Способы анализа последовательностей нуклеиновых кислот с использованием биологического олигонуклеотидного микрочипа и наборы для их осуществления

Есть еще 22 страницы.

Смотреть все страницы или скачать PDF файл.

Формула / Реферат

1. Способ анализа последовательностей нуклеиновых кислот (НК) с использованием биологического микрочипа, включающий получение очищенных препаратов олигонуклеотидов, иммобилизацию этих олигонуклеотидов в трехмерных гидрофильных микроячейках, подготовку анализируемого образца НК, анализ образца НК путем его гибридизации с иммобилизованными на микрочипе олигонуклеотидами, регистрацию результатов анализа и интерпретацию результатов анализа, характеризующийся тем, что в указанном способе используют биологический микрочип, состоящий из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр и содержащих набор иммобилизованных олигонуклеотидов.

2. Способ по п.1, в котором получают очищенные препараты дискриминирующих специфических олигонуклеотидов, выбранных на основе предварительного расчета их первичной и вторичной структур, и которые необходимы и достаточны для идентификации известных мутаций, полиморфных или аллельных вариантов анализируемых последовательностей НК, а также для изготовления контрольных ячеек, и которые удовлетворяют следующим условиям:

а) длина специфических дискриминирующих олигонуклеотидов, обеспечивающая их специфичность в отношении анализируемой последовательности НК, определяется размером и сложностью анализируемой последовательности и, в частности, наличием в ней повторов и протяженных гомополимерных последовательностей;

б) специфические дискриминирующие олигонуклеотиды способны выявлять известные замены, делеции и инсерции для каждой позиции анализируемой НК, для которой известны такие мутации, полиморфизм или аллельные варианты;

в) разброс значений температуры плавления (Тпл) специфических дискриминирующих олигонуклеотидов находится в диапазоне 4-5шC и подбирается путем варьирования длины олигонуклеотидов;

д) специфические дискриминирующие олигонуклеотиды не обладают способностью формировать вторичные структуры типа шпильки с высокими температурами плавления;

е) позиция детектируемых вариабельных нуклеотидов и других нуклеотидных перестроек в анализируемой НК находится по возможности не далее 1-4 нуклеотидов от середины соответствующего дискриминирующего олигонуклеотида.

3. Способ по п.1, в котором получают полный набор очищенных препаратов всех возможных олигонуклеотидов заданной длины.

4. Способ по любому из пп.1-3, в котором анализируемый образец НК - ДНК или РНК выбирают из группы, включающей

а) очищенные препараты НК;

б) НК, выделенные из чистых и накопительных культур микроорганизмов и вирусов;

в) НК, выделенные из клинического материала, полученного от пациента;

г) НК, выделенные из других образцов естественного происхождения, в том числе воды, почвы, смывов, проб воздуха.

5. Способ по любому из пп.1-4, в котором гибридизацию на биологическом микрочипе проводят в гибридизационном растворе, содержащем буферный компонент, соль для создания ионной силы, в герметичной гибридизационной камере при температуре, определяемой температурой плавления иммобилизованных на биологическом микрочипе олигонуклеотидов.

6. Способ по п.5, в котором гибридизационный раствор дополнительно содержит агент, дестабилизирующий водородные связи.

7. Способ по п.4, в котором образцы НК представляют собой РНК.

8. Способ по п.7, в котором подготовка анализируемого образца включает выделение РНК, фрагментацию выделенной РНК и ковалентное мечение этой РНК флуоресцентной меткой.

9. Способ по п.7, в котором подготовка анализируемого образца включает выделение РНК, синтез кДНК на матрице выделенной РНК, амплификацию кДНК с помощью ПЦР, фрагментацию амплифицированной ДНК и мечение этой ДНК флуоресцентной меткой.

10. Способ по п.7, в котором подготовка анализируемого образца включает выделение РНК, синтез кДНК на матрице выделенной РНК и амплификацию кДНК с одновременным мечением амплифицированной ДНК с использованием одного или двух флуоресцентно меченных праймеров с помощью ПЦР.

11. Способ по п.7, в котором подготовка анализируемого образца включает выделение РНК, синтез кДНК на матрице выделенной РНК и амплификацию кДНК с одновременным мечением амплифицированной ДНК с получением одноцепочечного флуоресцентно меченного продукта с помощью двухстадийной ПЦР, включающей стандартную ПЦР на первой стадии и асимметричную ПЦР с использованием флуоресцентно меченного праймера на второй стадии.

12. Способ по п.4, в котором образцы НК представляют собой ДНК.

13. Способ по п.12, в котором подготовка анализируемого образца включает выделение ДНК, ее фрагментацию и мечение этой ДНК флуоресцентной меткой.

14. Способ по п.4, в котором образцы НК представляют собой ДНК.

15. Способ по п.14, в котором подготовка анализируемого образца ДНК включает выделение, амплификацию выделенной ДНК с помощью ПЦР, фрагментацию этой амплифицированной ДНК и мечение этой ДНК флуоресцентной меткой.

16. Способ по п.14, в котором подготовка образца ДНК включает выделение и амплификацию выделенной ДНК с одновременным мечением амплифицированной ДНК с использованием одного или двух флуоресцентно меченных праймеров при помощи ПЦР.

17. Способ по п.14, в котором подготовка анализируемого образца ДНК включает выделение и амплификацию выделенной ДНК с одновременным мечением амплифицированной ДНК с получением одноцепочечного флуоресцентно меченного продукта с помощью двухстадийной ПЦР, включающей стандартную ПЦР на первой стадии и асимметричную ПЦР с использованием флуоресцентно меченного праймера на второй стадии.

18. Способ по п.6, в котором дестабилизирующий водородные связи агент выбирают из группы, включающей гуанидин тиоцианат, мочевину или формамид.

19. Способ по любому из пп.1-18, в котором регистрация результатов гибридизации включает использование регистрирующих устройств на базе широкопольной оптики, оснащенных источником света для возбуждения флуоресценции, или лазерных сканаторов различного типа.

20. Способ по п.19, в котором гибридизационную картину, полученную при помощи регистрирующего устройства на базе широкопольной оптики, регистрируют на фотопленку или цифровым детектором изображения, например ПЗС-камерой.

21. Способ по п.19, в котором регистрацию результатов гибридизации осуществляют путем сплошного сканирования микрочипа при помощи лазерного сканатора с последующим анализом полученного изображения или путем избирательного сканирования при помощи лазерного сканатора тех участков микрочипа, на которых расположены ячейки.

22. Способ по любому из пп.1 или 2, в котором интерпретацию результатов гибридизации осуществляют путем сравнения интенсивностей сигнала в ячейках микрочипа, выявляющих образование совершенных и несовершенных гибридизационных дуплексов.

23. Способ по п.3, в котором интерпретацию результатов гибридизации осуществляют путем сравнения интенсивностей сигнала в ячейках микрочипа, выявляющих образование совершенных и несовершенных гибридизационных дуплексов.

24. Способ по п.22, в котором интерпретацию результатов гибридизации с целью выявления специфических последовательностей в анализируемом образце НК осуществляют путем сравнения интенсивностей сигнала в ячейках, содержащих специфичные дискриминирующие олигонуклеотиды, и в контрольных ячейках, содержащих неспецифичные олигонуклеотиды.

25. Способ по п.22, в котором интерпретацию результатов гибридизации с целью выявления мутаций, полиморфизма или аллелизма генов осуществляют путем сравнения интенсивностей сигнала в ячейках, содержащих дискриминирующие олигонуклеотиды, соответствующие последовательностям дикого типа, и в ячейках, содержащих дискриминирующие олигонуклеотиды, соответствующие последовательностям мутантных типов, или полиморфных или аллельных вариантов НК.

26. Способ по любому из пп.1-25 для обнаружения последовательностей нуклеиновых кислот, детерминирующих синтез диагностически значимых белков; детекции точечных нуклеотидных мутаций, делеций, инсерций, инверсий и транслокаций, а также транспозонов и мобильных IS-элементов.

27. Споёюс по любому из пп.1-25 для обнаружения микроорганизмов и вирусов по специфическим последовательностям нуклеиновых кислот.

28. Способ по любому из пп.1-25 для выявления вида возбудителя заболевания; выявления генов, детерминирующих синтез токсинов; определения лекарственной устойчивости возбудителя; выявления гомозиготного и гетерозиготного состояния мутаций; а также для целей эпидемиологического генотипирования.

29. Способ по любому из пп.1-25 для определения уровня экспрессии известных генов в различных органах и тканях, при патологических состояниях, на разных стадиях развития организма, а также при разного рода воздействиях на организм.

30. Способ по любому из пп.1-25 для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов) методом гибридизации с олигонуклеотидным микрочипом.

31. Способ анализа последовательностей нуклеиновых кислот с использованием биологического микрочипа, включающий получение очищенных препаратов специфических олигонуклеотидов, выполняющих роль праймеров при проведении ПЦР, иммобилизацию этих олигонуклеотидов в трехмерных гидрофильных микроячейках, подготовку анализируемого образца НК, анализ образца НК путем проведения ПЦР на микрочипе, регистрацию результатов анализа и интерпретацию результатов анализа, характеризующийся тем, что в указанном способе используют биологический микрочип, состоящий из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр и содержащих набор иммобилизованных специфических олигонуклеотидов.

32. Способ по п.31, в котором получают очищенные препараты специфических дискриминирующих праймеров, выбранных на основе предварительного расчета их первичной и вторичной структур, и которые необходимы и достаточны для идентификации известных мутаций, полиморфных или аллельных вариантов анализируемых последовательностей НК, а также для изготовления контрольных ячеек, и которые удовлетворяют следующим условиям:

а) длина специфических дискриминирующих праймеров, обеспечивающая их специфичность в отношении анализируемой последовательности НК, определяется размером и сложностью анализируемой последовательности и, в частности, наличием повторов и протяженных гомополимерных последовательностей;

б) специфические дискриминирующие праймеры, различающиеся по своему 3'-концу, способны выявлять известные замены, делеции и инсерции для каждой позиции анализируемой НК, для которой известны такие мутации, полиморфизм или аллельные варианты;

в) разброс значений Тпл специфических дискриминирующих праймеров находится в диапазоне 3-4шC и подбирается путем варьирования длины олигонуклеотидов;

г) специфические дискриминирующие праймеры не способны формировать вторичные структуры типа шпильки с высокими температурами плавления.

33. Способ по п.31, в котором анализируемый образец НК - ДНК или РНК выбирают из группы, включающей

а) очищенные препараты НК;

б) НК, выделенные из чистых и накопительных культур микроорганизмов и вирусов;

в) НК, выделенные из клинического материала, полученного от пациента;

г) НК, выделенные из других образцов естественного происхождения, в том числе воды, почвы, смывов, проб воздуха.

34. Способ по п.31, в котором анализ образца включает проведение ПЦР на биологическом микрочипе с использованием пары специфических олигонуклеотидов, один из которых является внешним прямым праймером, а второй - внешним обратным праймером, причем прямой праймер иммобилизован в микроячейках биологического микрочипа, а флуоресцентно меченный обратный праймер находится в растворе над микрочипом.

35. Способ по п.33, в котором образец НК представляет собой РНК, а подготовка анализируемого образца включает выделение РНК и синтез на матрице выделенной РНК кДНК с помощью ПЦР.

36. Способ по п.33, в котором образец НК представляет собой ДНК, а подготовка анализируемого образца включает выделение ДНК.

37. Способ по п.34, в котором анализ образца НК включает проведение аллель-специфичной ПЦР на биологическом микрочипе, в ячейках которого иммобилизованы прямые дискриминирующие праймеры, обеспечивающие выявление известных замен, делеций, инсерций и нуклеотидных перестроек анализируемой последовательности.

38. Способ по п.37, в котором в раствор над микрочипом дополнительно добавляют свободный внешний прямой праймер.

39. Способ по п.31, в котором анализируют несколько последовательностей НК.

40. Способ по п.39, в котором применяют мультиплексный вариант ПЦР, включающий амплификацию каждой анализируемой последовательности своей парой специфических внешних праймеров, причем прямые праймеры иммобилизуют в соответствующих ячейках биологического микрочипа, а меченные флуоресцентной меткой обратные праймеры находятся в растворе над микрочипом.

41. Способ по п.40, в котором в раствор над микрочипом дополнительно добавляют свободные внешние прямые праймеры.

42. Способ по п.41, в котором внешний прямой праймер, используемый для преамплификации, одновременно служит и дискриминирующим праймером, иммобилизованным в ячейке биологического микрочипа.

43. Способ по п.41, в котором дискриминирующие внутренние прямые праймеры, иммобилизованные в ячейках микрочипа, позволяющие выявлять известные мутации, инсерции, делеции в конкретной позиции анализируемой последовательности, отличаются от внешнего прямого праймера, используемого для преамплификации.

44. Способ по любому из пп.31-43, в котором регистрацию результатов ПЦР осуществляют в процессе проведения ПЦР на биологическом микрочипе.

45. Способ по любому из пп.31-44, в котором интерпретацию результатов ПЦР осуществляют путем сравнения интенсивностей флуоресценции ячеек, выявляющих образование специфичного продукта ПЦР.

46. Способ по п.45, в котором интерпретацию результатов ПЦР с целью выявления специфических последовательностей в анализируемом образце НК осуществляют путем сравнения интенсивностей флуоресценции ячеек, содержащих специфичные дискриминирующие праймеры, и контрольных ячеек, содержащих неспецифичные праймеры.

47. Способ по п.45, в котором интерпретацию результатов ПЦР с целью выявления мутаций, полиморфных или аллельных вариантов генов осуществляют путем сравнения интенсивностей флуоресценции ячеек, содержащих дискриминирующие праймеры, соответствующие последовательностям дикого типа, и ячеек, содержащих дискриминирующие праймеры, соответствующие последовательностям мутантных типов, или полиморфных или аллельных вариантов НК.

48. Способ по любому из пп.31-47 для обнаружения последовательностей нуклеиновых кислот, детерминирующих синтез диагностически важных белков; точечных нуклеотидных мутаций, делеций, инсерций, инверсий и транслокаций, а также транспозонов и мобильных IS-элементов.

49. Способ по любому из пп.31-47 для обнаружения микроорганизмов и вирусов по специфическим последовательностям нуклеиновых кислот.

50. Способ по любому из пп.31-47 для выявления и идентификации вида возбудителя заболевания; выявления генов, детерминирующих синтез токсинов; определения лекарственной устойчивости возбудителя; определения гомозиготного и гетерозиготного состояния мутаций; а также для целей эпидемиологического генотипирования.

51. Способ по любому из пп.31-47 для определения уровня экспрессии известных генов в органах и тканях, при различных патологических состояниях, на разных стадиях развития организма, а также при разного рода воздействиях на организм.

52. Способ по п.31 для обнаружения генов токсинообразования и резистентности к ампициллину на микрочипе способами мультиплексной ПЦР и аллель-специфичной ПЦР.

53. Способ по п.31 для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности возбудителя туберкулеза к рифампицину, способом аллель-специфичной ПЦР на микрочипе.

54. Способ по п.31 для обнаружения точечных нуклеотидных замен в гене brca1, ответственном за предрасположенность к раку молочной железы, спососюь аллель-специфичной ПЦР на микрочипе.

55. Набор для осуществления способа по любому из пп.1-30, включающий

а) биологический микрочип, состоящий из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр и содержащих набор иммобилизованных олигонуклеотидов;

б) буферы для проведения гибридизации на микрочипе и отмывки.

56. Набор по п.55, дополнительно содержащий по меньшей мере один из следующих компонентов: реагенты для выделения образцов НК; реагенты для фрагментации образцов НК; флуоресцентные красители для мечения фрагментированных образцов НК; праймеры, в том числе, меченные флуоресцентным красителем, и другие реагенты для амплификации и/или мечения образцов НК; реагенты для получения кДНК.

57. Набор для осуществления способа по любому из пп.31-54, включающий

а) биологический микрочип, состоящий из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр и содержащих набор иммобилизованных олигонуклеотидов;

б) буферы и другие реагенты для проведения ПЦР на микрочипе.

58. Набор по п.57, дополнительно содержащий по меньшей мере один из следующих компонентов: реагенты для выделения образцов НК, праймеры и другие реагенты для амплификации образцов НК, реагенты для получения кДНК.

59. Набор по п.55 для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов), способом по п.30.

60. Набор по п.57 для обнаружения генов токсинообразования и резистентности к ампициллину на микрочипе способом по п.52.

61. Набор по п.57 для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, способом по п.53.

62. Набор по п.57 для обнаружения точечных нуклеотидных замен в гене brca1, ответственном за предрасположенность к раку молочной железы, способом по п.54.

63. Биологический микрочип с дискриминирующими олигонуклеотидами для осуществления способа по любому из пп.1-54, состоящий из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр и содержащих набор иммобилизованных олигонуклеотидов.

