2-(4-(2-гидроксиэтилпиперазин)-1-ил)этансульфоновая кислота] и сильное основание (например, гидроксид натрия). Буферный раствор также может включать трис/HCl,лизин/HCl, трис/малеиновую кислоту, трис/яблочную кислоту, трис/уксусную кислоту илиHepes/гидроксид натрия. Предпочтительно рН поддерживают в интервале от 7 до 7,5 и еще более конкретно при примерно 7,2. Солевой эксципиент, который можно использовать в препарате по настоящему изобретению, предпочтительно представляет собой NaCl в концентрации от 100 до 200 мМ и предпочтительно в концентрации примерно 150 мМ. Другие солевые эксципиенты могут содержать анионы и катионы, выбранные из группы, состоящей из ацетата, фосфата, карбоната, SO42-, Cl-, Br-, NO3-, Mg2+, Li+, Na+, K+ и NH4+. Молярную концентрацию буферного раствора определяют таким образом, чтобы оказывать буферное действие в пределах границ и в объеме, где значение рН стабилизировано от 7 до 7,5. Композиция для хранения стабильной плазмидной ДНК согласно настоящему изобретению, таким образом, содержит плазмидную ДНК, солевой эксципиент и буферный раствор, где буферный раствор присутствует в концентрации вплоть до 1 мМ и предпочтительно от 250 мкМ до 1 мМ, или предпочтительно от 400 мкМ до 1 мМ, чтобы поддерживать рН указанного препарата или композиции в диапазоне от 7 до 7,5. Среди буферных систем согласно изобретению Трис-буферный раствор в концентрации 400 мкМ дает особенно удовлетворительные результаты и, таким образом, является предпочтительным в препарате плазмид по настоящему изобретению. Как показано в примерах, приведенных ниже, препарат плазмидной ДНК по настоящему изобретению демонстрирует превосходную стабильность и при 4C, и при комнатной температуре (КТ), например, при 20 или 25C. В частности, препарат плазмидной ДНК является полезным в течение длительного- 20009447 периода времени, 1 месяца, 2 месяцев, 3 месяцев, до 6 месяцев и вплоть до 12 месяцев при 4 С и при 25 С, т.е. КТ. Настоящее изобретение, таким образом, относится к композиции, содержащей плазмидную ДНК,буферный раствор и солевой эксципиент, где буферный раствор присутствует в концентрации, достаточной для сохранения плазмидной ДНК в стабильной форме при температуре от 4 до 25 С,Настоящее изобретение также относится к композиции, содержащей плазмидную ДНК, буферный раствор и солевой эксципиент, где буферный раствор присутствует в концентрации, достаточной для сохранения плазмидной ДНК в стабильной форме при температуре от 4 до 25 С в течение длительного периода времени, 1 месяца, 2 месяцев, 3 месяцев, до 6 месяцев и вплоть до 12 месяцев. В действительности, плазмидная ДНК, которую хранят при 5 С или при комнатной температуре в течение длительного периода времени, показывает очень низкие скорости депуринизации и открытия кольца, в пределах 20, 15, 10, 5 или не более 1% в месяц. Композиция по настоящему изобретению может дополнительно содержать адъювант, такой как,например, полимер, выбранный из полиэтиленгликоля, плуроника или полисорбатного сахара, или спирта. Согласно другому аспекту настоящее изобретение относится к способу сохранения плазмидной ДНК в композиции, включающему: а) получение очищенного препарата плазмидной ДНК и б) объединение указанного очищенного препарата плазмидной ДНК с солевым эксципиентом и буферным раствором, который поддерживает рН полученной композиции в интервале от 7 до 7,5. Настоящее изобретение также относится к способу сохранения плазмидной ДНК в композиции при температуре вплоть до примерно 20 С, включающему: а) получение очищенного препарата плазмидной ДНК, б) объединение очищенного препарата плазмидной ДНК с солевым эксципиентом и буферным раствором, где буферный раствор предствлен в концентрации менее чем 1 мМ, или в интервале от 250 мкМ до 1 мМ и предпочтительно 400 мкМ; и в) хранение композиции плазмидной ДНК при температуре примерно 4 и вплоть до примерно 20 С. Примеры Общие методы клонирования и молекулярной биологии Традиционные методы молекулярной биологии, такие как переваривание рестриктазами, гельэлектрофорез, трансформация в Е. coli, осаждение нуклеиновых килот и тому подобное, описаны в литературе (Maniatis et al., Т., E.F. Fritsch and J. Sambrook, 1989. Molecular cloning: a laboratory manual, secondbiology 1987-1988. John Willey and Sons, New York.). Нуклеотидные последовательности определяли методом терминации цепи согласно уже опубликованному протоколу (Ausubel et al., 1987). Рестриктазы поставлялись фирмой New England Biolabs, Beverly, MA (Biolabs). Для проведения лигирований, фрагменты ДНК инкубировали в буфере, содержащем 50 мМ ТрисHCl рН 7,4, 10 мМ MgCl2, 10 мМ ДТТ, 2 мМ АТФ в присутствии ДНК-лигазы фага Т 4 (Biolabs). Олигонуклеотиды синтезировали, используя фосфорамидитную химию с фосфорамидитами, защищенными в (3-положении цианоэтиловой группой (Sinha, N.D., J. Biernat, J. McManus and H. Koster, 1984.Am. Biotechnol., Nov./Dec.) с помощью автоматического синтезатора ДНК Biosearch 8600, используя рекомендации производителя. Лигированные ДНК или ДНК, тестируемые на эффективность трансформации, использовали для трансформации следующих компетентных штаммов: Е. coli DH5[F/endA1, hsdR17, supE44, thi-1, recA1,qyrA96, relA1,(lacZYA-arqF)U169, deoR, Ф 8Odlac (lacZM15)] (для любой плазмиды Col E1); или