64. Микрочип по п.63 для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов), способом по п.30.

65. Микрочип по п.63 для обнаружения генов токсинообразования и резистентности к ампициллину на микрочипе способом по п.52.

66. Микрочип по п.63 для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, способом по п.53.

67. Микрочип по п.63 для обнаружения точечных нуклеотидных замен в гене brca1, ответственном за предрасположенность к раку молочной железы, способом по п.54.

68. Дискриминирующие олигонуклеотиды для изготовления микрочипа по п.63 для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов), способом по п.30.

69. Дискриминирующие олигонуклеотиды для изготовления микрочипа по п.65 для обнаружения генов токсинообразования и резистентности к ампициллину на микрочипе способом по п.52.

70. Дискриминирующие олигонуклеотиды для изготовления микрочипа по п.66 для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, способом по п.53.

71. Дискриминирующие олигонуклеотиды для изготовления микрочипа по п.67 для обнаружения точечных нуклеотидных замен в гене brca1, ответственном за предрасположенность к раку молочной железы, способом по п.54.

 

Текст

Смотреть все

006512 Область техники, к которой относится изобретение Изобретение относится к молекулярной биологии, микробиологии и медицине и рассматривает способы анализа последовательностей нуклеиновых кислот (НК) на биологическом микрочипе, что может быть использовано для идентификации микроорганизмов и вирусов; определения генов, детерминирующих синтез диагностически важных белков, токсинов; определения точечных мутаций, делеций, инсерций, инверсий и транслокаций в НК; определения лекарственной устойчивости возбудителей; детекции транспозонов и других мобильных элементов (IS-элементов); определения уровня экспрессии генов; определения гомо- и гетерозиготного состояния мутаций, а также в целях эпидемиологического типирования. Изобретение также включает способ создания олигонуклеотидных микрочипов; способ получения олигонуклеотидных зондов для проведения гибридизации на микрочипе и праймеров для проведения ПЦР на микрочипе, который необязательно предусматривает выбор олигонуклеотидов в соответствии с формализованными требованиями; способы гибридизации и амплификации НК на микрочипе; процедуры подготовки образцов к анализу на микрочипах; способы регистрации и интерпретации результатов. Уровень техники В настоящее время идентификация многих микроорганизмов, в особенности медленно растущих и трудно культивируемых в лабораторных условиях, базируется на анализе последовательности 16S РНКGenotyping and Species Identification Using Hybridization Pattern Recognition Analysis of Generic Mycobacterium DNA Arrays. Genome Res., 8: 435-448; Troesch A., H. Nguyen, C.G. Miyada, S. Desvarenne, T.R. Gingeras, P.M. Kaplan., P. Cross, and C.Mabilat. 1999. Mycobacterium Species Identification and Rifampicin Resistance Testing with High-Density DNA Probe Arrays. J. Clin. Microbiol., 37: 49-55]. В то же время для идентификации могут быть использованы гены, уникальные для данного микроорганизма или группы микроорганизмов (например, ген mtp40, представленный в геноме только М. tuberculosis [Liebana E., A.Mycobacterium bovis. FEMS Microbiol. Lett. 83: 11-16, Liebana E., A. Aranaz, B. Francis, and D. Cousins. 1996. Assessment of Genetic Markers for Species Differentiation within the Mycobacterium tuberculosis Complex. J. Clin. Microbiol., 34: 933-938], недавно описанный межгенный участок senX3-regX3 [Magdalena J.,A. Vachee, P. Supply, and С Locht. 1998. Identification of a New DNA Region Specific for Members of Mycobacterium tuberculosis Complex. J. Clin. Microbiol., 36: 937-943], характерные для всех видов микобактерий туберкулезного комплекса), или даже гены, ответственные за синтез консервативных белков (например,ген rроВ, кодирующий РНК-полимеразу [Gingeras T.R., G. Ghandour, E. Wang, A. Berno, P.M. Small, F.High-Density DNA Probe Arrays. J. Clin. Microbiol., 37: 49-55]). В последнем случае, как и в случае 16S РНК, анализируются видоспецифичные различия в вариабельных участках генов. В том случае, когда заболевание вызвано вирусами, молекулярные методы идентификации возбудителя являются ценной альтернативой чрезвычайно трудоемким, дорогостоящим и требующим длительного времени методам с использованием культур клеток и тканей. Уже описаны основанные на полимеразной цепной реакции системы детекции вируса иммунодефицита человека I типа [Abbott M, Poiesz В, Byrne S, et al: Enzymatic gene amplification: Qualitative and quantitative methods for detecting proviralman papillomavirus infection. J Clin Microbiol 31:1003-1006, 1992]. Спектр возбудителей инфекционных заболеваний человека и разнообразные молекулярные методы, используемые для их идентификации,хорошо представлены в руководствах [Persing D.H., Ed. PCR Protocols for Emerging Infectious Diseases. 1996. ASM Press, Washington, Persing DH, Smith TF, Tenover FC, et al (eds): Diagnostic Molecular Microbiology: Principles and Applications. Washington, D.C., American Society for Microbiology, 1993]. Анализ последовательностей, проводимый с целью родовой/видовой идентификации организмов,предусматривает три основных методических подхода. 1. Амплификация выбранного участка генома с использованием термостабильных ферментов ДНКполимеразы (PCR) [Persing D.H., Ed. PCR Protocols for Emerging Infectious Diseases. 1996. ASM Press,Washington, Persing DH, Smith TF, Tenover FC, et al (eds): Diagnostic Molecular Microbiology: Principles andCell Probes 7:35-43, 1993] в ходе циклического процесса или изотермическая амплификация с использованием РНК-полимеразы и обратной транскриптазы (TAS/3SR) [Davis GR, Blumeyer К, DiMichele LJ, ettype 1 with a bead-based sandwich hybridization format. Proc Natl Acad Sci U S A 86:1173-1177, 1989]; 2. Гибридизация геномной или предварительно амплифицированной ДНК на мембранах, in situ и на биологических микрочипах [Dubiley S., Kirillov E and A. Mirzabekov. 1999. Polymorphism analysis andProc. Natl. Acad. Sci. USA 93, 4913-4918]. 3. Определение первичной нуклеотидной последовательности амплифицированного (с помощью обладающих широкой специфичностью праймеров) фрагмента ДНК путем секвенирования [Relman DA,Falkow S: Identification of uncultured microoganisms: Expanding the spectrum of characterized microbialof the uncultured bacillus of Whipple's disease. N Engl J Med 327:293-301, 1992, Wilson KH, Blitchington R,Frothingham R, et al: Phylogeny of Whipple's-disease-associated bacterium. Lancet 338:474-475, 1991]. Спектр методов, применяемых для детекции точечных мутаций, представлен гораздо шире. Однако большинство методов так или иначе связано с использованием PCR, что обусловливает как их достоинства, так и их общие недостатки. 1. Достройка цепи меченым дидезоксирибонуклеозидтрифосфатом [Marth GT, Korf I, Yandell MD etPCR Method Based on pncA and oxyR Sequences for Distinguishing Mycobacterium bovis from Mycobacterium tuberculosis: Intraspecific M.bovis pncA Sequence Polymorphism. J. Clin. Microbiol. 36:, 239-242]. 3. Анализ полиморфизма рестрикционных фрагментов (PCR-RFLP Analysis) [PCR-RFLP Detectionof point Mutations in the Catalase-Peroxidase Gene (katG) of Mycobacterium tuberculosis Associated with Isoniazid Resistance. In: PCR Protocols for Emerging Infectious Diseases (D.H. Persing, Ed.) (1996) ASM Press,Washington, pp. 144-149]. 4. Анализ конформационного полиморфизма одноцепочечной ДНК (PCR-SSCP Analysis) [DelgadoInfectious Diseases (D.H.Persing, Ed.) (1996) ASM Press, Washington, pp. 112-121]. 7. ПЦР-гетеродуплексный анализ (PCR-heteroduplex analysis) [Williams D.L., C.W.Limbers, L.Spring,S.Jayachandra, and T.P. Gillis. PCR-Heteroduplex Detection of Rifampicin-Resistant Mycobacterium tuberculosis. In: PCR Protocols for Emerging Infectious Diseases (D.H.Persing, Ed.) (1996) ASM Press, Washington, pp. 122-129]. 8. Метод несовершенного дуплекса с РНК (RNA mismatch analysis) [Dracopoli, N.C. Ed. "Detection ofClin. Microbiol., 34: 3129-3137]. 10. Метод обратной гибридизации ДНК с иммобилизованными на твердой подложке зондамиsputum and biopsy specimens from tuberculosis patients by PCR and line probe assay. Tubercle Lung Dis. 76: 425-430]. 11. Гибридизация на микроматрицах (Hybridization on microarray) [Gingeras T.R., G.Ghandour, E.and Rifampicin Resistance Testing with High-Density DNA Probe Arrays. J. Clin. Microbiol., 37: 49-55]. При исключительно высокой чувствительности, характерной для классических амплификационных методов (PCR, LCR, TAS/3SR), главной проблемой является ограниченное количество определяемых продуктов (молекул-мишеней) в одном эксперименте. Мультиплексный вариант амплификации не позволяет определить более 20 продуктов (обычно гораздо меньше), отличается сложностью и громоздкостью подбора праймеров, что, по-видимому, и не позволило данному методу найти широкое применение. В то время как для PCR-методов стратегия борьбы с переносом ампликонов разработана [Cimino GD,Metchette КС, Tessman JW, et al: Post-PCR sterilization: A method to control carryover contamination for theuracil DNA glycosylase to control carry-over contamination in polymerase chain reaction. Gene 93:125-128,1990], при использовании LCR или TAS в диагностических целях система контроля контаминации отсутствует. Серьезной проблемой остается получение и ложноотрицательных результатов, что может быть обусловлено наличием ингибиторов полимеразных реакций в анализируемых образцах. Методы достройки цепи и аллель-специфичная ПЦР требуют постановки независимых реакций по числу изучаемых мутаций и, соответственно, большого количества изучаемого образца. Методы анализа полиморфизма рестрикционных фрагментов и конформационной подвижности одноцепочечной ДНК, ПЦР-гетеродуплексный анализ и метод несовершенного дуплекса с РНК отличаются трудоемкостью, занимают большое количество времени и дают заключение только о наличии/отсутствии мутации, но не ее типе. Последний зачастую обладает самостоятельной прогностической ценностью; в ряде случаев имеется прямая корреляция между типом мутации и уровнем устойчивости к тому или иному антибиотику или тяжестью прогноза течения заболевания. Методы, основанные на анализе подвижности ДНК, требуют использования электрофореза в полиакриламидном геле, устройств для поддержания заданной температуры в геле и, как правило, радиоактивной метки, что неприемлемо в условиях медицинских диагностических лабораторий. Кроме того, для метода несовершенного дуплекса предъявляются повышенные требования к отсутствию РНК-азы и в-3 006512 ряде случаев он не приемлем для детекции дуплекса G-U. Основными недостатками метода гибридизации на мембранах и in situ являются низкая чувствительность и высокая трудоемкость. Методу также присуща невысокая производительность и длительность процедуры. Не исключено получение как ложноположительных, так и ложноотрицательных результатов. Указанные недостатки служат лимитирующими факторами для широкого применения в медицинских диагностических исследованиях. Метод обратной гибридизации амплифицированного фрагмента ДНК с иммобилизованными на подложке зондами отличается трудоемкостью и высокой стоимостью. Секвенирование ДНК не нашло широкого применения в повседневной клинической практике из-за высокой стоимости, трудоемкости, необходимости использования дорогостоящего секвенирующего оборудования. Кроме того, прямое секвенирование требует выделения чистой культуры возбудителя. Методы структурно-специфического расщепления и дидезоксифингерпринтинг требуют стандартизации (подбора условий), что увеличивает трудоемкость. Кроме того, дидезоксифингерпринтинг выполняется с радиоактивной меткой, и разделение продуктов реакции ведется в полиакриламидном геле. Наиболее близким к заявляемому способу анализа последовательностей НК с использованием олигонуклеотидного биологического микрочипа является описанный ранее метод [Gingeras T.R., G.Identification and Rifampicin Resistance Testing with High-Density DNA Probe Arrays. J. Clin. Microbiol., 37: 49-55], который направлен, в основном, на определение полной последовательности изучаемого фрагмента НК. Метод предусматривает применение нестандартного твердофазного химического синтеза олигонуклеотидов непосредственно на поверхности подложки в сочетании с фотолитографическим способом изготовления микрочипов. Вследствие этого в каждой ячейке такого микрочипа находится не индивидуальный олигонуклеотид, а смесь продуктов синтеза, в которой на долю полноразмерного олигонуклеотида приходится от 25% (при длине 20 нуклеотидов) до 40% (при длине 10 нуклеотидов). Кроме того,близкое расположение иммобилизованных олигонуклеотидов на поверхности микрочипа приводит к тому, что находящиеся в соседних ячейках молекулы олигонуклеотидов могут взаимодействовать друг с другом, а молекула анализируемой НК может одновременно взаимодействовать сразу с несколькими ячейками микрочипа. В результате термодинамика процесса образования дуплексов на микрочипе становится гетерогенной и сильно отличной от термодинамики в гомогенном водном растворе, что драматически снижает дискриминацию совершенных и несовершенных дуплексов на таком микрочипе. Вследствие этого нельзя оганичиться использованием набора только тех олигонуклеотидных зондов, которые необходимы и достаточны для однозначного определения мутаций в известной последовательности ДНК. По этой причине, например, микрочип, позволяющий определять первичную нуклеотидную последовательность фрагмента rро b гена М. tuberculosis длиной 705 п.н., требует наличия 5640 различных олигонуклеотидных зондов. Стоимость производства такого микрочипа очень высока, а для регистрации и интерпретации результатов гибридизации требуется сложное регистрирующее оборудование и математическое обеспечение. Метод гибридизации на микрочипах для определения видовой принадлежности микобактерий требует выделения чистой культуры микроорганизма. Наконец, наличие повторяющихся коротких мотивов или даже достаточно протяженных последовательностей, характерное для многих микроорганизмов, представляет значительные сложности для анализа описанным методом гибридизации на микрочипах. Данные недостатки устраняются в настоящем изобретении. Сущность изобретения Разработан способ анализа последовательностей НК на биологическом микрочипе, содержащем иммобилизованные дискриминирующие олигонуклеотиды. Биологический микрочип состоит из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр. Разработанный способ включает получение очищенных препаратов олигонуклеотидов, иммобилизацию олигонуклеотидов в объеме трехмерных гидрофильных микроячеек биологического микрочипа, подготовку анализируемого образца, анализ образца путем гибридизации или ПЦР, регистрацию и интерпретацию результатов анализа. В предложенном способе в качестве анализируемого образца используют различные объекты, содержащие нуклеиновые кислоты, включающие очищенные препараты нуклеиновых кислот, чистые и накопительные культуры микроорганизмов и вирусов, клинический материал, выделенный от пациента,и другие образцы естественного происхождения, включая воду, почву, смывы, специально подготовленные пробы воздуха. Указанные нуклеиновые кислоты представляют собой РНК, представленные в клетке как большим, включая рРНК, так и малым числом копий, и ДНК, также представленные в клетке как большим, включая ДНК плазмид, вирусов, транспозонов и мобильных IS-элеменов, так и малым числом копий. В том случае, когда анализируют известные последовательности НК, предварительно проводят рас-4 006512 чет первичной и вторичной структуры олигонуклеотидов, иммобилизуемых в ячейках микрочипа, и выбирают только те из них, которые необходимы и достаточны для однозначной идентификации известных мутаций, полиморфных или аллельных вариантов анализируемых последовательностей, а также для изготовления контрольных ячеек. Если же целью является обнаружение неизвестных мутаций, полиморфных или аллельных вариантов известных последовательностей, а также при анализе неизвестных последовательностей нуклеиновых кислот вместо набора дискриминирующих олигонуклеотидов используют полный набор всех возможных олигонуклеотидов заданной длины. Для проведения анализа путем гибридизации при выборе дискриминирующих олигонуклеотидов с учетом размера и сложности анализируемой последовательности и, в частности, наличия повторов и протяженных гомополимерных последовательностей определяют длину дискриминирующих олигонуклеотидов, обеспечивающую их специфичность в отношении анализируемой последовательности. Для каждой позиции, для которой известны мутации, полиморфизм или аллельные варианты, подбирают набор специфичных дискриминирующих олигонуклеотидов, способный выявлять известные замены, делеции и инсерции. Используя компьютерные программы, рассчитывают температуры плавления олигонуклеотидов и, варьируя их длину, добиваются того, чтобы разброс температур плавления олигонуклеотидов составлял не