Е.coli XAC-pir (для любой плазмиды, происходящей из pCor). Минирепараты плазмидной ДНК делают согласно протоколу Klein и др., 1980. Для роста штаммов Е. coli используют культуральную среду LB (Maniatis et al., 1982). Штаммы инкубируют при 37 С. Бактерии высеивают на чашки со средой LB, дополненной подходящими антибиотиками. Пример 1. Подведение диаметров к используемым скоростям потока следует из рассчета чисел Рейнолдса в спиралях системы непрерывного лизиса. Так как следующий анализ предполагает, что поведение жидкостей является ньютоновским, приведенные ниже цифры полностью верны только в В 1 а и до определенной степени в В 2. Значение числа Рейнолдса позволяет специалисту в данной области точно определить тип поведения, с которым сталкиваются. В данном описании авторы будут рассмотривать только поток жидкости в трубке (гидравлическая техника). 1) Неньютоновская жидкость- 21009447 Двумя типами неньютоновских жидкостей, наиболее часто встречающихся в промышленности, являются жидкости Бингема (Bingham) и Оствальда де Вале (Ostwald de Waele). В этом случае число Рейнолдса (Re) рассчитывают следующим образом:ReN представляет собой обобщенное число РейнолдсаD - внутренний диаметр поперечного среза (м);- объемная масса жидкости (кг/м 3);w - пространственная скорость жидкости (м/с);n - индекс поведения жидкости (безразмерный);n и m определяют эмпирически (исследование реологического поведения) 2) Ньютоновская жидкость Что касается первой части, в уравнении (1) мы имеемRe = (D)/ (2)- объемная масса жидкости (кг/м 3);- вязкость жидкости (Пас и 1 мПас = 1 сП);D - внутренний диаметр поперечного среза (м);U - средняя полная скорость жидкости (м/с) Уравнение (1) при n=1 сокращается до уравнения (2). При Q = скорость потока (м 3/ч) и S = площадь поверхности поперечного сечения (м 2), и еслидана в сП, тогда(3) В кольцевом трубопроводе поток является ламинарным для числа Рейнолдса менее 2500 и гидравлически ровным турбулентным потоком для числа Рейнолдса от 2000 до 500000. Граница между 2000 и 2500 является осознанно размытой, где для установления того, что может затем произойти, используют оба типа поведения и выбор делают a posteriori. 3) Рассчеты Так как n и m обычно неизвестны, использовали следующие приближения для того, чтобы оценить тенденции: ньютоновская жидкость (во всех поперечных сечениях);= 1000 кг/м 3 (для всех жидкостей);= 5 сП в В 1 а и 40 сП в В 1b (данные авторов); 2,5 сП в В 2 (данные авторов). Следующие рассчеты проводили, используя уравнение (3) для двух стандартных протестированных конфигураций трубок, названных конфигурация 1 и конфигурация 2 (без трубки В 1b): Таблица 2 В этих двух конфигурациях потоки являются ламинарными на всех стадиях и растворы не смешиваются друг с другом в достаточной мере. Для других конфигураций трубок (нет трубки В 1b) мы имеем Сходные рассчеты провели, используя уравнение (3), для различных конфигураций трубок, когда присутствовали и трубка В 1 а, и трубка В 1b: Таблица 4 Ясно, что можно получить определенные заранее значения Рейнолдса путем регулирования диаметров трубок и скоростей потока. Специалист в данной области может рассмотреть множество комбинаций диаметров и длины В 2 или двух секций В 1 (В 1 а и В 1b). Например, первую секцию В 1 можно уменьшить с 6 до 3 мм для того,чтобы уменьшить длину и увеличить перемешивание. Дополнительно, n и m могут быть определены из исследования реологического поведения жидкостей и использованы для определения правильных характеристик трубок. Кроме эффективности перемешивания, также можно рассматривать продолжительность перемешивания, которую в некоторых воплощениях настоящего изобретения получают, регулируя длину спиралей. Диаметр трубок или скорость жидкости, по-видимому, не играют главную роль в уравнении (1) для неньютоновской жидкости (данные не показаны). Другими словами, кажется, что изменение диаметра не является более эффективным, чем изменение скорости потока, если уравнение (1) используют для рассчетов в B1b и в В 2. Там, где желательными являются высокие скорости потока, можно варьировать диаметр вместе со скоростью потока. Эти принципы можно использовать в качестве основы для ограничения перемешивания в В 1b и В 2 насколько это возможно для того, чтобы избежать фрагментации гДНК. Во время лизиса перемешивание может быть достаточно энергичным при условии, что гДНК не денатурирует. Снижение диаметра в начале В 1 делает возможным усиление перемешивания (повышенноеRe) для того, чтобы в достаточной степени перемешать раствор 2 с клетками. С другой стороны, когда клетки лизируют, перемешивание и силы трения на стенку могут быть уменьшены для предотвращения фрагментации нуклеиновых кислот. Увеличение диаметра позволяет снизить перемешивание (пониженное Re) и трение (пониженная скорость). М 1: перемешивание жидкостей. В 1 а: точное регулирование перемешивания в начале лизиса: феномен конвекции (макросмешива- 23009447 ние). В 1b: обеспечение денатурации плюс феномена диффузии (микросмешивание). Предполагают, что обобщенное число Рейнолдса имеет то же самое значение для неньютоновской жидкости, что и классическое число Рейнолдса для ньютоновской жидкости. В частности, предполагают, что пределом для ламинарного режима в трубопроводе с круглым