более 4-5 С. Избегают таких олигонуклеотидов, которые способны формировать вторичные структуры типа шпильки с высокими температурами плавления. Положение детектируемых вариабельных нуклеотидов и других нуклеотидных перестроек выбирают по возможности не далее 1-4 нуклеотида от середины соответствующего дискриминирующего олигонуклеотида. При проведении анализа путем гибридизации подготовка анализируемого образца включает выделение, необязательно фрагментацию, необязательно синтез кДНК, необязательно амплификацию при помощи ПЦР и флуоресцентное мечение указанных нуклеиновых кислот. При анализе рибосомальной РНК подготовка анализируемого образца включает выделение рРНК, фрагментацию выделенной рРНК и ковалентное мечение фрагментированной рРНК флуоресцентной меткой. При анализе РНК, представленных в клетке малым числом копий, подготовка анализируемого образца включает выделение РНК,синтез кДНК на матрице выделенной РНК, амплификацию кДНК с помощью ПЦР, необязательно фрагментацию амплифицированной ДНК и мечение амплифицированной ДНК флуоресцентной меткой. Флуоресцентную метку можно вводить как после ПЦР во фрагментированную амплифицированную ДНК, так и непосредственно во время амплификации с помощью стандартной ПЦР с использованием одного или двух флуоресцентно меченных праймеров с получением двухцепочечного флуоресцентно меченного продукта или с помощью двухстадийной ПЦР, включающей стандартную ПЦР на первой стадии и асимметричную ПЦР с использованием флуоресцентно меченого праймера на второй стадии с получением одноцепочечного флуоресцентно меченного продукта. При анализе ДНК, представленных в клетке большим числом копий, подготовка анализируемого образца включает выделение указанной ДНК, фрагментацию выделенной ДНК и мечение фрагментированной ДНК флуоресцентной меткой. При анализе ДНК, представленных в клетке малым числом копий, подготовка анализируемого образца включает выделение ДНК, амплификацию выделенной ДНК с помощью ПЦР, необязательно фрагментацию амплифицированной ДНК и мечение амплифицированной ДНК флуоресцентной меткой. Флуоресцентную метку можно вводить как после ПЦР во фрагментированную амплифицированную ДНК, так и непосредственно во время амплификации с помощью стандартной ПЦР с использованием одного или двух флуоресцентно меченных праймеров с получением двухцепочечного флуоресцентно меченного продукта или с помощью двухстадийной ПЦР, включающей стандартную ПЦР на первой стадии и асимметричную ПЦР с использованием флуоресцентно меченого праймера на второй стадии с получением одноцепочечного флуоресцентно меченного продукта. Разработанный способ предусматривает анализ образца путем гибридизации на биологическом микрочипе в гибридизационном растворе, содержащем буферный компонент для поддержания рН, соль для создания ионной силы и необязательно дестабилизирующий водородные связи агент, в герметичной гибридизационной камере при температуре, зависящей от температуры плавления иммобилизованных на микрочипе дискриминирующих олигонуклеотидов. В качестве дестабилизирующего водородные связи агента используют гуанидин тиоцианат, мочевину или формамид. Регистрацию результатов гибридизации проводят с помощью регистрирующих устройств на базе широкопольной оптики, оснащенных источником света для возбуждения флуоресценции, или лазерных сканаторов различного типа. При использовании устройств на базе широкопольной оптики изображение микрочипа в люминесцентном свете может быть зарегистрировано при помощи фотопленки или цифрового детектора изображения, например ПЗС-камеры. При использовании лазерных сканаторов регистрация результатов гибридизации может быть осуществлена либо путем сплошного сканирования микрочипа с последующим анализом полученного изображения, либо путем избирательного сканирования только участков микрочипа, на которых расположены ячейки. Интерпретацию результатов гибридизации осуществляют путем сравнения интенсивностей сигнала в ячейках, выявляющих образование совершенных и несовершенных гибридизационных дуплексов. При проведении анализа с целью определения присутствия специфических последовательностей нуклеиновых кислот интерпретацию результатов гибридизации осуществляют путем сравнения интенсивностей-5 006512 сигнала в ячейках, содержащих специфичные дискриминирующие олигонуклеотиды, и контрольных ячейках, содержащих неспецифичные олигонуклеотиды. При проведении анализа с целью выявления мутаций, полиморфизма или аллелизма генов интерпретацию результатов осуществляют путем сравнения интенсивностей сигналов в ячейках, содержащих дискриминирующие олигонуклеотиды, соответствующие последовательностям дикого типа, и в ячейках, содержащих дискриминирующие олигонуклеотиды, соответствующие последовательностям мутантных типов или полиморфных или аллельных вариантов указанных нуклеиновых кислот. Для проведении анализа с помощью ПЦР при выборе дискриминирующих праймеров устанавливают их специфичность в отношении анализируемой последовательности. Для каждой позиции, для которой известны мутации, полиморфизм или аллельные варианты, подбирают набор специфичных дискриминирующих праймеров, различающихся по своему 3'-концу и способных выявлять известные замены,делеции и инсерции. Используя компьютерные программы, рассчитывают температуры плавления праймеров и, варьируя их длину, добиваются того, чтобы разброс температур плавления праймеров внутри набора не превышал 3-4 С. Избегают таких праймеров, которые способны формировать вторичные структуры типа шпильки с высокими температурами плавления. При проведении анализа с помощью ПЦР подготовка анализируемого образца включает выделение нуклеиновых кислот и необязательно синтез кДНК. При анализе РНК подготовка анализируемого образца включает выделение РНК и синтез кДНК на матрице выделенной РНК. При анализе ДНК подготовка анализируемого образца включает выделение ДНК. Разработанный способ предусматривает анализ образца с помощью ПЦР на биологическом микрочипе с использованием пары внешних прямого и обратного праймеров, причем прямой праймер иммобилизован в ячейке биологического микрочипа, а флуоресцентно меченный обратный праймер находится в растворе над микрочипом. Для выявления известных замен, делеций, инсерций и нуклеотидных перестроек анализируемой последовательности разработанный способ предусматривает анализ образца с помощью аллель-специфичной ПЦР на микрочипе, в ячейках которого иммобилизованы прямые дискриминирующие праймеры. Для ускорения анализа на 5-10 циклов за счет эффективной преамплификации анализируемой последовательности в растворе над микрочипом в реакционную смесь может быть добавлен внешний прямой праймер. С целью одновременного обнаружения нескольких последовательностей разработанный способ предусматривает анализ образца с помощью мультиплексного варианта ПЦР,включающего амплификацию каждой анализируемой последовательности своей парой специфичных внешних праймеров, причем прямые праймеры иммобилизуют в соответствующих ячейках микрочипа, а меченные флуоресцентной меткой обратные праймеры находятся в растворе над микрочипом. Для ускорения анализа на 5-10 циклов за счет эффективной преамплификации анализируемых последовательностей в растворе над микрочипом в реакционную смесь могут быть добавлены внешние прямые праймеры. Внешний прямой праймер, используемый для преамплификации, одновременно может служить и дискриминирующим праймером, иммобилизованным в ячейке микрочипа. В качестве дискриминирующих праймеров, иммобилизованных в ячейках микрочипа, для выявления известных мутаций, инсерций,делеций в конкретной позиции анализируемой последовательности также могут быть использованы внутренние прямые праймеры, отличающиеся от внешнего прямого праймера, используемого для преамплификации. Регистрацию результатов ПЦР осуществляют в процессе проведения ПЦР на микрочипе с использованием оптического регистрирующего устройства, включающего термостатированный столик, оснащенный термоконтроллером, позволяющим осуществлять программируемое циклическое изменение температуры, на который помещают герметичную реакционную камеру, флуоресцентный микроскоп,оснащенный источником света для возбуждения флуоресценции, ПЗС-камеру, компьютер, позволяющий осуществлять постоянный мониторинг флуоресцентного сигнала в процессе проведения ПЦР и преобразование его в цифровой вид, и компьютерную программу для обработки данных. Интерпретацию результатов ПЦР на микрочипе осуществляют путем сравнения интенсивностей флуоресценции ячеек, выявляющих образование специфичного продукта ПЦР. При проведении анализа с целью определения присутствия специфических последовательностей нуклеиновых кислот интерпретацию результатов ПЦР осуществляют путем сравнения интенсивностей флуоресценции ячеек, содержащих специфичные дискриминирующие праймеры, и контрольных ячек, содержащих неспецифичные праймеры. При проведении анализа с целью выявления мутаций, полиморфизма или аллелизма генов интерпретацию результатов ПЦР осуществляют путем сравнения интенсивностей флуоресценции ячеек,содержащих специфичные дискриминирующие праймеры, соответствующие последовательностям дикого типа, и ячеек, содержащих специфичные дискриминирующие праймеры, соответствующие последовательностям мутантных типов или полиморфных или аллельных вариантов указанных нуклеиновых кислот. Разработанный способ может быть применен для обнаружения последовательностей нуклеиновых кислот, детерминирующих синтез диагностически важных белков, используемых в дальнейшем для диагностики патологических состояний. Способ также может быть использован для обнаружения микроорганизмов и вирусов по специфическим последовательностям нуклеиновых кислот, для детекции точеч-6 006512 ных нуклеотидных мутаций, делеций, инсерций, инверсий и транслокаций, для детекции транспозонов и коротких мобильных IS-элементов, для определения вида возбудителя заболевания, выявления генов,детерминирующих синтез токсинов, для определения лекарственной устойчивости возбудителя, определения гомозиготного и гетерозиготного состояния мутаций, для целей эпидемиологического генотипирования. Способ позволяет определять уровни экспрессии известных генов в различных органах и тканях,при различных патологических состояниях на разных стадиях развития организма, а также при различных воздействиях на организм. Осуществление предложенного способа анализа последовательностей нуклеиновых кислот предусматривает использование набора, включающего биологический микрочип, содержащий соответствующий конкретным задачам специфичный набор иммобилизованных дискриминирующих олигонуклеотидов, и по необходимости - реагенты для выделения образцов НК, реагенты для фрагментации образцов НК, флуоресцентные красители для мечения фрагментированных образцов НК, праймеры, в том числе меченные флуоресцентным красителем, для амплификации и/или мечения образцов НК, реагенты для получения кДНК, буферы для проведения гибридизации на микрочипе и отмывки, буфер и другие реагенты для проведения ПЦР на микрочипе, а также по необходимости - регистрирующее устройство. На основе предложенного способа анализа последовательностей нуклеиновых кислот на биологическом микрочипе, содержащем иммобилизованные дискриминирующие олигонуклеотиды, разработаны способ идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов), методом гибридизации на микрочипе, способ обнаружения генов токсинообразования и резистентности к ампициллину на микрочипе способами мультиплексной ПЦР и аллельспецифичной ПЦР, способ обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, способом аллель-специфичной ПЦР на микрочипе и способ обнаружения точечных нуклеотидных замен в гене brса 1, ответственном за предрасположенность к раку молочной железы, способом аллель-специфичной ПЦР на микрочипе. На основе предложенного способа анализа последовательностей нуклеиновых кислот на биологическом микрочипе, содержащем иммобилизованные дискриминирующие олигонуклеотиды, разработан набор для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов), методом гибридизации на микрочипе, набор для обнаружения генов токсинообразования и резистентности к ампициллину способами мультиплексной ПЦР и аллель-специфичной ПЦР на микрочипе, набор для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, способом аллель-специфичной ПЦР на микрочипе и набор для обнаружения точечных нуклеотидных замен в гене brса 1, ответственном за предрасположенность к раку молочной железы, способом аллель-специфичной ПЦР на микрочипе. На основе предложенного способа анализа последовательностей нуклеиновых кислот на микрочипе, содержащем иммобилизованные дискриминирующие олигонуклеотиды, разработан микрочип для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов), методом гибридизации на микрочипе, микрочип для обнаружения генов токсинообразования и резистентности к ампициллину способами мультиплексной ПЦР и аллель-специфичной ПЦР на микрочипе, микрочип для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, способом аллель-специфичной ПЦР на микрочипе и микрочип для обнаружения точечных нуклеотидных замен в гене brса 1, ответственном за предрасположенность к раку молочной железы, способом аллель-специфичной ПЦР на микрочипе. На основе предложенного способа анализа последовательностей нуклеиновых кислот на микрочипе, содержащем иммобилизованные дискриминирующие олигонуклеотиды, разработаны дискриминирующие олигонуклеотиды для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов) методом гибридизации на микрочипе, дискриминирующие олигонуклеотиды для обнаружения генов токсинообразования и резистентности к ампициллину способами мультиплексной ПЦР и аллель-специфичной ПЦР на микрочипе, дискриминирующие олигонуклеотиды для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, способом аллель-специфичной ПЦР на микрочипе и дискриминирующие олигонуклеотиды для обнаружения точечных нуклеотидных замен в гене brca1, ответственном за предрасположенность к раку молочной железы, способом аллель-специфичной ПЦР на микрочипе. Преимущества способа при использовании микрочипов Основными преимуществами являются низкая себестоимость проводимого анализа; универсальность изготовления микрочипов с применением стандартных технологий синтеза и очистки олигонуклеотидов; возможность одновременного анализа большого количества последовательностей НК на одном микрочипе; многофункциональное применение (различные типы методик, различные объекты, оба типа нуклеиновых кислот). Перечень чертежей Изобретение иллюстрируется 16 чертежами, где приведены: на фиг. 1 - схема расположения олигонуклеотидов на микрочипе;-7 006512 на фиг. 2 - гибридизационная картина, полученная при анализе последовательности РНК клеток линии HL-60 на микрочипе; на фиг. 3 - гибридизационная картина, полученная при анализе последовательности РНК клеток линии К-562 на микрочипе; на фиг. 4 - гибридизационная картина, полученная при анализе последовательности РНК клеток линии NB4 на микрочипе; на фиг. 5 - расположение олигонуклеотидов по номерам на микрочипе для обнаружения рифампицин-устойчивых штаммов М. Tuberculosis; на фиг. 6 - соответствие между расположением олигонуклеотидов на микрочипе и выявляемыми ими мутациями в аминокислотной последовательности; на фиг. 7 - соответствие между расположением олигонуклеотидов на микрочипе и выявляемыми ими мутациями в нуклеотидной последовательности (указаны триплеты); на фиг. 8 - картина, полученная при гибридизации образца, содержащего ДНК штамма М. tuberculosis дикого типа, чувствительного к рифампицину; на фиг. 9 - картина, полученная при гибридизации образца, содержащего ДНК мутантного штамма М. tuberculosis, резистентного к рифампицину; на фиг. 10 - картина, полученная при гибридизации образца, содержащего ДНК мутантного штамма М. tuberculosis, резистентного к рифампицину; на фиг. 11 - расположение праймеров на микрочипе для проведения ПЦР при детекции генов токсинов и гена резистентности к антибиотикам пенициллинового ряда; на фиг. 12 - принципиальная схема ПЦР и аллель-специфичной ПЦР для обнаружения генов токсинообразования и резистентности к ампициллину на микрочипе; на фиг. 13 - накопление флуоресцентного сигнала в ячейках микрочипа, содержащих специфические праймеры к фрагментам гена pag4 и sht, в процессе амплификации образцов, содержащих гены pag4(А) или sht (Б); 1. накопление сигнала в ячейке, содержащей праймер к фрагменту pag4; 2. накопление сигнала в ячейке, содержащей праймер к фрагменту sht; ось ординат - интенсивность флуоресценции, у.