поперечным сечением является ReN2300. Нейтрализацию проводят в В 2. Высокие скорости потока имеют тенденцию увеличивать фрагментацию геномной ДНК, вызываемую перемешиванием, которое является слишком энергичным, и силами трения у стенки (механические напряжения). Использование трубки большого диаметра позволяет снизить перемешивание (Re) и силы трения (скорость). Авторы расположили здесь трубку малого диаметра(6 мм) для того, чтобы избежать недостаточного перемешивания. Наблюдения авторов показали, что для В 2 лучше всего было иметь только трубку малого диаметра для того, чтобы "сильно и быстро" перемешивать нейтрализованный лизат. Пример 2. Авторы могут разбить систему лизиса клеток на 5 стадий. В одном конкретном воплощении конфигурация была следующей: 1) Смешивание: клетки (в растворе 1) + раствор 2 (М 1 + 3 м 6-мм трубки). Начало лизиса клеток с помощью ДСН, отсутствие риска фрагментации ДНК, пока она не денатурирована. 2) Окончание лизиса и денатурации гДНК (13 м 16-мм трубки). 3) Смешивание: лизат + раствор 3 (М 2 + 3 м 6-мм трубки). 4) Сбор нейтрализованного лизата при 4 С 5) Оседание хлопьев и больших фрагментов гДНК в течение ночи при 4C. Для проведения непрерывного лизиса можно использовать следующие условия: Раствор 1: 10 мМ ЭДТА, 9 г/л глюкозы (Глк) и 25 мМ Трис-HCl, рН 7,2. Раствор 2: 1% ДСН и 0,2 н.NaOH Раствор 3: 2 М уксусная кислота и 3 М ацетат калия. Скорость потока 60 л/ч: Раствор 1 и раствор 2 Скорость потока 90 л/ч: Раствор 3. Клетки доводят до 38,5 г/л раствором 1. Клетки в растворе 1 проходят через 3 сопла, которые диспергируют их в растворе 2, который поступает из противоположного направления. Смеситель М 1 имеет геометрию, позволяющую оптимизировать перемешивание двух жидкостей(см. фиг. 2, схематический рисунок смесителя). Первая секция трубки после смесителя М 1 - это В 1 а, а следующая секция - В 1b. В 1 а: длина 3 м, диаметр 6 мм, время пребывания 2,5 с В 1b: длина 13 м, диаметр 16 мм, время пребывания 77 с Способ по настоящему изобретению дает преимущество в показателях эффективности, просуммированное как: дисперсия, быстрое сильное перемешивание и мягкое перемешивание путем диффузии. При использовании способа по настоящему изобретению увеличивается число лизированных клеток и, следовательно, возрастает количество выделенной пДНК. Идея диффузии является особенно важной из-за трудностей при смешивании этих жидкостей, обусловленных их свойствами, в особенности вязко-эластичностью. Способ по настоящему изобретению позволяет ограничить напряжение сдвига и, следовательно,ограничить фрагментацию гДНК, облегчая ее удаление в течение последующей хроматографической очистки. Проблема заключается в последующем смешивании с раствором 3, который может быть охлажден до 4 С. В одном воплощении в способе по изобретению используют: смеситель М 2, который имеет Y-образную форму с внутренним диаметром примерно 10 мм; секцию трубки В 2, расположенную после смесителя М 2. В 2: 2 м 6-мм трубки, время пребывания: 1 с. В табл. 5 ниже даны результаты, полученные в сравнительных тестах, с целью показать преимущества способа непрерывного лизиса по изобретению по сравнению с периодическим лизисом. Пример 3. Используемая колонка представляет собой 1 мл колонку HiTrap, активированную NHS (Nгидроксисукцинимид, Pharmacia), соединенную с перистальтическим насосом (выход 1 мл/мин). Используемый специфический олигонуклеотид имеет NH2 группу на 5' конце, его последовательность является следующей: 5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1). В этом примере используют следующие буферы: Буфер для связывания: 0,2 М NaHCO3, 0,5 М NaCl, pH 8,3. Буфер А: 0,5 М этаноламин, 0,5 М NaCl, pH 8,3. Буфер В: 0,1 М ацетат, 0,5 М NaCl, pH 4. Колонку промывают 6 мл 1 мМ HCl, и олигонуклеотид, разбавленный в буфере для связывания (50 нмоль в 1 мл), затем наносят на колонку и оставляют на 30 мин при комнатной температуре. Колонку промывают три раза подряд 6 мл буфера А и затем 6 мл буфера В. Олигонуклеотид, таким образом, ковалентно связывается с колонкой через связь CONH. Колонку хранят при 4 С в PBS (фосфатно-солевой буфер), 0,1% NaN3, и ее можно использовать по меньшей мере четыре раза. Синтезировали два следующих олигонуклеотида: олигонуклеотид 4817: 5'GATCCGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA AGAAGG-3 (SEQ IDNO: 13) и олигонуклеотид 4818 5'-ААТТССТТСТТСТТСТТСТТСТТСТТСТТСТТСТТСТТСТТСТТСТТСТТСТТСТТС G-3 (SEQ ID NO: 14). При гибридизации и клонировании в плазмиду, эти олигонуклеотиды вводят гомопурингомопиримидиновую последовательность (GAA)17 (SEQ ID NO: 15) в соответствующую плазмиду, как описано выше. Последовательность, соответствующую этим двум гибридизованным олигонуклеотидам, клонировали в сайте множественного клонирования плазмиды pBKS+ (Stratagene Cloning System, La Jolla CA),которая несет ген устойчивости к ампициллину. Для этого олигонуклеотиды гибридизовали следующим образом: один мкг этих двух олигонуклеотидов помещали вместе в 40 мл конечного буфера, содержащего 50 мМ Трис-HCl рН 7,4, 10 мМ MgCl2. Эту смесь нагревали до 95 С и затем помещали при комнатной температуре для того, чтобы температура медленно снижалась. Десять нг смеси гибридизованных олигонуклеотидов лигировали с 200 нг плазмиды pBKS+ (Stratagene Cloning System, La Jolla CA), переваренной BamHI и EcoRI в конечном объеме 30 мкл. После лигирования, аликвоту трансформировали в DH5a. Трансформационные смеси переносили на чашки со средой L, дополненной ампициллином (50 мг/л) и Xgal (20 мг/л). Рекомбинантные клоны должны показать отсутствие синего окрашивания на этой среде, в отличие от родительской плазмиды (pBKS+), которая обеспечивает -комплементацию фрагментагалактозидазы из Е. coli. После получения минипрепаратов плазмидной ДНК из 6 клонов, все они продемонстрировали исчезновение сайта Pstl, расположенного между сайтами EcoRI и BamHI в pBKS+, и увеличение молекулярной массы полосы Pvull длиной 448 п.н., содержащей сайт множественного клонирования. Отбирали один клон, и соответствующую плазмиду обозначали pXL2563. Клонированную последовательность подтверждали секвенированием, используя праймер -20 (5'-TGACCGGCAGCAAAATG-3'Megaprep (Promega Corp. Madison, Wl) согласно рекомендациям поставщика. Затем этот препарат плазмидной ДНК использовали в примерах, описанных ниже. Плазмиду pXL2563 очищали на колонке HiTrap со присоединенным к ней олигонуклеотидом, описанным в 1.1., из раствора, также содержащего плазмиду pBKS+. Буферы, используемые при этой очистке, являются следующими: Буфер F: 2 М NaCl, 0,2 М ацетат, рН от 4,5 до 5. Буфер Е: 1 М Трис-HCl, рН 9, 0,5 мМ ЭДТА. Колонку промывали 6 мл буфера F, наносили на колонку плазмиды (20 мкг pXL2563 и 20 мкгpBKS+ в 400 мкл буфера F) и инкубировали в течение 2 ч при комнатной температуре. Колонку промывали 10 мл буфера F и затем проводили элюцию буфером Е. Плазмиды определяли после электрофореза- 25009447 на 1%-ном агарозном геле и окрашивания бромистым этидием. Процентное содержание плазмид в растворе оценивали, измеряя их трансформирующую активность на Е. coli. Начиная со смеси, содержащей 30% pXL2563 и 70% pBKS+, на выходе колонки получали раствор,содержащий 100% pXL2563. Чистота, оцениваемая по отношению OD при 260 и 280 нм, возрастает от 1,9 до 2,5, что указывает на удаление загрязняющих белков с помощью этого способа. Пример 4. Связывание олигонуклеотида (5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1 с колонкой проводили, как описано в примере 3. Для связывания олигонуклеотид модифицировали на 5'-конце аминогруппой, связанной с фосфатом спейсера группировкой, содержащей 6 атомов углерода (Modified(Promega Corp., Madison, Wl), согласно рекомендациям поставщика. В этом примере использовали следующие буферы: Буфер F: 2 М NaCl, 0,2 М ацетат, рН от 4,5 до 5. Буфер Е: 1 М Трис-HCl, рН 9, 0,5 мМ ЭДТА. Колонку промывают 6 мл буфера F, затем на колонку наносят 100 мкг плазмиды pXL2563, разбавленной в 400 мкл буфера F, и инкубируют в течение 2 ч при комнатной температуре. Колонку промывают 10 мл буфера F, и затем проводят элюцию буфером Е. Количество плазмиды оценивают, измеряя оптическую плотность при 260 нм. В этом примере связывание осуществляют в буфере, молярность которого по отношению к NaCl варьирует от 0 до 2 М (буфер F). Выход очистки снижается, когда уменьшается молярность NaCl. рН буфера для связывания может варьировать от 4,5 до 5, причем выход очистки лучше при 4,5. Также можно использовать другой буфер элюции с основным рН: элюцию, таким образом, проводили буфером, содержащим 50 мМ борат, рН 9, 0,5 мМ ЭДТА. Связывание олигонуклеотида (5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1 с колонкой проводят, как описано в примере 3. ПлазмидуpXL2563 очищали, используя набор Wizard Megaprep (Promega Corp., Madison, Wl), согласно рекомендациям поставщика. В этом примере использовали следующие буферы: Буфер F: 0,1 М NaCl, 0,2 М ацетат, рН 5. Буфер Е: 1 М Трис-HCl, рН 9, 0,5 мМ ЭДТА. Колонку промывают 6 мл буфера F, затем на колонку наносят 100 мкг плазмиды pXL2563, разбавленной в 400 мкл буфера F, и инкубируют в течение одного часа при комнатной температуре. Колонку промывают 10 мл буфера F и затем проводят элюцию буфером Е. Измеряют содержание геномной или хромосомной ДНК Е. coli, присутствующей в образцах плазмиды до и после пропускания через олигонуклеотидную колонку. Количество этой геномной ДНК измеряют с помощью ПЦР, используя праймеры в гене Е. coli galK, согласно следующему протоколу: Последовательности этих праймеров описаныDebouck и др. (Nucleic Acids Res. 1985, 13, 1841-1853): 5-CCG AAT TCT GGG GAC CAA AGC AGT TTC-3' (SEQ ID NO: 17) и 5'-CCA AGC TTC ACT GTT CAC GAC GGG TGT-3' (SEQ ID NO: 18). Реакционная среда содержит в 25 мкл буфера для ПЦР (Promega France, Charbonnieres): 1,5 мМMgCl2; 0,2 мМ dXTP (Pharmacia, Orsay); 0,5 мкМ праймера; 20 ед./мл Taq полимеразы (Promega). Реакцию проводят согласно последовательности: 5 мин при 95 С 30 циклов по 10 с при 95C 30 с при 60 С 1 мин при 78 С 10 мин при 78 С. Амплифицированный фрагмент ДНК, имеющий длину 124 п.