е.; ось абсцисс - амплификационные циклы. На фиг. 14 - картина ПЦР-амплификации на микрочипе; А. Амплификация образца, содержащего ген протективного антигена В. anthracis и ген устойчивости к ампициллину. Б. Амплификация образца, содержащего ген устойчивости к ампициллину и ген, детерминирующий синтез шигеллезного токсина. Стрелками показан положительный результат ПЦР. На фиг. 15 - картина ПЦР на микрочипе, детектирующем точечные мутации в гене rроВ М. tuberculosis; На фиг.16 - схема расположения праймеров в ячейках микрочипа для обнаружения точечных нуклеотидных замен в гене brcal методом аллель-специфичной ПЦР (I) и результаты ПЦР (II), полученные при анализе препаратов, содержащих: А - ДНК, не имеющую мутаций; Б - ДНК, имеющую мутацию(СТ) в гомозиготном состоянии; В -ДНК, имеющую мутацию (СТ) в гетерозиготном состоянии. Сведения, подтверждающие возможность осуществления изобретенияI. Общие принципы создания диагностического микрочипа для анализа последовательностей НК. Диагностический микрочип создается по следующей схеме. 1. Выбирают специфические последовательности НК (молекулы-мишени) для детекции или дискриминации при помощи микрочипа. 2. Выбирают тип анализируемой НК (РНК или ДНК). 3. Исходя из особенностей локализации вариабельных участков, типа изучаемого объекта и с учетом специфических требований, предъявляемых к микрочипу (времени проведения анализа, прогностической значимости положительных и отрицательных результатов и др.), решают, какой из подходов(гибридизационный или ПЦР и ее варианты) является оптимальным для анализа выбранной последовательности НК. 4. По необходимости выбирают специфические наборы олигонуклеотидов (праймеров) в сответствии с пунктами, изложенными в разделе Выбор олигонуклеотидов для анализа последовательностей НК при помощи микрочипа. 5. Выбирают способ выделения НК и ее последующей подготовки для анализа при помощи микрочипа (см. раздел Обработка изучаемого образца). Выбор специфических последовательностей НК (молекулы-мишени) для детекции или дискриминации при помощи микрочипа В каждом конкретном случае выбор молекулы-мишени для анализа при помощи микрочипа определяется конкретной задачей. Например, для видовой диагностики микроорганизмов целесообразно использовать последовательности генов рибосомальной РНК, которые секвенированы для большого числа-8 006512 микрорганизмов и которые широко используются в геносистематике. При определении устойчивости микроорганизма к антибиотику естественно анализировать последовательности тех генов, которые вовлечены в механизм устойчивости, если таковые известны. Принципы выбора типа нуклеиновой НК для анализа на микрочипе Выбор типа НК - РНК или ДНК для анализа на микрочипе диктуется специфическими свойствами содержащего эти НК объекта. В том случае, когда объект содержит только РНК или ДНК, как, например,некоторые вирусы, выбор является однозначным. Использование РНК оправдано тогда, когда дифференциально анализируют экспрессию тех или иных генов в разных тканях или органах или на разных стадиях дифференцировки в одной и той же ткани, или, например, активаторов или супрессоров при раковой трансформации клеток. При злокачественных заболеваниях крови (лейкозах) также целесообразно анализировать последовательности и-РНК, поскольку в данном случае не только может быть получена информация об образовании в клетке химерных транскриптов в результате произошедших хромосомных транслокаций, но и однозначно установлено,какие гены и по какому положению оказываются слитыми. В таком случае используют обратную транскрипцию для получения кДНК, которую затем амплифицируют с помощью ПЦР. В настоящее время при проведении филогенетического анализа и установлении таксономического положения того или иного микроорганизма принято использовать последовательности рибосомальной РНК (рРНК) - 5S, 16S, 23S и спейсерных участков. При наличии такой информации в международных базах данных подобный же подход может быть реализован и с использованием микрочипов. В связи с тем, что рРНК в клетках микроорганизмов представлена большим числом копий, отпадает необходимость в предварительной амплификации таких последовательностей с помощью, например, ПЦР, и выделенный препарат рРНК после соответствующей стадии флуоресцентного мечения может быть прямо использован для анализа с помощью микрочипов. Вследствие крайней нестабильности РНК к действию РНКаз ко всем манипуляциям с РНК предъявляются чрезвычайно жесткие требования. В частности, выделяется специальная чистая от РНКаз зона лаборатории со специально зарезервированным для работы с РНК набором автоматических пипеток,расходных материалов, реактивов и т.д. Все растворы готовятся на специально обработанной для необратимой инактивации РНКаз воде или же подвергаются деконтаминации диэтилпирокарбонатом. В отличие от РНК, манипуляции с ДНК не требуют таких предосторожностей, поэтому во всех прочих случаях для анализа последовательностей нуклеиновых кислот предпочтительно использовать ДНК. Выбор олигонуклеотидов для анализа последовательностей НК при помощи микрочипа При использовании гибридизационной техники олигонуклеотиды для создания микрочипа подбирают, используя следующие критерии: а) с учетом размера и сложности анализируемой последовательности (наличие повторов, протяженных гомополимерных участков) выбирают длину дискриминирующих олигонуклеотидов, обеспечивающую их специфичность в отношении анализируемой последовательности; обычно используют олигонуклеотиды длиной 15-23 нуклеотида; в случае, когда для анализа используется амплифицированный фрагмент ДНК длиной не более 150-200 оснований, минимальный размер специфических дискриминирующих олигонуклеотидов может быть уменьшен до 12; б) для каждой позиции, для которой известны мутации, полиморфизм или аллельные варианты,подбирают набор специфических дискриминирующих олигонуклеотидов (СНО), способный выявлять известные замены, делеции и инсерции; в) для одновременного анализа сразу нескольких полиморфных сайтов количество СНО соответствует количеству анализируемых сайтов; г) каждый выбранный СНО должен обладать уникальной специфичностью в отношении изучаемого участка последовательности нуклеиновых кислот; д) используя компьютерные программы, рассчитывают температуры плавления олигонуклеотидов для каждого из выбранных СНО; е) варьируя длину дискриминирующих олигонуклеотидов, добиваются того, чтобы разброс температур плавления олигонуклеотидов внутри СНО и между различными СНО не превышал 4-5 С; ж) избегают таких олигонуклеотидов, которые способны формировать вторичные структуры типа шпильки с высокими температурами плавления; з) детектируемые вариабельные нуклеотиды и другие нуклеотидные перестройки должны по возможности приходиться на 1-4 положение от середины соответствующего дискриминирующего олигонуклеотида; допускается располагать вариабельный нуклеотид ближе к тому или иному концу, но не ближе 6-й позиции от конца; в некоторых случаях именно такая локализация вариабельного основания обеспечивает наилучшую дискриминацию между совершенным и несовершенным дуплексами, хотя абсолютная интенсивность гибридизационных сигналов заметно снижается, что не позволяет регистрировать результаты простым фотографирующим устройством. При использовании ПЦР и ее модификаций на микрочипе дискриминирующие олигонуклеотиды для его создания подбирают согласно следующим критериям: а) для каждой позиции, для которой известны мутации, полиморфизм или аллельные варианты,-9 006512 подбирают набор специфических дискриминирующих праймеров, различающихся только по своему 3'концу, способный выявлять известные замены, делеции и инсерции; б) каждый выбранный набор олигонуклеотидов (СНО) должен обладать уникальной специфичностью в отношении изучаемого участка последовательности НК; в) температура плавления праймеров при проведении реакции на микрочипе выбирается выше, чем при аналогичной ситуации в пробирке; оптимальной представляется температура плавления выше 65 С; г) длина олигонуклеотидов, выполняющих роль праймеров, определяется выбранной температурой плавления и их последовательностью; д) используя компьютерные программы, рассчитывают температуры плавления дискриминирующих праймеров и, варьируя их длину, добиваются того, чтобы разброс температур плавления праймеров внутри набора не превышал 3-4 С; е) для одновременного анализа сразу нескольких полиморфных сайтов количество специфических наборов олигонуклеотидов соответствует количеству анализируемых сайтов; ж) при использовании аллель-специфичной ПЦР на микрочипе возможен выбор праймеров, комплементарных любой из двух цепей анализируемой ДНК; следует избрать ту цепь, праймеры на которую не формируют шпилек в области своего 3'-конца; з) праймеры для проведения ПЦР на микрочипе следует выбрать так, чтобы размер амплифицируемого фрагмента составлял 70-250 пар оснований (п.о.); амплификация более длинных фрагментов увеличивает время проведения реакции, в то время как более короткие ампликоны не позволяют контролировать специфичность реакции с помощью флуоресцентно меченного зонда, комплементарного к внутреннему участку достроенного в гелевой ячейке праймера; е) избегают таких олигонуклеотидов, которые способны формировать вторичные структуры типа шпильки с высокими температурами плавления. Методика изготовления микроматрицы для иммобилизации олигонуклеотидов с целью получения микрочипа Олигонуклеотиды для иммобилизации на микрочипе были синтезированы на автоматическом синтезаторе 394 DNA/RNA synthesizer (Applied Biosystems, USA) с использованием стандартной фосфоамидитной процедуры. Для синтеза олигонуклеотидов для гибридизационного микрочипа использовали 3'Amino-Modifier С 3 (или С 7) CPG 500 (Glen Research, USA), так что синтезированный олигонуклеотид содержал на своем 3'-конце спейсер со свободной аминогруппой. Олигонуклеотиды, используемые для проведения ПЦР на микрочипе, модифицировали по 5'-концу при помощи 5'-Amino-Modifier C6 (или С 12) (Glen Research, USA). Микроматрица, содержащая ячейки размером 100x100x20 мкм, приготовлена путем фотополимеризации 5%-го полиакриламидного геля, как описано ранее [Yershov, G., Barsky, V., Belgovskiy, A., Kirillov,Eu., Kreindlin, E., Ivanov, I., Parinov, S., Guschin, D., Drobishev, A., Dubiley, S.Mirzabekov, A. 1996. DNAanalysis and diagnostics on oligonucleotide microchips. Proc. Natl. Acad. Sci. USA 93, 4913-4918]. Гель активировали 2% трифторуксусной кислотой при комнатной температуре в течение 10 мин,отмывали водой и высушивали. Далее гель последовательно обрабатывали в Repel-Silane (2% раствор(вес/объем) диметилдихролсилана в 1,1,1 -трихлорэтане, LKB-Produkter AB, Sweden) - 30 с; дихлорметаном - 10 с; этанолом (95 об.%) - 10 с; промывали водой - 3 мин и высушивали. 1 мМ раствор олигонуклеотидов наносился иглой робота дважды в объеме 1 нл. Для стабилизации ковалентных связей между аминогруппами спейсеров, фланкирующих один из концов олигонуклеотидов, и альдегидными группами геля матрицу помещали в 0.1 М раствор пиридинборанового комплекса(Aldrich Chemical Co., USA) в хлороформе, наслаивали верхнюю водную фазу и выдерживали 12-16 ч при комнатной температуре. Далее микрочип дважды промывали этанолом (95 об.%) и водой. Непрореагировавшие альдегидные группировки восстанавливали свежеприготовленным раствором 0,1 М NaBH4(Aldrich) в течение 20 мин при комнатной температуре. Микрочип промывали водой, высушивали и хранили при комнатной температуре. Подготовка анализируемого образца В качестве первичного образца для анализа последовательности используют очищенные препараты НК, а также чистые и накопительные культуры микроорганизмов и вирусов, клинический материал, полученный от пациентов, другие образцы естественного происхождения, включающие воду, почву, смывы, образцы проб воздуха. В зависимости от характера образца, содержащего НК, и наличия примесей, присутствующих в образце, проводится специализированная обработка пробы с целью обеспечения доступа к НК и удаления примесей, могущих мешать проведению анализа при помощи микрочипа. В зависимости от подхода, который будет в дальнейшем использован, и типа НК применяют следующие способы подготовки образца к проведению анализа на микрочипе: а) выделение НК (ДНК или РНК), фрагментация и флуоресцентное мечение для последующей гибридизации на микрочипе; б) выделение РНК, представленной малым числом копий в клетке, получение кДНК в реакции обратной транскрипции и амплификация ДНК при помощи ПЦР; введение флуоресцентной метки может- 10006512 осуществляться одновременно с проведением амплификации путем добавления в реакционную смесь одного или обоих флуоресцентно меченных праймеров или же после фрагментации амплифицированной ДНК; еще один способ состоит в проведении двухстадийной ПЦР: на первой стадии проводится стандартная ПЦР, на второй стадии с целью получения одноцепочечного флуоресцентно меченного продукта проводится асимметричная ПЦР с использованием праймера, содержащего флуоресцентную метку; полученный одним из описанных выше способов флуоресцентно меченный продукт используется для гибридизации на микрочипе; в) выделение ДНК и ее амплификация при помощи ПЦР; введение флуоресцентной метки может осуществляться одновременно с проведением амплификации путем добавления в реакционную смесь одного или обоих флуоресцентно меченных праймеров или же после фрагментации амплифицированной ДНК; еще один способ состоит в проведении двухстадийной ПЦР: на первой стадии проводится стандартная ПЦР, на второй стадии с целью получения одноцепочечного флуоресцентно меченного продукта проводится асимметричная ПЦР с использованием праймера, содержащего флуоресцентную метку; полученный одним из описанных выше способов флуоресцентно меченный продукт используется для гибридизации на микрочипе; г) выделение РНК и синтез кДНК в реакции обратной транскрипции; полученная кДНК используется для анализа при помощи ПЦР на микрочипе; д) выделение ДНК для проведения ПЦР на микрочипе. Способы анализа последовательностей НК на микрочипе Анализируемый препарат НК, полученный, как описано в разделе Подготовка анализируемого образца, используют для проведения следующих реакций на микрочипе: а) метод РНК-дезоксиолигонуклеотид гибридизации, который может быть использован, например,для идентификации микроорганизмов по различиям в последовательностях 5S, 16S, и 23S РНК и спейсерных регионов, а также для определения точечных мутаций в РНК изучаемого объекта; б) метод ДНК-дезоксиолигонуклеотид гибридизации, который может быть использован для анализа последовательностей НК, детермиинирующих синтез диагностически важных белков; идентификации точечных мутаций и различных перестроек в последовательности ДНК (делеции, инверсии, инсерции,транслокации); определения транспозонов и коротких мобильных элементов (IS-элементов); дифференциального анализа экспрессии генов; в) метод аллель-специфичной ПЦР на микрочипе и ее модификации, который может быть использован для одновременного определения точечных мутаций, находящихся в одном или различных участках анализируемой НК; г) метод мультиплексной ПЦР на микрочипе, который может быть использован для одновременного анализа сразу нескольких последовательностей НК, детерминирующих синтез диагностически важных белков; различных перестроек в последовательности НК (делеции, инверсии, инсерции, транслокации); транспозонов и коротких мобильных элементов (IS-элементов); д) дополнительный контроль специфичности амплификации можно осуществлять путем гибридизации флуоресцентно меченных обратного праймера или зонда, комплементарного внутреннему участку цепи, достроенной в ходе ПЦР с иммобилизованного в ячейке микрочипа прямого праймера. Регистрация и интерпретация результатов анализа В зависимости от типа проведенной реакции могут быть использованы различные способы регистрации результатов. 1. Регистрацию гибридизационной картины проводят с помощью регистрирующих устройств на базе широкопольной оптики, включающих источник света для возбуждения флуоресценции и оборудование для регистрации флуоресцентного сигнала. В простейшем случае гибридизационная картина может быть зарегистрирована при помощи фотопленки. Более совершенным является использование цифрового детектора изображения, например ПЗС-камеры, в качестве оборудования для регистрации флуоресцентного сигнала. Примером использования такого оборудования является автоматический комплекс, состоящий из флуоресцентного микроскопа, 512x512 ПЗС-камеры (3x3 мм 2 поле зрения) и компьютера. Для регистрации и последующей обработки изображений применяют программу WinView (PrincetoneInstruments, USA), обработку интенсивности флуоресцентного сигнала проводят при помощи программ,использующих LabVIEW интерфейс (National Instruments, USA). 2. Регистрацию гибридизационной картины можно также проводить с использованием лазерных сканаторов различного типа. Одним из вариантов является сканирование всей поверхности микрочипа с последующим анализом полученного изображения. Другим вариантом является избирательное сканирование только тех участков микрочипа, на которых расположены ячейки. 