н., разделяют электрофорезом на 3%ном агарозном геле в присутствии SybrGreen I (Molecular Probes, Eugene, США) и затем измеряют количественно относительно серии геномной ДНК Ultrapur из Е. coli штамм В (Sigma, ref D4889). Пример 5. В этом примере описана очистка плазмидной ДНК из осветленного лизата бактериальной культуры в так называемой системе "минипреп": центрифугируют 1,5 мл ночной культуры штаммов DH5a, содержащих плазмиду pXL2563, осадок ресуспендируют в 100 мкл 50 мМ глюкозы, 25 мМ Трис-HCl, рН 8, 10 мМ ЭДТА. Добавляют 200 мкл 0,2 М NaOH, 1% ДСН, переворачивают пробирки для перемешивания,затем добавляют 150 мкл 3 М ацетата калия, рН 5, и переворачивают пробирки для перемешивания. После центрифугирования супернатант выделяют и наносят на олигонуклеотидную колонку, полученную,как описано в примере 1. Связывание, промывки и элюция идентичны таковым, описанным в примере 3. Из 1,5 мл культуры выделяют примерно 1 мкг плазмиды. Полученная плазмида, проанализированная с помощью электрофореза на агарозном геле и окрашивания бромистым этидием, принимает форму единственной полосы "суперскрученной" кольцевой ДНК. В плазмиде, очищенной этим способом, не обнаруживается никаких следов высокомолекулярной (хромосомной) ДНК или РНК.- 26009447 Пример 6. В этом примере описан эксперимент по очистке плазмидной ДНК, выполненный в тех же условиях,что и в примере 5, начиная с 20 мл бактериальной культуры штаммов DH5a, содержащих плазмидуpXL2563. Осадок клеток растворяют в 1,5 мл 50 мМ глюкозы, 25 мМ Трис-HCl, рН 8, 10 мМ ЭДТА. Лизис проводят с помощью 2 мл 0,2 М NaOH, 1% ДСН, а нейтрализацию - 1,5 мл 3 М ацетата калия, рН 5. Затем ДНК осаждают 3 мл 2-пропанола, осадок растворяют в 0,5 мл 0,2 М ацетата натрия, рН 5, 0,1 МNaCl и наносят на олигонуклеотидную колонку, как описано в примере выше. Связывание, промывку колонки и элюцию проводят, как описано в примере выше, за исключением промывочного буфера, молярность которого относительно NaCl составляет 0,1 М. Полученная плазмида, проанализированная с помощью электрофореза на агарозном геле и окрашивания бромистым этидием, принимает форму единственной полосы "суперскрученной" кольцевой ДНК. В очищенной плазмиде не обнаруживается никаких следов высокомолекулярной (хромосомной) ДНК или РНК. Переваривание плазмиды рестриктазой дает единственную полосу с ожидаемой молекулярной массой 3 т.п.н. Используемая плазмида содержит кассету, содержащую цитомегаловирусный промотор, ген, кодирующий люциферазу, и гомопурингомопиримидиновую последовательность (GAA)17 (SEQ ID NO: 15), происходящую из плазмидыpXL2563. Штамм DH1 (Maniatis et al., 1989), содержащий эту плазмиду, культивируют в 7-литровом ферментере. Осветленный лизат получают из 200 грамм клеток: осадок клеток растворяют в 2 л 25 мМ Трис-буфера, рН 6,8, 50 мМ глюкозы, 10 мМ ЭДТА, к которым добавляют 2 л 0,2 М NaOH. 1% ДСН. Лизат нейтрализуют путем добавления одного литра 3 М ацетата калия. После диафильтрации, 4 мл этого лизата наносят на 5 мл колонку HiTrap-NHS, связанную с олигонукпеотидом последовательности 5'GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1), согласно способу, описанному в примере 3. Промывку и элюцию проводят, как описано в примере выше. Пример 7. В этом примере описано применение олигонуклеотида, несущего метилированные цитозины. Последовательность используемого олигонуклеотида является следующей: 5'-GAGGMeCTTMeCTTMeCTTMeCTTMeCTTMeCTTMeCTT-3' (SEQ ID NO: 19). Этот олигонуклеотид имеет группу NH2 на 5'-конце. МеС представляет собой 5-метилцитозин. Этот олигонуклеотид делает возможной очистку плазмиды pXL2563 в условиях примера 1 буфером для связывания с рН 5 (риск деградации плазмиды при этом снижается). Пример 8. В примерах, приведенных выше, используемый олигонуклеотид модифицируют на 5'терминальном конце аминогруппой, связанной с фосфатом через группировку, содержащую 6 атомов углерода: NH2-(CH2)6. В этом примере аминогруппу связывают с фосфатом 5'-терминального конца через группировку, содержащую 12 атомов углерода: NH2-(CH2)12. Связывание олигонуклеотида и пропускание через колонку проводят, как описано в примере 3, буфером F: 2 М NaCl, 0,2 М ацетат, рН 4,5. Этот олигонуклеотид позволяет получать лучшие выходы очистки: получают выход 53%, тогда как с олигонуклеотидом, содержащим 6 атомов углерода, этот выход имеет порядок 45% в тех же самых условиях. Пример 9. Следуя стратегии клонирования, описанной в примере 3, сконструировали две другие плазмиды,несущие гомопурин-гомопиримидиновые последовательности: плазмиду pXL2725, которая содержит последовательность (GGA)16, (SEQ ID NO: 20) и плазмиду pXL2726, которая содержит последовательность (GA)25(SEQ ID NO: 21). Плазмиды pXL2725 и pXL2726, аналогичныеплазмиде pXL2563, сконструировали согласно стратегии клонирования, описанной в примере 3, используя следующие пары олигонуклеотидов: 5986: 5'-GATCC(GA)25GGG-3' (SEQ ID NO: 22) 5987: 5'-AATTCCC(TC)25G-3' (SEQ ID NO: 23) 5981: 5'-GATCC(GGA)17GG-3' (SEQ ID NO: 24) 5982: 5'-AATT(CCT)17CCG-3' (SEQ ID NO: 25) Пару нуклеотидов 5986 и 5987 использовали для конструирования плазмиды pXL2726 путем клонирования олигонуклеотидов в сайтах BamН 1 и EcoRI pBKS+ (Stratagene Cloning System, La Jolla CA),тогда как олигонуклеотиды 5981 и 5982 использовали для конструирования плазмиды pXL2725. Использовали те же экспериментальные условия, что и при конструировании плазмиды pXL2563, и изменили только пары олигонуклеотидов. Аналогично, клонированные последовательности подтверждали секвенированием плазмид. Это позволяло увидеть, что плазмида pXL2725 обладает модификацией, имеющей отношение к ожидаемой последовательности: вместо последовательности GGA, повторенной 17 раз,присутствует GGAGA(GGA)15 (SEQ ID NO: 