3. Регистрацию результатов, полученных с применением ПЦР, проводят на автоматическом комплексе, подобном тому, что используют для регистрациии гибридизационной картины. Помимо флуоресцентного микроскопа, 512x512 ПЗС-камеры (3x3 мм 2 поле зрения) и компьютера, такой комплекс включает оснащенный термоконтроллером термостатированный столик, что позволяет осуществлять программируемое циклическое изменение температуры в помещенной на столик герметичной реакционной камере. При этом регистрацию результатов проводят по ходу реакции, что позволяет получить до- 11006512 полнительную информацию, например, в случае аллель-специфичной ПЦР. Интерпретацию результатов гибридизации проводят следующим образом. Визуально или с использованием программного обеспечения сравнивают интенсивности сигналов ячеек, выявляющих образование совершенных и несовершенных гибридизационных дуплексов. Когда целью анализа является определение той или иной специфической последовательности, сравнивают интенсивности сигналов ячеек,содержащих специфические в отношении этой последовательности дискриминирующие олигонуклеотиды, по сравнению с контрольными ячейками, содержащими неспецифические олигонуклеотиды. Когда целью анализа является выявление мутаций, полиморфизма или аллелизма генов, сравнивают интенсивности сигналов ячеек, содержащих дискриминирующие олигонуклеотиды, соответствующие последовательностям дикого и мутантного типов или полиморфным или аллельным вариантам анализируемой последовательности. Сопоставление интенсивностей сигналов проводят только между теми ячейками, которые содержат иммобилизованные дискриминирующие олигонуклеотиды, принадлежащие одному и тому же СНО и предназначенные для анализа единичного вариабельного нуклеотидного остатка или делеции, инсерции или инверсии. Нуклеотидную последовательность изучаемого образца считают строго комплементарной тому олигонуклеотиду, который иммобилизован в ячейке, обладающей максимальной интенсивностью сигнала. Аналогичным образом проводят сравнение интенсивностей сигналов для других локусов изучаемого образца. Обобщая результаты анализа различных локусов, выдают заключение о наличии мутаций или специфических нуклеотидных последовательностей в изучаемом образце нуклеиновых кислот. Сходным образом интерпретируют результаты, полученные с применением ПЦР. Отличие заключается в том, что вместо гибридизации иммобилизованного в ячейке олигонуклеотида с фрагментом НК изучаемого образца в гелевых ячейках происходит реакция амплификации ДНК, в результате которой и иммобилизованный прямой праймер, и находящийся в растворе обратный флуоресцентно меченный праймер достраиваются, образуя ампликон специфического размера, который по сути представляет собой аналог гибридизационного дуплекса. Существуют дополнительные методы контроля специфичности достраивания иммобилизованного праймера, основанные на гибридизации его после проведения ПЦР либо с меченым обратным праймером, либо с меченым внутренним зондом. Примеры Приведенные далее примеры являются предпочтительными, предназначены лишь для подтверждения возможности осуществления изобретения и не должны стать основанием для ограничения объема притязаний заявителя. Специалист в данной области техники без труда найдет возможности иных воплощений изобретения, безусловно, подпадающих под притязания заявителя, отраженные в формуле изобретения, приводимой ниже. Пример 1. Идентификация хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов), методом гибридизации на биологическом микрочипе. Пример показывает применение способа гибридизации на биологическом микрочипе для анализа последовательности РНК с целью идентификации хромосомных транслокаций и верификации последовательности в точке слияния генов, участвующих в транслокации. Клинический образец костного мозга или периферической крови подвергается гемолизу с целью выделения лейкоцитов, из лейкоцитов выделяют РНК, проводят реакцию обратной транскрипции, полученный образец кДНК используют как матрицу в ПЦР. Двухцепочечный продукт ПЦР фрагментируют ДНКазой I, включают флуоресцентно меченные аналоги дезоксинуклеотидтрифосфатов с помощью терминальной трансферазы и используют в гибридизации. Фрагментированный и меченный продукт гибридизуют на микрочип, содержащий олигонуклеотиды, представляющие собой участки последовательностей генов, вовлеченных в транслокации, как из смысловой так и из антисмысловой цепей. Анализируемый фрагмент ДНК образует совершенные гибридизационные дуплексы с соответствующими олигонуклеотидами. Со всеми остальными олигонуклеотидами анализируемый фрагмент ДНК будет образовывать несовершенные дуплексы. Дискриминацию совершенных и несовершенных дуплексов проводят, сравнивая интенсивности флуоресценции соответствующих ячеек микрочипа. Интенсивность сигнала в случае образования совершенного дуплекса выше, чем в случае несовершенного. Используя схему расположения олигонуклеотидов на микрочипе, определяют какие гены участвуют в транслокации, а также определяют последовательность в точке слияния этих генов. Олигонуклеотидный микрочип для идентификации хромосомных транслокаций при злокачественных заболеваниях крови. Олигонуклеотиды для иммобилизации на микрочипе были синтезированы на автоматическом синтезаторе 394 DNA/RNA Synthesizer (Applied Biosystems, USA ) с использованием стандартной фосфоамидитной процедуры. 3'-конец олигонуклеотидов содержал спейсер со свободной аминогруппой, который вводился в состав олигонуклеотида при синтезе путем использования 3'-Amino-Modifier С 7 CPG 500(Glen Research, USA). Микрочип был изготовлен как описано в п. Методика изготовления микроматрицы для иммобилизации олигонуклеотидов с целью получения микрочипа.- 12006512 Структура микрочипа для идентификации хромосомных транслокаций при злокачественных заболеваниях крови. Микрочип содержал 31 тип иммобилизованных олигонуклеотидов, список которых представлен в табл. 1. Схема расположения олигонуклеотидов на микрочипе приведена на фиг. 1. Левый вертикальный ряд включал олигонуклеотиды гена ABL, который служил позитивным контролем для определения качества препарата РНК, эффективности процедуры обратной транскрипции, фрагментации и мечения пробы. В горизонтальных рядах ячеек располагались олигонуклеотиды, представляющие собой участки последовательностей генов, вовлеченных в транслокации. Набор олигонуклеотидов в горизонтальном ряду для каждой транслокации включал олигонуклеотид из участка гена, входящего во все варианты химерных транскриптов для данной транслокации, далее олигонуклеотиды - последовательности в точке слияния, причем половина нуклеотидов в данном олигонуклеотиде принадлежала одному гену, вторая - другому гену, участвующему в транслокации. Для каждого олигонуклеотида был также синтезирован вариант, содержащий в середине две однонуклеотидные замены. Такие олигонуклеотиды обозначены на фиг. 1, как m. Таблица 1. Олигонуклеотиды, используемые в гибридизации. Знаками (+) и (-) обозначена принадлежность к смысловой и антисмысловой цепи, соответственно. Химерные олигонуклеотиды, представляющие собой последовательности из точки слияния, обозначены добавлением j к названию олигонуклеотида. Микрочип способен анализировать 4 типа транслокаций и суммарно 10 вариантов слияния между генами, участвующими в транслокациях. Обработка клеточных линий или клинического образца. 1. Использовали следующие клеточные линии, несущие специфические хромосомные транслокации: К-562, MV-4-11, NB4, REH. Клетки выращивали на среде RPMI с добавлением 10% эмбриональной телячьей сыворотки. За 18 часов перед выделением РНК клетки рассевали в концентрации 500 000 клеток/мл. 2. Клинический образец (костный мозг или кровь), предварительно смешанный с антикоагулянтом(не гепарином), подвергали гемолизу в растворе 0,8 % NH4Cl и последующему центрифугированию в течение 20 мин при 3000 об/мин для выделения фракции лимфоцитов.- 13006512 3. Выделение РНК проводили по общепринятой методике экстракцией кислым фенолом или с помощью набора реактивов RNAqueous фирмы Ambion, USA. Получение кДНК и амплификация химерных транскриптов методом двухраундовой мультиплексной nested-ПЦP с целью наработки двухцепочечного фрагмента гибридного гена, специфичного для каждой транслокации. 4. Перед проведением обратной транскрипции препарат РНК обрабатывали ДНКазой I (Gibco, BRL) по стандартной методике для удаления примеси ДНК. РНК (2-4 мкг) инкубировали при 70 С в течение 5 мин со смесью специфичных для указанных транслокаций кДНК-праймеров (10 пкмоль каждого ) и затем проводили обратную транскрипцию с ферментом Superscript II, Gibco BRL в количестве 200 ед. на 25 мкл реакционной смеси, содержащей 20 ед. ингибитора РНКазы ( Rnase inhibitor, Ambion, USA), пo 1MgCl2 при 42 С в течение 1 ч. 5. В 25 мкл ПЦР-смеси первого раунда вносили 1 мкл образца, полученного в п.4. Состав ПЦРсмеси: 67 мМ Трис- НСl, рН 8,6, 16,6 мМ (NH4)2SO, 0,01% Тритон Х-100, 1,5 мМ MgCl2, 0,2 мМ каждого из dNTP (Promega, USA), смесь праймеров первого раунда (Табл. 2) по 5 пмоль каждого и 1.5 единицы фермента Taq-полимераза фирмы Силекс (Россия). Всю смесь нагревали при 94 С в течение 5 мин,затем проводили 25 циклов амплификации по следующей схеме: 94 С - 30 с, 58 С - 30 с, 72 С - 1 мин. 6. В 100 мкл ПЦР-смеси второго раунда вносили 5 мкл продукта первого раунда ПЦР. Состав ПЦРсмеси был тот же, что и в первом раунде, с той разницей, что вместо праймеров первого раунда в реакцию брали смесь праймеров второго раунда (табл. 2) по 12,5 пмоль каждого и 5 единиц фермента Taqполимераза фирмы Силекс (Россия). Последовательности праймеров первого и второго раунда были взяты из работы [Pallisgaard N., Hokland P., Riishoj D. С, et al. 1998. Multiplex reverse transcriptionpolymerase chain reaction for simultaneous screening of 29 translocations and chromosomal aberrations in acuteleukemia. Blood. 92: 574-588], см. также табл. 1. Условия реакции были те же, что и в п.5, но после 25 циклов амплификации следовал этап достраивания цепи при 72 С в течение 10 мин. 7. Еще 1 мкл продукта обратной транскрипции из п.4 использовали для параллельной амплификации фрагмента гена ABL, постоянно экспрессирующегося в любой культуре. Амплификацию фрагмента гена ABL проводили в 100 мкл ПЦР-смеси того же состава, что и п.5, вместо праймеров второго раунда добавляли праймеры, специфичные для гена ABL: ABL5' (5'TTCAGCCGCCAGTAGCATCTGACTT3') иALL3' (5'AGATACTCAGCGGCATTG3'). 25 циклов амплификации были проведены: 94 С - 30 с, 58 С -30 с, и 72 С - 1 мин; и заканчивались стадией достраивания цепи при 72 С в течение 7 мин. Фрагментация и мечение двухцепочечного ПЦР-продукта. 8. Продукт второго раунда мультиплексной ПЦР из п.6 и продукт ПЦР из п.7 смешивали и очищали на колонке QIAquick Purification Kit (Qiagen, USA). Очищенный ПЦР- продукт фрагментировали с помощью фермента ДНКазы I ( Gibco, BRL). Фрагментацию проводили в 40 мкл буфера, содержащего 40 мМ Таблица 2. Праймеры, используемые для проведения мультиплексной ПЦР Трис- НС 1, рН 8,0, 55 мМ КСl и 2 мМ MgCl2 с добавлением 0,04 ед. фермента на каждые 2 мкг- 14006512 ПЦР-продукта. Фрагментация проводилась при 37 С в течение 20 мин с последующей инактивацией при 70 С в течение 10 мин. При этом основная часть фрагментов должна была иметь длину 50-100 п.о. 9. Флуоресцентное мечение продукта проводили с помощью фермента терминальная трансфераза(Promega, USA). Для этого к 40 мкл продукта из п.8 добавляли реакционную смесь, содержащую 100 мМ какодилатного буфера, рН 6,8, 1 мМ СаСl2, 0,1 мМ дитиотрейтол, 450 пмоль флуоресцентно меченного нуклеотида тетраметилродамин-6-дУТФ ( NEN, USA ) и 10 ед. терминальной трансферазы. Смесь инкубировали при 37 С в течение 1 ч и очищали на колонке QIAquick Nucleotide Removal Kit (Qiagen, USA). Гибридизация меченого продукта на микрочипе. 10. 25 мкл образца, полученного в п.9, использовали для гибридизации на микрочипе в буфере следующего состава: 10% формамид (Gibco BRL), 6x SSPE. Готовую гибридизационную смесь перед гибридизацией денатурировали при 94 С в течение 5 мин, охлаждали во льду и наносили на микрочип в гибридизационную камеру объемом 30 мкл (Sigma, USA). Гибридизацию проводили в течение ночи (16-18 ч) при комнатной температуре (22-24 С). Отмывку проводили в буфере 1x SSPE при комнатной температуре в течение 30 мин. Гибридизационную картину регистрировали на влажном чипе, в той же гибридизационной камере в буфере lx SSPE. Регистрация и интерпретация результатов гибридизации. Регистрацию гибридизационной картины проводят на автоматическом комплексе, состоящем из флуоресцентного микроскопа, 512x512 ПЗС-камеры (3x3 мм 2 поле зрения) и компьютера. Для сканирования и последующей обработки изображений применяют программу WinView (Princetone Instruments,USA), обработку интенсивности флуоресцентного сигнала проводят при помощи программ, использующих интерфейс LabVIEW (National Instruments, USA). Интерпретацию результатов проводили следующим образом. Гибридизационный сигнал в ячейках крайнего левого вертикального ряда, где иммобилизованы олигонуклеотиды, относящиеся к гену ABL,должен присутствовать на всех гибридизационных картинах. Он свидетельствует о том, что такие этапы подготовки пробы, как выделение РНК, обратная транскрипция, фрагментация, флуоресцентное мечение и сама гибридизация прошли нормально. Отсутствие гибридизационного сигнала в ячейках, расположенных правее в горизонтальных рядах, свидетельствует об отсутствии в клиническом образце химерных транскриптов, принадлежащих вышеперечисленным транслокациям. Наличие сигнала в ячейках,расположенных правее в горизонтальных рядах, свидетельствует о наличии в образце химерного транскрипта, принадлежащего одной из перечисленных транслокаций. По уровню расположения строки относительно левого столбца можно определить тип транслокации, а по тому, в каких ячейках регистрируется гибридизационный сигнал вдоль самой строки, определить вариант химерного транскрипта и, таким образом, верифицировать последовательность в точке слияния двух генов, участвующих в данной транслокации. На фиг. 2 представлена картина гибридизации образца, полученного из клеточной культуры HL-60. Гибридизационные сигналы наблюдаются только в ячейках левого вертикального ряда. В ячейках, расположенных правее в горизонтальных строках, сигналы отсутствуют. Делается заключение, что в образце отсутствуют клетки, содержащие вышеперечисленные транслокации. На фиг. 3 представлена картина гибридизации образца, полученного из клеточной культуры К-562. Наличие гибридизационных сигналов в левом вертикальном ряду свидетельствует о том, что все этапы приготовления образца прошли нормально. Появление сигналов в ячейках, расположенных в строке правее, свидетельствует о наличии транслокации. Ориентируясь по схеме микрочипа, можно определить,что это транслокация (9;22). Появление сигналов в определенных ячейках вдоль строки позволяет определить вариант слияния между участвующими в транслокации генами BCR и ABL как b3/а 2. Следует отметить, что в данном случае в гибридизации участвуют иммобилизованные олигонуклеотиды из смысловой цепи. Гибридизационные сигналы в ячейках, в которых иммобилизованы олигонуклеотиды с мисматчами, также регистрируются, но их интенсивность в 2-3 раза ниже, чем в ячейках, где иммобилизованы олигонуклеотиды, образующие совершенные дуплексы. На фиг. 4 представлена картина гибридизации образца, полученного из клеточной культуры NB4. Наличие гибридизационных сигналов в левом вертикальном ряду свидетельствует о том, что все этапы приготовления образца прошли нормально. Появление сигналов с ячеек, расположенных в строке, свидетельствует о наличии транслокации. Ориентируясь по схеме микрочипа, можно определить, что это транслокация (15;17). Появление сигналов в определенных ячейках вдоль строки позволяет определить,что данная транслокация в этой культуре представлена двумя вариантами слияния между участвующими в транслокации генами PML и RAR. Следует отметить, что в данном случае в гибридизации участвуют иммобилизованные олигонуклеотиды из антисмысловой цепи. Представленный способ позволяет в короткие сроки определить наличие или отсутствие в клетках определенных хромосомных перестроек, в том числе используя для анализа непосредственно клинический образец. Метод отличается от существующих в настоящее время аналогов (ПЦР с последующей гибридизацией по Саузерну) простотой выполнения и позволяет резко сократить время, требуемое для скрининга пациента по нескольким транслокациям, и существенно повысить достоверность обнаружения- 15006512 транслокации в анализируемом образце по сравнению со стандартным ПЦР анализом. Пример 2. Определение точечных нуклеотидных замен, приводящих к возникновению устойчивости микроорганизмов к рифампицину, в ДНК микобактерий туберкулеза на микрочипе. Пример показывает применение способа гибридизации на биологическом микрочипе для анализа последовательности ДНК с целью идентификации точечных мутаций; определения специфических последовательностей хромосомной, фаговой и плазмидной локализации, детерминирующих синтез диагностически важных белков; детекции различных перестроек в последовательности ДНК (делеции, инверсии, инсерции), а также определения транспозонов и коротких мобильных элементов (IS-элементов). Клинический образец обрабатывают для обеспечения доступа к ДНК и деконтаминации. Специфический фрагмент гена rроВ накапливают с помощью ПЦР, затем получают при помощи асимметричной ПЦР одноцепочечный меченый продукт, используя флуоресцентно меченный праймер. Полученный продукт гибридизуют на микрочип, содержащий дискриминирующие олигонуклеотиды, комплементарные последовательностям гена, как имеющим мутации, так и не имеющим таковых(дикий тип). Анализируемый фрагмент ДНК образует совершенные гибридизационные дуплексы с соответствующими олигонуклеотидами. Со всеми остальными олигонуклеотидами анализируемый фрагмент ДНК будет образовывать несовершенные дуплексы. Дискриминацию совершенных и несовершенных дуплексов проводят, сравнивая интенсивности флуоресценции соответствующих ячеек микрочипа. Интенсивность сигнала в случае образования совершенного дуплекса выше, чем в случае несовершенного. Используя схему расположения олигонуклеотидов на микрочипе, определяют мутации, присутствующие в изучаемой последовательности ДНК, и делают заключение об устойчивости (или чувствительности) изучаемого объекта к рифампицину. Олигонуклеотидный микрочип для выяления рифампицин-устойчивых штаммов микобактерий туберкулеза. Олигонуклеотиды для иммобилизации на микрочипе были синтезированы на автоматическом синтезаторе 394 DNA/RNA Synthesizer (Applied Biosystems, USA) с использованием стандартной фосфоамидитной процедуры. 