26). Пример 10. Олигонуклеотиды, образующие тройные спирали с этими гомопуриновыми последовательностями,связывали с колонками HiTrap согласно методике, описанной в примере 1.1. Для очистки плазмидыpXL2725 использовали олигонуклеотидную последовательность 5'-AATGCCTCCTCCTCCTCCTCCTCCT-3' (SEQ ID NO: 27), и олигонуклеотидную последовательность 5'AGTGCTCTCTCTCTCTCTCTCTCTCT-3' (SEQ ID NO: 28) использовали для очистки плазмидыpXL2726. Две колонки, полученные посредством этого, обеспечивали очистку соответствующих плазмид согласно методике, описанной в примере 2, со следующими буферами: Буфер F: 2 М NaCl, 0,2 М ацетат, рН 4,5. Буфер Е: 1 М Трис-HCl, рН 9, 0,5 мМ ЭДТА. Полученные выходы составляли 23 и 31% для pXL2725 и pXL2726 соответственно. Пример 11. Этот пример иллюстрирует влияние длины специфической последовательности, присутствующей в плазмиде, на выходы очистки. Репортерный ген, используемый в этих экспериментах для демонстрации активности композиций по изобретению, представляет собой ген, кодирующий люциферазу (Luc). Плазмида pXL2621 содержит кассету, содержащую цитомегаловирусный промотор (CMV) из 661 п.н., экстрагированную из pcDNA3 (Invitrogen Corp., San Diego, CA) путем расщепления рестриктазамиpGL базового вектора (Promega Corp., Madison, WI). Эту плазмиду сконструировали, используя стандартные методы молекулярной биологии. Плазмиды pXL2727-1 и pXL2727-2 сконструировали следующим образом: Два микрограмма плазмиды pXL2621 линеаризовали с помощью BamHl; фермент инактивировали обработкой при 65 С в течение 10 мин; в то же самое время гибридизировали олигонуклеотиды 6006 и 6008, как описано для конструирования плазмиды pXL2563. 6006: 5'-GATCT(GAA)17CTGCAGATCT-3'(SEQ ID NO: 29) 6008: 5'-GATCAGATCTGCAG(TTC)17A-3' (SEQ ID NO: 30). Эту гибридизационную смесь клонировали на BamHl концах плазмиды pXL2621 и после трансформации в DH5 идентифицировали рекомбинантные клоны посредством анализа рестриктазой Pstl, так как олигонуклеотиды включают сайт Pstl. Выбирали два клона и подтверждали нуклеотидную последовательность клонированного фрагмента с использованием праймера(6282,5'ACAGTCATAAGTGCGGCGACG-3' (SEQ ID NO: 31 в качестве праймера реакции секвенирования (Viera J. and J. Messing, 1982. The pUC plasmids an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene, 19:259-268). Первый клон (pXL2727-1) содержит последовательность GAA, повторенную 10 раз. Второй клон(pXL2727-2) содержит последовательность 5'-GAAGAAGAG(GAA)7GGAAGAGAA-3' (SEQ ID NO: 32). Используют колонку, такую как колонка, описанная в примере 3, с которой связан олигонуклеотид 5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1). Плазмида pXL2727-1 несет 14 повторов последовательности GAA. Олигонуклеотид, описанный выше, который содержит только 7 повторов соответствующей гибридизационной последовательности СТТ, может, следовательно, гибридизироваться с плазмидой в 6 различных положениях. ПлазмидаpXL2727-2, напротив, обладает гибридизационной последовательностью (GAA)7 (SEQ ID NO: 36) той же длины, что и длина олигонуклеотида, связанного с колонкой. Этот олигонуклеотид может, следовательно, гибридизироваться только в одном положении в pXL2727-2. Эксперимент идентичен эксперименту, описанному в примере 4, со следующими буферами: Буфер F: 2 М NaCl, 0,2 М ацетат, рН 4,5. Буфер Е: 1 М Трис-HCl, рН 9, 0,5 мМ ЭДТА. Выход очистки составляет 29% с плазмидой pXL2727-1 и 19% с плазмидой pXL2727-2. Используемые клетки представляют собой клетки NIH ЗТЗ, инокулируемые за день до эксперимента в 24-луночные культуральные планшеты из расчета 50000 клеток/лунку. Плазмиду разбавляют в 150 мМ NaCl и смешивают с липофектантом RPR115335. Используют отношение положительных зарядов липофектанта к отрицательным зарядам ДНК, равное 6. Смесь встряхивают (на vortex), оставляют на 10 минут при комнатной температуре, разбавляют в среде без фетальной телячьей сыворотки и затем добавляют к клеткам в соотношении 1 мкг ДНК на культуральную лунку. Через два часа при 37 С добавляют 10% об./об. фетальной телячьей сыворотки и инкубируют клетки в течение 48 ч при 37 С в присутствии 5% СО 2. Клетки дважды промывают PBS и измеряют активность люциферазы согласно описанному протоколу (набор Promega, Promega Corp., Madison, Wl) на люминометре Lumat LB9501 (EG and G Berthold,Evry). Плазмида pXL2727-1, очищенная как описано в примере 8.2, дает выходы трансфекции, в два раза более высокие, чем выходы трансфекции, полученные с той же плазмидой, очищенной с использованием набора Wizard Megaprep (Promega Corp. Madison, Wl). Пример 12. Следующий пример демонстрирует очистку плазмид, происходящих из pCOR, с использованием аффинной хроматографии с образованием тройной спирали. Показали, что эта методика удаляет загрязнения нуклеиновыми кислотами (особенно геномную ДНК и РНК хозяина) до уровней, которые не были достигуты традиционными хроматографическими методами. Триплексный аффинный гель синтезировали с Sephacryl S-1000 SF (Amersham-Pharmacia Biotech) в качестве хроматографического матрикса. Sephacryl S-1000 сперва активировали мета-перйодатом натрия(3 мМ, комнатная температура, 1 ч) в 0,2 М ацетате натрия (рН 4,7). Затем связывали олигонуклеотид через его 5'-NH2 концевую группировку с альдегидными группами активированного матрикса с помощью восстановительного аминирования в присутствии аскорбиновой кислоты (5 мМ), как было описано ранее для связывания белков (Hornsey et al., J. Immunol. Methods, 1986, 93, 83-88). Гомопиримидиновый олигонуклеотид, используемый в этих экспериментах (от Eurogentec, очищенный ВЭЖХ), имел последовательность, которая была комплементарна короткой 14-мерной гомопуриновой последовательности (5'AAGAAAAAAAAGAA-3') (SEQ ID NO: 10), присутствующей в точке инициации репликации (ori) плазмиды pCOR (Soubrier et al., Gene Therapy, 1999, 6, 1482-1488). Как обсуждали выше, последовательность гомопиримидинового олигонуклеотида представляет собой 5'-ТТСТТТТТТТТСТТ-3' (SEQ ID NO: 11). Следующие плазмиды подвергали хроматографии: pXL3296 (pCOR без трансгена, 2,0 т.п.н.),pXL3179 (pCOR-FGF, 2,4 т.п.н.), pXL3579 (pCOR-VEGFB, 2,5 т.п.н.), pXL3678 (pCOR-AFP, 3,7 т.п.н.),pXL3227 (pCOR-lacZ 5,4 т.п.н.) и pXL3397 (pCOR-Bdeleted FVIII, 6,6 т.п.н.). Все эти плазмиды очищали на двух стадиях анионообменной хроматографии из осветленных лизатов, полученных как описано в примере 4. Также исследовали плазмиду pBKS+ (pBluescript II KS + от Stratagene), происходящую отColE1 плазмиды, очищенную ультрацентрифугированием в CsCl. Все использованные плазмиды находились в их суперскрученном (более 95%) топологическом состоянии. В каждом эксперименте по очистке плазмидной ДНК на аффинную колонку, содержащую вышеупомянутый олигонуклеотид 5'-ТТСТТТТТТТТСТТ-3' (SEQ ID NO: 11), наносили 300 мкг плазмидной ДНК в 6 мл 2 М NaCl, 0,2 М ацетата калия (рН 5,0) со скоростью потока 30 см/ч. После промывки колонки 5 объемами того же буфера, связанную плазмиду элюировали 1 М Трис/HCI, 0,5 мМ ЭДТА (рН 9,0) и количественно оценивали с помощью УФ (260 нм) и ионообменной хроматографии на колонке MilliporeGen-Pak (Marquet et al., BioPharm, 1995, 8, 26-37). Выходы плазмид в собранной фракции составляли 207 мкг для pXL3296, 196 мкг для pXL3179, 192 мкг для pXL3579, 139 мкг для PXL3678, 97 мкг для pXL3227 и 79 мкг для pXL3397. Когда на этой колонке хроматографировали pBKS, не смогли определить связывание плазмиды ( 3 мкг). Это указывает на то, что олигонуклеотид 5'-ТТСТТТТТТТТСТТ-3' (SEQ ID NO: 11) образует стабильные триплексные структуры с комплементарной 14-мерной последовательностью 5'AAGAAAAAAAAGAA-3' (SEQ ID NO: 10), присутствующей в pCOR (ori ), но не с близкородственной последовательностью 5'-AGAAAAAAAGGA-3' (SEQ ID NO: 8), присутствующей в pBKS. Это указывает на то, что введение одной неканонической триады (в данном случае TGC) приводит к полной дестабилизации триплексной структуры. В качестве контроля, не наблюдали связывания плазмиды ( 1 мкг) при хроматографированииpXL3179 на контрольной колонке, синтезированной строго в таких же условиях, но без олигонуклеотида. Оперируя этой колонкой для аффинной очистки при условиях, описанных в данном изобретении,уровень загрязнения геномной ДНК хозяина снизили для препарата pXL3296 от 2,6 до 0,07%. Аналогично, уровень загрязнения ДНК хозяина снизили для препарата pXL3179 от 0,5 до 0,008% при хроматографировании образца через ту же аффинную колонку. Пример 13. Следующий пример демонстрирует очистку плазмид, происходящих из ColE1, с использованием аффинной хроматографии с образованием тройной спирали. Показали, что эта методика удаляет загрязнения нуклеиновыми кислотами (особенно геномной ДНК и РНК хозяина) до уровней, которые не были достигнуты традиционными хроматографическими методами. Триплексный аффинный гель синтезировали путем связывания олигонуклеотида, имеющего последовательность 5'-ТСТТТТТТТССТ-3' (SEQ ID NO: 9), с Sephacryl S-1000 SF, окисленным перйодатом,как описано в примере выше. Плазмиды pXL3296 (pCOR без трансгена) и pBKS, плазмиду, происходящую из ColE1, хроматографировали на 1-мл колонке, содержащей олигонуклеотид 5'-ТСТТТТТТТССТ-3' (SEQ ID NO: 9) в условиях, описанных в примере 9. Выходы плазмид в собранной фракции составляли 175 мкг для pBKS и менее 1 мкг для pXL3296. Это указывает на то, что олигонукпеотид 5'-ТСТТТТТТТССТ-3' (SEQ ID NO: 9) образует стабильные триплексные структуры с комплементарной 12-мерной последовательностью (5'AGAAAAAAAGGA-3') (SEQ ID NO: 8), присутствующей в pBKS, но не с очень близкородственной 12 мерной последовательностью (5'-AGAAAAAAAAGA-3') (SEQ ID NO: 34), присутствующей в pCOR. Это показывает, что введение одной неканонической триады (в данном случае САТ) может приводить к полной дестабилизации триплексной структуры. Пример 14. Посевную культуру получали в колбе Эрленмейера без перегородки с помощью следующего способа. Рабочий банк клеток инокулируют в колбу Эрленмейера, содержащую среду M9modG5, со скоростью посева 0,2% об./об. Штамм культивируют при 220 об./мин в ротационном шейкере при 371 С в течение примерно 182 ч до истощения глюкозы. Это дает 200 мл посевной культуры. Ожидается, что оптическая плотность культуры при А 600 составляет примерно 2-3.- 29009447 Затем создают предварительную культуру в первом ферментере. Посевную культуру асептически переносят в предварительный ферментер, содержащий среду M9modG5 для того, чтобы обеспечить скорость посева 0,2% (об./об.), и культивируют при аэрации и перемешивании. pO2 поддерживают на уровне более 40% насыщения. Культуру собирают, когда через 16 ч потребляется глюкоза. Это дает примерно 30 л предварительной культуры. Ожидается, что оптическая плотность культуры при А 600 составляет примерно 2-3. Затем создают основную культуру во втором ферментере. 