3'-конец олигонуклеотидов содержал спейсер со свободной аминогруппой, который вводился в состав олигонуклеотида при синтезе путем использования 3'-Amino-Modifier С 7 CPG 500(Glen Research, USA). Микрочип был изготовлен как описано в п.Методика изготовления микроматрицы для иммобилизации олигонуклеотидов с целью получения микрочипа. Структура микрочипа для выяления рифампицин-устойчивых штаммов микобактерий туберкулеза. Микрочип содержал 31 иммобилизованный олигонуклеотид, список которых представлен в табл. 3 и 4. Схема расположения олигонуклеотидов на микрочипе приведена на фиг. 5. Верхний ряд микрочипа включает олигонуклеотиды, комплементарные последовательности ДНК дикого типа, присутствующей в рифампицин-чувствительных микобактериях туберкулеза. Под каждой ячейкой с иммобилизованным олигонуклеотидом, комплементарным ДНК дикого типа, расположены ячейки с иммобилизованными олигонуклеотидами, комплементарными последовательностям ДНК мутантных типов (из рифампицинустойчивых микобактерий туберкулеза). Каждый столбец ячеек содержит СНО, позволяющий анализировать известные точечные замены или нуклеотидные перестройки в аминокислоте, номер которой приведен над верхним рядом ячеек на фиг. 6. Микрочип способен регистрировать 22 аминокислотные замены, затрагивающие 7 аминокислотных остатков (см. фиг. 6), или соответствующие им 22 нуклеотидные замены (см. фиг. 7); и одну делецию, захватывающую 2 аминокислоты, что соответствует 6 нуклеотидам.- 16006512 Табл. 3. Расположение олигонуклеотидов относительно последовательности гена rpoB M. tuberculosis- 17006512 Обработка клинического образца. 1. Клинический образец (мокрота, экссудат, смыв, бронхо-альвеолярный лаваж) смешивали в соотношении 1:1 по объему со свежеприготовленным 0,5% раствором N-ацетил-L-цистеина (NALC) в 2%NaOH. Образец тщательно перемешивали на вортексе и выдерживали при комнатной температуре в течение 40 мин. К образцу добавляли фосфатный буфер рН 6,8 в соотношении 1:5 по объему и центрифугировали в течение 30 мин при 3000 об/мин. При использовании спинномозговой жидкости ее центрифугировали в центрифуге Эппендорф течение 10 мин при 10000 об/мин. При анализе крови выделяли лимфоцитарную фракцию по общепринятой методике с использованием фиколла. Дальнейшая обработка образцов проводилась одинаково. 2. Осадок клеток суспендировали в 1,5 мл ТЕ буфера, рН 8,0, и осаждали при 3000 об/мин в течение 30 мин. Отмывку повторяли еще раз. 3. К полученному осадку добавляли 30-70 мкл ТЕ буфера, рН 8,0, содержавшего 1% (об/об) Тритон Х-100, и выдерживали в сухом термостате при 95 С в течение 15 мин. 4. Образец центрифугировали при 10000 об/мин в течение 10 мин в центрифуге Эппендорф и надосадочную жидкость (3 мкл) использовали для проведения ПЦР. Амплификация фрагмента rроВ гена и получение одноцепочечного меченого продукта методом ПЦР. 5. В 50 мкл ПЦР-смеси вносят 3 мкл образца, полученного в п.4. Состав ПЦР-смеси: 1 х ПЦР-буфер: 50 мМ KСl, 10 мМ Tris-HCl (рН 9.0 при 25 С), 0,1% Triton Х-100 (Promega, USA); 1,5 мМ MgCl2 (Promega, USA); 200 мкМ каждого дезоксинуклеозидтрифосфата (dNTP) (Sigma, USA); 5 пмоль каждого праймера (rро 105 и rро 273); 1,5 ед. термостабильной Taq ДНК полимеразы (Promega, USA). Праймеры: Праймеры rpol05 (5'-cgt gga ggc gat cac acc gca gac gtt g) и rpo273 (5'-gac ctc cag ccc ggc acg ctc acg t),фланкирующие фрагмент гена rроВ размером 193 п.о. (позиции 1224-1416, Асc. No L27989), были синтезированы с использованием стандарной фосфоамидитной процедуры и очищены методом обращеннофазовой ВЭЖХ. 6. Амплификацию проводили на программируемом термостате MiniCycler (MJ Research, USA) со следующим режимом: 95 С - 30 с, 68 С - 40 с, 72 С - 20 с; 33 цикла (в первом цикле время денатурации увеличивали до 5 мин, в последнем - время элонгации до 5 мин). 7. 1 мкл (100 нг) амплифицированного препарата двуцепочечной ДНК переносили в 100 мкл ПЦРсмеси для получения одноцепочечного меченого фрагмента гена rроВ. Состав ПЦР-смеси: 1 х ПЦР-буфер: 50 мМ KСl, 10 мМ Tris-HCl (pH 9.0 при 25 С), 0.1% Triton Х-100 (Promega, USA); 1,5 мМ MgCl2 (Promega, USA); 200 мкМ каждого dNTP (Sigma, USA); 10 пмоль праймера 1272f; 1 пмоль праймера 1378r; 1,5 ед. термостабильной Taq ДНК полимеразы (Promega, USA). Праймеры. Праймеры 1272f (5'- cgc cgc gat caa gga gtt ct) и 1378r (5'- tca cgt gac aga ccg ccg gg), фланкирующие фрагмент гена rроВ размером 127 п.о. (позиции 1272 -1398 Асc. No L27989), были синтезированы с использованием стандартной фосфоамидитной процедуры и очищены методом обращенно-фазовой ВЭЖХ. Праймер 1272f содержал на 5'-конце 5'-Amino-Modifier C6 (Glen Research, USA), к аминогруппе которого был ковалентно присоединен Texas Red-sulfonyl chloride (Molecular Probes Inc., USA) пo протоколу, рекомендуемому фирмой-изготовителем. 8. Амплификацию проводили, как описано п.6, с некоторыми модификациями: вместо 30 циклов проводили 36; отжиг проводили при температуре 65 С вместо 68 С. 12 мкл полученного продукта (смесь преимущественно одноцепочечной ДНК с двухцепочечной и праймерами) использовали для гибридизации на микрочипе. Гибридизация амплифицированного меченого продукта на микрочипе 9. 12 мкл образца, полученного в асимметричной ПЦР (1,2 мкг оцДНК), используют для гибридизации на микрочипе в буфере следующего состава: 1 М гуанидин тиоцианат, 50mM HEPES, рН 7,5. 5mМEDTA. Гибридизацию выполняют в коммерчески производимой гибридизационной камере объемом 30 мкл (Sigma, USA) в течение ночи (16-18 ч) при 37 С. Отмывку проводят трижды в буфере: 6,7x SSPE; 10% Tween 20 при 37 С. Микрочип высушивают струей воздуха при комнатной температуре. Регистрация и интерпретация результатов гибридизации. Регистрацию гибридизационной картины проводят на автоматическом комплексе, состоящем из флуоресцентного микроскопа, 512x512 ПЗС-камеры (3x3 мм 2 поле зрения) и компьютера. Для сканирования и последующей обработки изображений применяют программу WinView (Princetone Instruments,- 18006512USA), обработку интенсивности флуоресцентного сигнала проводят при помощи программ, использующих интерфейс Lab VIEW (National Instruments, USA). Интерпретацию результатов проводят следующим образом. Внутри каждого столбца гелевых ячеек визуально или с использованием программного обеспечения сравнивают интенсивности флуоресцентных сигналов. Если интенсивность сигнала верхней ячейки больше, чем в ячейках, расположенных ниже ее,то по данному столбцу, каждый из которых соответствует определенному аминокислотному остатку,анализируемый образец относят к дикому типу, т.е. не имеющему мутации. Если в каком-либо столбце одна из расположенных ниже ячеек имеет большую интенсивность, чем самая верхняя ячейка, то анализируемый образец нуклеиновой кислоты имеет точечную мутацию. Тип и локализацию мутации устанавливают путем сравнения со схемой расположения олигонуклеотидов на микрочипе. В случае, если по каждому столбцу, т.е. аминокислотному остатку, изучаемый образец определен как не имеющий мутаций, его относят к дикому типу, и выдается заключение, что в изученном клиническом образце микобактерий туберкулеза, не чувствительных к рифампицину, не определено. В том случае, если хотя бы по одному столбцу анализируемый образец определен как имеющий точечную мутацию, его относят к мутантному типу, и выдается заключение, что в анализируемом клиническом образце определены микобактерии туберкулеза, устойчивые к рифампицину. На фиг. 8-10 представлены результаты анализа последовательности ДНК трех различных штаммов микобактерий методом гибридизации на микрочипе. На фиг. 8 представлена картина гибридизации образца ДНК, выделенного из чувствительного к рифампицину штамма микобактерий туберкулеза. Внутри каждого столбца верхняя ячейка имеет большую интенсивность флуоресцентного сигнала,чем расположенные ниже ячейки. Следовательно, ДНК изучаемого объекта образует совершенные гибридизационные дуплексы с олигонуклеотидами, комплементарными последовательности ДНК дикого типа. Из этого следует, что в изученном клиническом образце микобактерий, устойчивых к рифампицину, не определено. На фиг. 9 представлена картина гибридизации образца ДНК, выделенного из резистентного к рифампицину штамма микобактерий туберкулеза. Внутри каждого столбца верхняя ячейка имеет большую интенсивность флуоресцентного сигнала,чем расположенные ниже ячейки. Исключение составляет образование совершенного дуплекса в ячейке,обозначенной стрелкой. Интенсивность сигнала в данной ячейке превосходит интенсивность, регистрируемую в верхней ячейке данного столбца. Следовательно, ДНК изучаемого объекта имеет точечную нуклеотидную замену АТ в позиции 1322, что приводит к замене аминокислоты Asp на Val в позиции 516 и ведет к возникновению резистентности изучаемого штамма к рифампицину. Выдается заключение,что в изученном клиническом образце определены микобактерии туберкулеза, резистентные к рифампицину. Резистентность обусловлена заменой аминокислоты Asp на Val в позиции 516. На фиг. 10 представлена картина гибридизации образца ДНК, выделенного из резистентного к рифампицину штамма микобактерий туберкулеза. Внутри каждого столбца верхняя ячейка имеет большую интенсивность флуоресцентного сигнала,чем расположенные ниже ячейки. Исключение составляет образование совершенного дуплекса в ячейке,обозначенной стрелкой. Интенсивность сигнала в данной ячейке превосходит интенсивность, регистрируемую в верхней ячейке данного столбца. Следовательно, ДНК изучаемого объекта содержит две точечные нуклеотидные замены СТ в позиции 1351 и AG в позиции 1352, что приводит к замене аминокислоты His на Cys в позиции 526 и ведет к возникновению резистентности изучаемого штамма к рифампицину. Выдается заключение, что в изученном клиническом образце определены микобактерии туберкулеза, резистентные к рифампицину. Резистентность обусловлена заменой аминокислоты His на Cys в позиции 526. Представленный способ позволяет в короткие сроки идентифицировать устойчивые к рифампицину формы микобактерий туберкулеза, в том числе используя для анализа непосредственно клинический образец. Метод выгодно отличается от существующих в настоящее время аналогов простотой выполнения и низкой себестоимостью. Применение микрочипа, содержащего набор дискриминирующих олигонуклеотидов, позволяет также выполнять типирование микобактерий туберкулеза на генотипическом уровне. Пример 3. Определение генов токсинообразования и резистентности к ампициллину методами мультиплексной ПЦР и аллель-специфичной ПЦР на микрочипе Метод относится к способу одновременного определения нескольких генов, детерминирующих синтез диагностически важных белков, и детекции точечных мутаций в ДНК микроорганизмов. В данном примере рассматривается применение методов ПЦР на микрочипе для одновременной детекции следующих продуктов: гена pag4 - ответственного за синтез протективного антигена В. anthracis; гена stx - ответственного за синтез шигеллезного токсина у рода Shigella; гена slt - ответственного за синтез шига-подобного токсина у рода Escherichia; гена blа - ответственного за синтез бета-лактамазы у пенициллин-устойчивых микроорганизмов. Олигонуклеотидный микрочип для определения генов токсинообразования и резистентности к ампициллину методами мультиплексной ПЦР и аллель-специфичной ПЦР.- 19006512 Олигонуклеотиды для иммобилизации на микрочипе были синтезированы на автоматическом синтезаторе 394 DNA/RNA Synthesizer (Applied Biosystems, USA) с использованием стандартной фосфоамидитной процедуры. 5'-Конец олигонуклеотидов содержал 5'-Amino-Modifier C6 (Glen Research, USA),свободная аминогруппа которого позволяла иммобилизовать праймеры в ячейках полиакриламидного геля. Микрочип был изготовлен как описано в п.Методика изготовления микроматрицы для иммобилизации олигонуклеотидов с целью получения микрочипа. Структура микрочипа для определения генов токсинообразования и резистентности к ампициллину методами мультиплексной ПЦР и аллель-специфичной ПЦР. Микрочип содержал 5 иммобилизованных праймеров, список которых представлен в табл. 5 (отмечены буквой I). Расположение праймеров на микрочипе представлено на фиг. 11. Таблица 5. Список олигонуклеотидов, используемых для детекции генов pag4, bla, sht и slt, на микрочипе. (Используемые обозначения: F- прямой праймер; R - обратный праймер; Р - зонд; I - иммобилизованный).- положение праймера относительно последовательности гена;Таn - рассчитанная температура отжига. Олигонуклеотиды pag4-FI и pag4-R являлись специфическими праймерами для амплификации фрагмента гена, детерминирующего синтез протективного антигена В. anthracis. pag4-P - олигонуклеотидный зонд, несущий флуоресцентную метку Texas Red на 3'-конце, был комплементарен внутреннему участку раg4-ампликона. Олигонуклеотиды bla-FI и bla-R являлись специфическими праймерами для амплификации фрагмента гена, детерминирующего синтез бета-лактамазы. Олигонуклеотиды sht-FI и sht-R являлись специфическими праймерами для амплификации фрагмента гена, детерминирующего синтез шигеллезного (sht) и шига-подобного (slt) токсинов. Праймерыsht-F(T)I и slt-F(G)I являлись специфическими прямыми праймерами для амплификации фрагмента геновsht и slt, соответственно, и различались 3'-концевым основанием, которое является дискриминирующим для генов двух токсинов, различающихся точечной нуклеотидной заменой. Подготовка образца для проведения ПЦР на микрочипе. Образцы обрабатывали стандартными экспресс-методами, обеспечивающими доступ к бактериальной ДНК. Проведение ПЦР для определения генов токсинообразования и резистентности к ампициллину на микрочипе. Подготовленный образец ДНК вносили в камеру для проведения ПЦР, содержавшую реакционную смесь конечным объемом 28 мкл. Состав ПЦР-смеси: 1 х реакционный буфер для фрагмента Стоффеля Taq ДНК полимеразы (Perkin Elmer, USA) 2,5 мМ MgCl2 (Promega, USA); 200 мкМ каждого dNTP (Sigma, USA); 5 пмоль каждого праймера; 1 мг/мл бычьего сывороточного альбумина (V фракция, Sigma, USA); 50 мкг/мл ДНК спермы лосося (Sigma, USA); 2,5 ед. фрагмента Стоффеля Taq ДНК полимеразы (Perkin Elmer, USA). Амплификацию проводили на микрочипе, помещенном на не отражающую световые лучи алюминиевую подложку, оснащенную элементами Пелтье, управляемыми термоконтроллером и компьютером. Объем камеры по периметру ограничивал полиэтиленовый спейсер толщиной 70 мкм, имеющий форму прямоугольной рамки с шириной стенок 1 мм. Сверху объем ограничивался прямоугольной формы кварцевым стеклом, имеющим два отверстия диаметром 1 мм для подвода и отвода растворов. Герметичность камеры во время реакции обеспечивали стяжкой, прижимающей кварцевое стекло через спейсер к микрочипу. Отверстия после добавления в камеру всех необходимых реакционных компонентов также гер- 20006512 метично закрывались с помощью силиконовых прокладок. Данное устройство помещали на предметный столик флуоресцентного микроскопа, что позволяло следить за изменениями уровня флуоресценции в каждой ячейке в процессе реакции. Перед амплификацией устройство прогревалось в течение 10 мин при 95 С. Амплификацию проводили в следующем режиме: предварительная денатурация при 95 С в течение 120 с; денатурация при 95 С - 30 с; отжиг при 53 С - 60 с; достройка цепи при 72 С - 40 с. Проведение ПЦР на микрочипе можно осуществлять в нескольких различных вариантах (см. фиг. 12). Простейший вариант, в котором прямой праймер был иммобилизован, а обратный флуоресцентно меченный находился в растворе над микрочипом, представлен на схеме В. Второй вариант предусматривал предварительное накопление ампликона на стадиях А и Б (прямой праймер находился в растворе), после которых выполняли стадию В или Г. Стадия Г отличается тем, что иммобилизованный прямой праймер не идентичен прямому праймеру, помещенному в реакционную смесь, а комплементарен внутреннему региону ампликона. Введение стадии А или Б уменьшало время проведения эксперимента (на 5-10 циклов амплификации) за счет более интенсивной наработки ампликона в растворе над микрочипом в сравнении с амплификацией, протекающей в ячейках микрочипа. Аллель-специфичная ПЦР проводилась по аналогичной схеме (рис. 12 В), но для иммобилизации использовали такие дискриминирующие праймеры (sht-F(T)I и slt-F(G)I), которые различались только по 3'-концевому основанию и позволяли выявлять известные точечные замены в комплементарной данному основанию позиции анализируемого гена, как, например, в случае генов шигеллезного и шига-подобного токсинов, отличающихся наличием основания Т или G в позиции 1648, соответственно. Регистрация и интерпретация результатов определения генов токсинообразования и резистентности к ампициллину методами ПЦР и аллель-специфичной ПЦР на микрочипе О том, идет ли в той или иной ячейке ПЦР или нет, судили по накоплению в ней флуоресцентного сигнала, обусловленного формированием гибридизационного дуплекса между достроенным иммобилизованным праймером и вновь образовавшимся в результате амплификации продуктом с включенным в его состав меченым праймером (см. фиг. 12 Ж и З). Увеличение флуоресцентного сигнала в соответствующих ячейках микрочипа в процессе специфической амплификации фрагмента гена pag4 представлено на фиг. 13 А. Контролем служила ячейка, содержавшая праймер, специфичный для гена sht. На фиг. 13 Б показано накопление флуоресцентного сигнала в процессе специфической амплификации фрагмента гена sht (контрольной служила ячейка, содержавшая праймер, специфичный в отношении гена pag4). На фиг. 14 А представлена картина, полученная при амплификации образца, содержащего гены pag4 и bla. Положительная амплификация зафиксирована в ячейках, отмеченных стрелками. На фиг. 14 Б представлена картина, полученная при регистрации амплификации образца, содержащего фрагменты генов sht и blа. Положительная амплификациязафиксирована в ячейках, отмеченных стрелками. Контроль специфичности амплификации. В соответствии со схемой (см. фиг. 12 Д и Е) после проведения амплификации микрочип отмывали от прогибридизовавшихся меченых продуктов в 0,1 М NaCl при 95 С в течение 10 мин. На отмытый таким образом микрочип наносили реакционный буфер для проведения ПЦР, содержавший флуоресцентно меченный обратный праймер (фиг. 12 Д) или меченый зонд, комплементарный внутреннему участку ампликона (фиг. 12 Е). Например, для контроля специфичности при амплификации гена pag4 использовали флуоресцентно меченный зонд pag4-P (см. табл. 5). В случае успешного прохождения ПЦР на микрочипе добавленные меченые олигонуклеотиды образовывали гибридизационные дуплексы с достроенным в ходе реакции иммобилизованным праймером, что сопровождалось появлением флуоресцентного сигнала. Методом контроля специфичности также являлся электрофорез продуктов, содержащихся в реакционной смеси после завершения ПЦР, размер которых должен соответствовать ожидаемому. Пример 4. Метод определения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, методом аллель-специфичной ПЦР на микрочипе. Метод относится к способу детекции точечных мутаций в хромосомной ДНК микроорганизмов методом амплификации на микрочипе. Принцип метода состоит в следующем. Известно, что в подавляющем большинстве случаев (более 95%) устойчивость микобактерий туберкулеза к рифампицину обусловлена точечными мутациями или короткими, не более 6 п.о., инсерциями или делециями, сохраняющими нормальную рамку считывания, которые располагаются в коровом участке гена rро В длиной 81 п.о. Для этого участка были выбраны следующие праймеры: rpoB-F и rpoB-R являются общими внешними прямым и обратным праймерами, соответственно, для амплификации в растворе над микрочипом. Для каждой аминокислотной позиции, для которой описаны вызывающие устойчивость микобактерий к рифампицину мутации, подбирается набор специфических дискриминирующих праймеров, различаю- 21006512 щихся только находящимися в 3'-положении основаниями и позволяющих выявлять все известные точечные замены в комплементарной данному основанию позиции гена rроВ. Наборы дискриминирующих праймеров по всем выбранным вариабельным позициям иммобилизуются в ячейках микрочипа. Таким образом, метод сочетает в себе признаки "nested-ПЦР и аллель-специфической ПЦР. Олигонуклеотидный микрочип для определения точечных мутаций в гене rроВ М. tuberculosis методом аллель-специфичной ПЦР. Олигонуклеотиды для иммобилизации на микрочипе были синтезированы на автоматическом синтезаторе 394 DNA/RNA Synthesizer (Applied Biosystems, USA) с использованием стандартной фосфоамидитной процедуры. 5'-Конец олигонуклеотидов содержал 5'-Amino-Modifier C6 (Glen Research, USA),свободная аминогруппа которого позволяла иммобилизовать праймеры в ячейках микрочипа. Микрочип был изготовлен как описано в п.Методика изготовления микроматрицы для иммобилизации олигонуклеотидов с целью получения микрочипа. Структура микрочипа для определения точечных мутаций в гене rpoB M. tuberculosis методом аллель-специфичной ПЦР на микрочипе. Микрочип содержал 23 иммобилизованных праймера (обозначены буквой I), список которых приведен в табл. 6. Размещение олигонуклеотидов в ячейках микрочипа, как видно из фиг. 15, определяется номером столбца и буквенным обозначением ряда, что отражено в названии праймера в виде аббревиатуры типа 1 А, 2 В и т.д. (см. табл. 6). Буквы F и R использованы для обозначения прямых и общего обратного праймеров, соответственно. Общий обратный праймер rpoB-R содержал на своем 5'-конце флуоресцентную метку Texas Red. Ячейки верхнего ряда микрочипа содержат праймеры, специфичные к ДНК дикого типа, представленной в чувствительных к рифампицину микобактериях туберкулеза. В данном примере под специфичным следует понимать праймер, имеющий на своем 3'-конце основание, соответствующее последовательности ДНК дикого типа. Под каждой ячейкой с иммобилизованным праймером, специфичным к ДНК дикого типа, расположены ячейки с иммобилизованными праймерами, специфичными к ДНК мутантных типов (из рифампицин-устойчивых микобактерий туберкулеза). Каждый столбец ячеек представляет собой специфический набор праймеров, позволяющий детектировать все известные нуклеотидные замены внутри триплета, кодирующего конкретный аминокислотный остаток. Подготовка образцов для проведения анализа. Подготовку клинических образцов для анализа методом ПЦР на микрочипе проводили как описано в примере 2 в разделе Обработка клинического образца. Определение точечных мутаций в гене rроВ М. tuberculosis методом аллель-специфичной ПЦР на микрочипе. Амплификацию проводили по способу, аналогичному используемому для выявления генов, детерминирующих синтез шигиллезного и шигаподобного токсинов (см. пример 3. Определение генов токсинообразования и резистентности к ампициллину методами мультиплексной ПЦР и аллельспецифичной ПЦР на микрочипе и фиг. 12 Г). Таблица 6. Список олигонуклеотидов, используемых для детекции точечных мутаций в гене rpoBM. tuberculosis, ответственных за возникновение устойчивости к рифампицину, методом аллельспецифичной ПЦР на микрочипе. (Используемые обозначения: F- прямой праймер; R - обратный праймер; I- иммобилизованный)- 22006512- положение праймера относительно последовательности гена: первая цифра - положение с 5'конца значимой цепи; вторая цифра - позиция мутации; первая буква - основание, находящееся в 3'- концевом положении, соответствующее дикому типу; буква после стрелки - 3'-основание, соответствующее мутантному типу; W- дикий тип;Таn - рассчитанная температура плавления. Для амплификации применяли камеру, описанную в примере 3 в разделе Проведение ПЦР для определения генов токсинообразования и резистентности к ампициллину на микрочипе. Предварительную амплификацию в растворе над микрочипом проводили согласно фиг. 12 А и Б. Использовали следующий режим амплификации: предварительная денатурация при 95 С - 120 с; денатурация при 95 С - 30 с; отжиг при 65 С - 60 с; достройка цепи при 72 С - 40 с. Регистрация и интерпретация результатов определения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, методом аллельспецифичной ПЦР на микрочипе. Наличие амплификации регистрировали по накоплению флуоресцентного сигнала в ячейках микрочипа, обусловленному формированием гибридизационных дуплексов между достроенным иммобилизованным праймером и вновь образовавшимся в ходе ПЦР продуктом с включенным в его состав флуоресцентно меченным праймером (см. фиг. 12 З). Интерпретацию результатов проводили по схеме, аналогичной описанной в примере 2 в разделе Регистрация и интерпретация результатов гибридизации. На фиг. 15-I представлена картина, полученная при амплификации образца ДНК М. tuberculosis,чувствительного к рифампицину (ДНК дикого типа). Как и в случае гибридизации (см. пример 2), верхняя ячейка в каждом столбце, соответствующая последовательности ДНК дикого типа, имеет наибольшую интенсивность флуоресценции. При амплификации образца ДНК, полученного из штамма, устойчивого к рифампицину, интенсивность флуоресценции одной из нижерасположенных ячеек внутри одного столбца начинает превышать таковую в верхней ячейке. На фиг. 15-II представлена амплификационная картина, полученная при проведении ПЦР на микрочипе с ДНК штамма, имеющего аминокислотную замену в 531 позиции SerLeu (ct). Две ячейки (В 6 и В 7), соответствующие последовательности мутантного типа, обладают большей интенсивностью флуоресценции в сравнении с расположенными выше ячейками (А 6 и А 7), соответствующими последовательности дикого типа. Пример 5. Метод определения точечных нуклеотидных замен в гене brca1, ответственном за предрасположенность к раку молочной железы, методом аллель-специфичной ПЦР на микрочипе. Метод относится к способу детекции точечных мутаций в хромосомной ДНК эукариот методом аллель-специфичной ПЦР на микрочипе. Ген brca1, локализованный в участке хромосомы 17q11 человека, обычно функционирует как один из супрессоров, регулирующих рост и дифференцировку эпителиальных клеток. Люди с наследственными мутациями в этом гене имеют повышенный риск развития рака молочной железы. Мутация действует по рецессивному типу. Определение же гетерозиготного типа также является актуальным для прогнозирования заболевания у потомства. Олигонуклеотидный микрочип для определения точечных нуклеотидных замен в гене brca1 методом аллель-специфичной ПЦР. Олигонуклеотиды для иммобилизации на микрочипе были синтезированы на автоматическом синтезаторе 394 DNA/RNA Synthesizer (Applied Biosystems, USA) с использованием стандартной фосфоамидитной процедуры. 5'-Конец олигонуклеотидов содержал 5'-Amino-Modifier C6 (Glen Research, USA),свободная аминогруппа которого позволяла иммобилизовать праймеры в ячейках микрочипа. Микрочип был изготовлен как описано в п.Методика изготовления микроматрицы для иммобилизации олигонуклеотидов с целью получения микрочипа. Структура микрочипа для определения точечных нуклеотидных замен в гене brca1 методом аллельспецифичной ПЦР. Дискриминирующий микрочип содержал 4 иммобилизованных праймера, представленных в табл. 7(обозначены буквой I). Иммобилизованные праймеры различались только своим 3'-концевым основанием, соответствующим всем возможным точечным заменам в позиции 2713 гена brca1 (GenBank AccessionNo-AF005068). Расположение праймеров на микрочипе представлено на фиг. 16-I.- 23006512 Таблица. 7. Список олигонуклеотидов для обнаружения точечных нуклеотидных замен в гене brca1,ответственном за предрасположенность к раку молочной железы, методом аллель-специфичной ПЦР на микрочипе. Положение показано относительно последовательности, депонированной в GenBank (Accession NoAF005068). Подготовка образца. Подготовку образца для амплификации на микрочипе осуществляли стандартной процедурой выделения ДНК. Определение точечных нуклеотидных замен мутаций в гене brca1 методом аллель-специфичной ПЦР на микрочипе. Амплификацию проводили по способу, аналогичному используемому при дискриминации генов,детерминирующих синтез шигеллезного и шига-подобного токсинов (см. пример 3 Определение генов токсинообразования и резистентности к ампициллину методами мультиплексной ПЦР и аллельспецифичной ПЦР на микрочипе и фиг. 12 Г). Для амплификации применяли камеру, описанную в примере 3 в разделе Проведение ПЦР для определения генов токсинообразования и резистентности к ампициллину на микрочипе. Предварительную амплификацию в растворе над микрочипом проводили согласно фиг. 12 А и Б с праймерами brca-F и brca-R. Общий обратный праймер brca-R имел на 5'-конце флуоресцентную меткуTexas Red. Использовали следующий режим амплификации: предварительная денатурация при 95 С - 120 с; денатурация при 95 С - 30 с; отжиг при 53 С - 60 с; достройка цепи при 72 С - 40 с. Регистрация и интерпретация результатов определения точечных нуклеотидных замен в гене brca1 методом аллель-специфичной ПЦР на микрочипе. Наличие амплификации регистрировали по накоплению флуоресцентного сигнала в ячейках микрочипа, обусловленному формированием гибридизационных дуплексов между достроенным иммобилизованным праймером и вновь образовавшимся в ходе ПЦР продуктом с включенным в его состав меченым праймером (см. фиг. 12 З). Интерпретацию результатов проводили по схеме, аналогичной описанной в примере 2 в разделе Регистрация и интерпретация результатов гибридизации. На фиг. 16-II представлены картины, полученные при амплификации трех образцов ДНК. На фиг. 16-II А показана амплификация фрагмента ДНК здорового пациента. В позиции 2713 находится цитозин,что было зарегистрировано на ячейке с иммобилизованным праймером brca-CI. В случае, если обе копии хромосомы 17 несут мутантный аллель гена brca1, содержащий точечную замену CТ, наибольшую интенсивность флуоресцентного сигнала наблюдали в ячейке с иммобилизованным праймером brca-TI(фиг. 16-II Б). Такого пациента относят к группе, предрасположенной к развитию рака молочной железы,т.е. имеющего рецессивную мутацию в гомозиготном состоянии. На фиг. 16-II В представлена картина,полученная при амплификации ДНК, содержащей тимин в гетерозиготном состоянии. В этом случае пациента относят к группе, способной при репродукции передать мутантный аллель потомству. ФОРМУЛА ИЗОБРЕТЕНИЯ 1. Способ анализа последовательностей нуклеиновых кислот (НК) с использованием биологического микрочипа, включающий получение очищенных препаратов олигонуклеотидов, иммобилизацию этих олигонуклеотидов в трехмерных гидрофильных микроячейках, подготовку анализируемого образца НК,анализ образца НК путем его гибридизации с иммобилизованными на микрочипе олигонуклеотидами,регистрацию результатов анализа и интерпретацию результатов анализа, характеризующийся тем, что в указанном способе используют биологический микрочип, состоящий из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр и содержащих набор иммобилизованных олигонуклеотидов. 2. Способ по п.1, в котором получают очищенные препараты дискриминирующих специфических олигонуклеотидов, выбранных на основе предварительного расчета их первичной и вторичной структур,- 24006512 и которые необходимы и достаточны для идентификации известных мутаций, полиморфных или аллельных вариантов анализируемых последовательностей НК, а также для изготовления контрольных ячеек, и которые удовлетворяют следующим условиям: а) длина специфических дискриминирующих олигонуклеотидов, обеспечивающая их специфичность в отношении анализируемой последовательности НК, определяется размером и сложностью анализируемой последовательности и, в частности, наличием в ней повторов и протяженных гомополимерных последовательностей; б) специфические дискриминирующие олигонуклеотиды способны выявлять известные замены, делеции и инсерции для каждой позиции анализируемой НК, для которой известны такие мутации, полиморфизм или аллельные варианты; в) разброс значений температуры плавления (Тпл) специфических дискриминирующих олигонуклеотидов находится в диапазоне 4-5 С и подбирается путем варьирования длины олигонуклеотидов; д) специфические дискриминирующие олигонуклеотиды не обладают способностью формировать вторичные структуры типа шпильки с высокими температурами плавления; е) позиция детектируемых вариабельных нуклеотидов и других нуклеотидных перестроек в анализируемой НК находится по возможности не далее 1-4 нуклеотидов от середины соответствующего дискриминирующего олигонуклеотида. 3. Способ по п.1, в котором получают полный набор очищенных препаратов всех возможных олигонуклеотидов заданной длины. 4. Способ по любому из пп.1-3, в котором анализируемый образец НК - ДНК или РНК выбирают из группы, включающей а) очищенные препараты НК; б) НК, выделенные из чистых и накопительных культур микроорганизмов и вирусов; в) НК, выделенные из клинического материала, полученного от пациента; г) НК, выделенные из других образцов естественного происхождения, в том числе воды, почвы,смывов, проб воздуха. 