30 л предварительной культуры асептически переносят в ферментер, заполненный 270 л стерилизованной среды FmodG2 для того, чтобы обеспечить скорость посева примерно 10% (об./об.). Культивирование начинают периодическим способом для создания некоторой биомассы. Подпитку глюкозой начинают сразу после потребления исходного сахара примерно через 4 ч. Контролируют аэрацию, перемешивание, рО 2 (40%), рН (6,90,1), температуру (37 1 С) и подпитку глюкозой для того, чтобы поддерживать специфическую скорость роста, близкую к 0,09 ч-1. Культивирование заканчивают примерно через 35 ч после подпитки. Это дает примерно 400 л культуры. Ожидается, что оптическая плотность культуры при А 600 составляет примерно 100. Проводят первую стадию разделения, которая называется сбор клеток. Биомассу собирают с помощью центрифуги с коническими перегородками в роторе. Жидкую среду концентрируют в 3-4 раза для того, чтобы удалить использованную культуральную среду, и непрерывно ресуспендируют в 400 л стерильного буфера S1. Это дает примерно 500 л предварительно кондиционированной среды. Сухая масса клеток составляет 255 г/л. Проводят вторую стадию разделения, которую называют стадией концентрирования. После ресуспендирования/гомогенизации в буфере S1, клетки вновь подвергают обработке сепаратором с образованием концентрированной суспензии. Это дает примерно 60-80 л промытой и концентрированной суспензии. Сухая масса клеток составляет 15030 г/л; масса пДНК составляет 30060 мг/л. Затем проводят стадию замораживания. Суспензию асептически переносят в 20-литровые мешкиFlexboy (заполненные до 50% от их емкости) и далее замораживают при -205 С перед дальнейшей обработкой. Это дает замороженную биомассу. Содержание пДНК составляет 30060 мг/л; суперскрученная форма составляет более 95%. Затем проводят стадию оттаивания клеток. Замороженные мешки нагревают вплоть до 20 С, и клеточную суспензию разбавляют до 40 г/л, рН 8,0 100 мМ Трис-гидрохлоридом, 10 мМ ЭДТА, 20 мМ глюкозой, и суспензию оставляют при 202 С на 1 ч с перемешиванием перед лизисом клеток. Это дает оттаявшую суспензию биомассы. рН составляет 8,00,2. В течение этой стадии можно использовать температуры примерно 20 С. Затем проводят стадию щелочного лизиса. Стадия лизиса клеток состоит из прокачивания разбавленной клеточной суспензии через расположенный на одной линии смеситель раствором 0,2 н. NaOH 35 мМ ДСН (раствор S2) с последующей непрерывной контактной стадией в спиральной трубке. Непрерывная контактная стадия должна обеспечить полный лизис клеток и денатурацию геномной ДНК и белков. Раствор лизированных клеток смешивают соответственно с раствором 3 (S3) охлажденного 3 М ацетата калия - 2 н. уксусной кислоты перед сбором в охлажденный встряхиваемый сосуд. Добавление раствора S3 приводит к осаждению геномной ДНК, РНК, белков и ДСН. Затем проводят фильтрацию лизата. Нейтрализованный лизат затем инкубируют при 53 С в течение 2-24 ч без перемешивания и фильтруют через 3,5 мм сетчатый фильтр для удаления массы осажденного вещества (хлопьевидной фазы) с последующей объемной фильтрацией в качестве стадии окончательной фильтрации. Это дает осветленный лизат с концентрацией суперскрученной плазмиды более 90%. Затем проводят анионообменную хроматографию. Раствор прозрачного лизата разбавляют очищенной водой до намеченного значения проводимости 50 мС/см, фильтруют через двухслойный фильтр (3 мкм - 0,8 мкм) и наносят на колонку для анионообменной хроматографии. Используют 300-мм колонку,заполненную 11,0 л смолы Fractogel TMAE HiCap (M) (Merck; 1.10316.5000). Осветеленный лизат наносят на колонку и проводят элюцию, используя ступенчатый градиент NaCl. Основную массу примесей,связавшихся с колонкой, элюируют раствором NaCl при примерно 61 мС/см, и плазмидную ДНК элюируют раствором NaCl при примерно 72 мС/см. Это дает элюат ионообменной хроматографии, имеющий высокую концентрацию плазмидной ДНК. После этого следует триплексная аффинная хроматография. Элюат из колонки для анионообменной хроматографии разбавляют примерно 0,5 объемами раствора 500 мМ ацетата натрия (рН 4,2), содержащего 4,8 М NaCl, и прокачивают через колонку для триплексной аффинной хроматографии, уравновешенную 50 мМ ацетатом натрия (рН 4,5), содержащим 2 М NaCl. Колонка имеет диаметр 300 мм и содержит 10,0 л геля для аффинной хроматографии с образованием тройной спирали Sephacryl S-1000(Amersham Biosciences; Piscataway, NJ). Колонку промывают раствором 50 мМ ацетата натрия (рН 4,5),содержащего 1 М NaCl, и NV1FGF элюируют 100 мМ Трис-буфером (рН 9,0), содержащим 0,5 мМ ЭДТА. Это дает элюат после триплексной аффинной хроматографии, имеющий высокую концентрацию плазмиды.

МПК / Метки

МПК: C12N 1/06, C12N 15/10

Метки: фармацевтического, способ, качества, днк, получения, плазмидной

Код ссылки

<a href="http://easpatents.com/30-9447-sposob-polucheniya-plazmidnojj-dnk-farmacevticheskogo-kachestva.html" rel="bookmark" title="База патентов Евразийского Союза">Способ получения плазмидной днк фармацевтического качества</a>

Похожие патенты