5. Способ по любому из пп.1-4, в котором гибридизацию на биологическом микрочипе проводят в гибридизационном растворе, содержащем буферный компонент, соль для создания ионной силы, в герметичной гибридизационной камере при температуре, определяемой температурой плавления иммобилизованных на биологическом микрочипе олигонуклеотидов. 6. Способ по п.5, в котором гибридизационный раствор дополнительно содержит агент, дестабилизирующий водородные связи. 7. Способ по п.4, в котором образцы НК представляют собой РНК. 8. Способ по п.7, в котором подготовка анализируемого образца включает выделение РНК, фрагментацию выделенной РНК и ковалентное мечение этой РНК флуоресцентной меткой. 9. Способ по п.7, в котором подготовка анализируемого образца включает выделение РНК, синтез кДНК на матрице выделенной РНК, амплификацию кДНК с помощью ПЦР, фрагментацию амплифицированной ДНК и мечение этой ДНК флуоресцентной меткой. 10. Способ по п.7, в котором подготовка анализируемого образца включает выделение РНК, синтез кДНК на матрице выделенной РНК и амплификацию кДНК с одновременным мечением амплифицированной ДНК с использованием одного или двух флуоресцентно меченных праймеров с помощью ПЦР. 11. Способ по п.7, в котором подготовка анализируемого образца включает выделение РНК, синтез кДНК на матрице выделенной РНК и амплификацию кДНК с одновременным мечением амплифицированной ДНК с получением одноцепочечного флуоресцентно меченного продукта с помощью двухстадийной ПЦР, включающей стандартную ПЦР на первой стадии и асимметричную ПЦР с использованием флуоресцентно меченного праймера на второй стадии. 12. Способ по п.4, в котором образцы НК представляют собой ДНК. 13. Способ по п.12, в котором подготовка анализируемого образца включает выделение ДНК, ее фрагментацию и мечение этой ДНК флуоресцентной меткой. 14. Способ по п.4, в котором образцы НК представляют собой ДНК. 15. Способ по п.14, в котором подготовка анализируемого образца ДНК включает выделение, амплификацию выделенной ДНК с помощью ПЦР, фрагментацию этой амплифицированной ДНК и мечение этой ДНК флуоресцентной меткой. 16. Способ по п.14, в котором подготовка образца ДНК включает выделение и амплификацию выделенной ДНК с одновременным мечением амплифицированной ДНК с использованием одного или двух флуоресцентно меченных праймеров при помощи ПЦР. 17. Способ по п.14, в котором подготовка анализируемого образца ДНК включает выделение и амплификацию выделенной ДНК с одновременным мечением амплифицированной ДНК с получением одноцепочечного флуоресцентно меченного продукта с помощью двухстадийной ПЦР, включающей стандартную ПЦР на первой стадии и асимметричную ПЦР с использованием флуоресцентно меченного праймера на второй стадии. 18. Способ по п.6, в котором дестабилизирующий водородные связи агент выбирают из группы,- 25006512 включающей гуанидин тиоцианат, мочевину или формамид. 19. Способ по любому из пп.1-18, в котором регистрация результатов гибридизации включает использование регистрирующих устройств на базе широкопольной оптики, оснащенных источником света для возбуждения флуоресценции или лазерных сканаторов различного типа. 20. Способ по п.19, в котором гибридизационную картину, полученную при помощи регистрирующего устройства на базе широкопольной оптики, регистрируют на фотопленку или цифровым детектором изображения, например ПЗС-камерой. 21. Способ по п.19, в котором регистрацию результатов гибридизации осуществляют путем сплошного сканирования микрочипа при помощи лазерного сканатора с последующим анализом полученного изображения или путем избирательного сканирования при помощи лазерного сканатора тех участков микрочипа, на которых расположены ячейки. 22. Способ по любому из пп.1 или 2, в котором интерпретацию результатов гибридизации осуществляют путем сравнения интенсивностей сигнала в ячейках микрочипа, выявляющих образование совершенных и несовершенных гибридизационных дуплексов. 23. Способ по п.3, в котором интерпретацию результатов гибридизации осуществляют путем сравнения интенсивностей сигнала в ячейках микрочипа, выявляющих образование совершенных и несовершенных гибридизационных дуплексов. 24. Способ по п.22, в котором интерпретацию результатов гибридизации с целью выявления специфических последовательностей в анализируемом образце НК осуществляют путем сравнения интенсивностей сигнала в ячейках, содержащих специфичные дискриминирующие олигонуклеотиды, и в контрольных ячейках, содержащих неспецифичные олигонуклеотиды. 25. Способ по п.22, в котором интерпретацию результатов гибридизации с целью выявления мутаций, полиморфизма или аллелизма генов осуществляют путем сравнения интенсивностей сигнала в ячейках, содержащих дискриминирующие олигонуклеотиды, соответствующие последовательностям дикого типа, и в ячейках, содержащих дискриминирующие олигонуклеотиды, соответствующие последовательностям мутантных типов или полиморфных или аллельных вариантов НК. 26. Способ по любому из пп.1-25 для обнаружения последовательностей нуклеиновых кислот, детерминирующих синтез диагностически значимых белков; детекции точечных нуклеотидных мутаций,делеций, инсерций, инверсий и транслокаций, а также транспозонов и мобильных IS-элементов. 27. Способ по любому из пп.1-25 для обнаружения микроорганизмов и вирусов по специфическим последовательностям нуклеиновых кислот. 28. Способ по любому из пп.1-25 для выявления вида возбудителя заболевания; выявления генов,детерминирующих синтез токсинов; определения лекарственной устойчивости возбудителя; выявления гомозиготного и гетерозиготного состояния мутаций; а также для целей эпидемиологического генотипирования. 29. Способ по любому из пп.1-25 для определения уровня экспрессии известных генов в различных органах и тканях, при патологических состояниях, на разных стадиях развития организма, а также при разного рода воздействиях на организм. 30. Способ по любому из пп.1-25 для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов) методом гибридизации с олигонуклеотидным микрочипом. 31. Способ анализа последовательностей нуклеиновых кислот с использованием биологического микрочипа, включающий получение очищенных препаратов специфических олигонуклеотидов, выполняющих роль праймеров при проведении ПЦР, иммобилизацию этих олигонуклеотидов в трехмерных гидрофильных микроячейках, подготовку анализируемого образца НК, анализ образца НК путем проведения ПЦР на микрочипе, регистрацию результатов анализа и интерпретацию результатов анализа, характеризующийся тем, что в указанном способе используют биологический микрочип, состоящий из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр и содержащих набор иммобилизованных специфических олигонуклеотидов. 32. Способ по п.31, в котором получают очищенные препараты специфических дискриминирующих праймеров, выбранных на основе предварительного расчета их первичной и вторичной структур, и которые необходимы и достаточны для идентификации известных мутаций, полиморфных или аллельных вариантов анализируемых последовательностей НК, а также для изготовления контрольных ячеек, и которые удовлетворяют следующим условиям: а) длина специфических дискриминирующих праймеров, обеспечивающая их специфичность в отношении анализируемой последовательности НК, определяется размером и сложностью анализируемой последовательности и, в частности, наличием повторов и протяженных гомополимерных последовательностей; б) специфические дискриминирующие праймеры, различающиеся по своему 3'-концу, способны выявлять известные замены, делеции и инсерции для каждой позиции анализируемой НК, для которой известны такие мутации, полиморфизм или аллельные варианты;- 26006512 в) разброс значений Тпл специфических дискриминирующих праймеров находится в диапазоне 34 С и подбирается путем варьирования длины олигонуклеотидов; г) специфические дискриминирующие праймеры не способны формировать вторичные структуры типа шпильки с высокими температурами плавления. 33. Способ по п.31, в котором анализируемый образец НК - ДНК или РНК выбирают из группы,включающей а) очищенные препараты НК; б) НК, выделенные из чистых и накопительных культур микроорганизмов и вирусов; в) НК, выделенные из клинического материала, полученного от пациента; г) НК, выделенные из других образцов естественного происхождения, в том числе воды, почвы,смывов, проб воздуха. 34. Способ по п.31, в котором анализ образца включает проведение ПЦР на биологическом микрочипе с использованием пары специфических олигонуклеотидов, один из которых является внешним прямым праймером, а второй - внешним обратным праймером, причем прямой праймер иммобилизован в микроячейках биологического микрочипа, а флуоресцентно меченный обратный праймер находится в растворе над микрочипом. 35. Способ по п.33, в котором образец НК представляет собой РНК, а подготовка анализируемого образца включает выделение РНК и синтез на матрице выделенной РНК кДНК с помощью ПЦР. 36. Способ по п.33, в котором образец НК представляет собой ДНК, а подготовка анализируемого образца включает выделение ДНК. 37. Способ по п.34, в котором анализ образца НК включает проведение аллель-специфичной ПЦР на биологическом микрочипе, в ячейках которого иммобилизованы прямые дискриминирующие праймеры, обеспечивающие выявление известных замен, делеций, инсерций и нуклеотидных перестроек анализируемой последовательности. 38. Способ по п.37, в котором в раствор над микрочипом дополнительно добавляют свободный внешний прямой праймер. 39. Способ по п.31, в котором анализируют несколько последовательностей НК. 40. Способ по п.39, в котором применяют мультиплексный вариант ПЦР, включающий амплификацию каждой анализируемой последовательности своей парой специфических внешних праймеров, причем прямые праймеры иммобилизуют в соответствующих ячейках биологического микрочипа, а меченные флуоресцентной меткой обратные праймеры находятся в растворе над микрочипом. 41. Способ по п.40, в котором в раствор над микрочипом дополнительно добавляют свободные внешние прямые праймеры. 42. Способ по п.41, в котором внешний прямой праймер, используемый для преамплификации, одновременно служит и дискриминирующим праймером, иммобилизованным в ячейке биологического микрочипа. 43. Способ по п.41, в котором дискриминирующие внутренние прямые праймеры, иммобилизованные в ячейках микрочипа, позволяющие выявлять известные мутации, инсерции, делеции в конкретной позиции анализируемой последовательности, отличаются от внешнего прямого праймера, используемого для преамплификации. 44. Способ по любому из пп.31-43, в котором регистрацию результатов ПЦР осуществляют в процессе проведения ПЦР на биологическом микрочипе. 45. Способ по любому из пп.31-44, в котором интерпретацию результатов ПЦР осуществляют путем сравнения интенсивностей флуоресценции ячеек, выявляющих образование специфичного продукта ПЦР. 46. Способ по п.45, в котором интерпретацию результатов ПЦР с целью выявления специфических последовательностей в анализируемом образце НК осуществляют путем сравнения интенсивностей флуоресценции ячеек, содержащих специфичные дискриминирующие праймеры, и контрольных ячеек,содержащих неспецифичные праймеры. 47. Способ по п.45, в котором интерпретацию результатов ПЦР с целью выявления мутаций, полиморфных или аллельных вариантов генов осуществляют путем сравнения интенсивностей флуоресценции ячеек, содержащих дискриминирующие праймеры, соответствующие последовательностям дикого типа, и ячеек, содержащих дискриминирующие праймеры, соответствующие последовательностям мутантных типов или полиморфных или аллельных вариантов НК. 48. Способ по любому из пп.31-47 для обнаружения последовательностей нуклеиновых кислот, детерминирующих синтез диагностически важных белков; точечных нуклеотидных мутаций, делеций, инсерций, инверсий и транслокаций, а также транспозонов и мобильных IS-элементов. 49. Способ по любому из пп.31-47 для обнаружения микроорганизмов и вирусов по специфическим последовательностям нуклеиновых кислот. 50. Способ по любому из пп.31-47 для выявления и идентификации вида возбудителя заболевания; выявления генов, детерминирующих синтез токсинов; определения лекарственной устойчивости возбудителя; определения гомозиготного и гетерозиготного состояния мутаций; а также для целей эпидемио- 27006512 логического генотипирования. 51. Способ по любому из пп.31-47 для определения уровня экспрессии известных генов в органах и тканях при различных патологических состояниях, на разных стадиях развития организма, а также при разного рода воздействиях на организм. 52. Способ по п.31 для обнаружения генов токсинообразования и резистентности к ампициллину на микрочипе способами мультиплексной ПЦР и аллель-специфичной ПЦР. 53. Способ по п.31 для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности возбудителя туберкулеза к рифампицину, способом аллельспецифичной ПЦР на микрочипе. 54. Способ по п.31 для обнаружения точечных нуклеотидных замен в гене brca1, ответственном за предрасположенность к раку молочной железы, способом аллель-специфичной ПЦР на микрочипе. 55. Набор для осуществления способа по любому из пп.1-30, включающий а) биологический микрочип, состоящий из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр и содержащих набор иммобилизованных олигонуклеотидов; б) буферы для проведения гибридизации на микрочипе и отмывки. 56. Набор по п.55, дополнительно содержащий по меньшей мере один из следующих компонентов: реагенты для выделения образцов НК; реагенты для фрагментации образцов НК; флуоресцентные красители для мечения фрагментированных образцов НК; праймеры, в том числе, меченные флуоресцентным красителем, и другие реагенты для амплификации и/или мечения образцов НК; реагенты для получения кДНК. 57. Набор для осуществления способа по любому из пп.31-54, включающий а) биологический микрочип, состоящий из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр и содержащих набор иммобилизованных олигонуклеотидов; б) буферы и другие реагенты для проведения ПЦР на микрочипе. 58. Набор по п.57, дополнительно содержащий по меньшей мере один из следующих компонентов: реагенты для выделения образцов НК, праймеры и другие реагенты для амплификации образцов НК; реагенты для получения кДНК. 59. Набор по п.55 для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов), способом по п.30. 60. Набор по п.57 для обнаружения генов токсинообразования и резистентности к ампициллину на микрочипе способом по п.52. 61. Набор по п.57 для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, способом по п.53. 62. Набор по п.57 для обнаружения точечных нуклеотидных замен в гене brca1, ответственном за предрасположенность к раку молочной железы, способом по п.54. 63. Биологический микрочип с дискриминирующими олигонуклеотидами для осуществления способа по любому из пп.1-54, состоящий из трехмерных гидрофильных микроячеек, нанесенных в заданном пространственном порядке на поверхность общей подложки с частотой нанесения не менее 5 на квадратный миллиметр и содержащих набор иммобилизованных олигонуклеотидов. 64. Микрочип по п.63 для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов), способом по п.30. 65. Микрочип по п.63 для обнаружения генов токсинообразования и резистентности к ампициллину на микрочипе способом по п.52. 66. Микрочип по п.63 для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, способом по п.53. 67. Микрочип по п.63 для обнаружения точечных нуклеотидных замен в гене brcа 1, ответственном за предрасположенность к раку молочной железы, способом по п.54. 68. Дискриминирующие олигонуклеотиды для изготовления микрочипа по п.63 для идентификации хромосомных транслокаций, приводящих к развитию злокачественных заболеваний крови (лейкозов),способом по п.30. 69. Дискриминирующие олигонуклеотиды для изготовления микрочипа по п.65 для обнаружения генов токсинообразования и резистентности к ампициллину на микрочипе способом по п.52. 70. Дискриминирующие олигонуклеотиды для изготовления микрочипа по п.66 для обнаружения точечных мутаций в гене rpoB M. tuberculosis, ответственных за возникновение резистентности микроорганизмов к рифампицину, способом по п.53. 71. Дискриминирующие олигонуклеотиды для изготовления микрочипа по п.67 для обнаружения точечных нуклеотидных замен в гене brca1, ответственном за предрасположенность к раку молочной железы, способом по п.54.

МПК / Метки

МПК: C12Q 1/68, G01N 33/50

Метки: кислот, использованием, олигонуклеотидного, последовательностей, осуществления, анализа, наборы, микрочипа, биологического, способы, нуклеиновых

Код ссылки

<a href="http://easpatents.com/30-6512-sposoby-analiza-posledovatelnostejj-nukleinovyh-kislot-s-ispolzovaniem-biologicheskogo-oligonukleotidnogo-mikrochipa-i-nabory-dlya-ih-osushhestvleniya.html" rel="bookmark" title="База патентов Евразийского Союза">Способы анализа последовательностей нуклеиновых кислот с использованием биологического олигонуклеотидного микрочипа и наборы для их осуществления</a>

Похожие патенты