Способы и композиции для неинвазивной пренатальной диагностики анеуплоидии плода

Номер патента: 23565

Опубликовано: 30.06.2016

Авторы: Пацалис Филиппос К., Папагеоргиу Элизавет А.

Есть еще 22 страницы.

Смотреть все страницы или скачать PDF файл.

Формула / Реферат

1. Способ пренатальной диагностики трисомии 21 хромосомы с использованием образца крови матери, включающий:

а) физическое отделение гиперметилированной ДНК от гипометилированной ДНК без химического изменения или ферментативного расщепления гипометилированной ДНК или гиперметилированной ДНК в образце материнской крови для получения образца гиперметилированной ДНК;

б) определение уровней множества дифференциально метилированных участков (ДМУ) в образце гиперметилированной ДНК с получением значения гиперметилирования для образца гиперметилированной ДНК, где по меньшей мере один из ДМУ содержит участок, выбранный из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 44161178-44161323 (SEQ ID NO: 34), пар оснований 33320735-33320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 42355712-42355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 32268843-32268943 (SEQ ID NO: 42) и пар оснований 37841284-37841411 (SEQ ID NO: 44);

в) сравнение значения гиперметилирования образца гиперметилированной ДНК со стандартизированным эталонным значением гиперметилирования для указанного множества ДМУ и

г) диагностику трисомии 21 хромосомы на основе указанного сравнения.

2. Способ по п.1, отличающийся тем, что образец крови матери представлен образцом периферической крови матери или фракционированной частью периферической крови матери.

3. Способ по п.1 или 2, отличающийся тем, что гиперметилированная ДНК отделяется от гипометилированной ДНК с использованием антитела, которое иммунопреципитирует метилированную ДНК

4. Способ по любому из предшествующих пунктов, отличающийся тем, что множество ДМУ выбирают из списков, представленных в Приложении А.

5. Способ по любому из предшествующих пунктов, отличающийся тем, что уровни множества ДМУ определяют по меньшей мере для трех, пяти, восьми или десяти ДМУ.

6. Способ по любому из предшествующих пунктов, отличающийся тем, что уровни множества ДМУ в образце гиперметилированной ДНК определяют путем количественной полимеразной цепной реакции в режиме реального времени (КПЦР в режиме реального времени).

7. Способ по любому из предшествующих пунктов, отличающийся тем, что значение гиперметилирования для образца гиперметилированной ДНК сравнивают со стандартизированным нормальным эталонным значением гиперметилирования образца ДНК крови здоровой матери и диагноз анеуплоидии плода ставят, когда значение гиперметилирования для образца гиперметилированной ДНК выше, чем стандартизированное нормальное эталонное значение гиперметилирования для образца ДНК крови здоровой матери.

8. Способ по любому из предшествующих пунктов, отличающийся тем, что множество ДМУ находится на хромосоме 21 и включает:

(а) три или более участка, выбранных из группы, состоящей из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 44161178-44161323 (SEQ ID NO: 34), пар оснований 44161239-44161371 (SEQ ID NO: 35), пар оснований 33320735-33320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 42355712-42355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 22403649-22403792 (SEQ ID NO: 40), пар оснований 29136735-29136844 (SEQ ID NO: 41), пар оснований 32268843-32268943 (SEQ ID NO: 42), пар оснований 44079235-44079322 (SEQ ID NO: 43), пар оснований 37841284-37841411 (SEQ ID NO: 44) и их комбинаций;

(б) восемь или более участков, выбранных из группы, состоящей из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 44161178-44161323 (SEQ ID NO: 34), пар оснований 44161239-44161371 (SEQ ID NO: 35), пар оснований 33320735-33320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 42355712-42355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 22403649-22403792 (SEQ ID NO: 40), пар оснований 29136735-29136844 (SEQ ID NO: 41), пар оснований 32268843-32268943 (SEQ ID NO: 42), пар оснований 44079235-44079322 (SEQ ID NO: 43), пар оснований 37841284-37841411 (SEQ ID NO: 44) и их комбинаций; или

(в) восемь участков с нуклеотидными последовательностями пары оснований 33320735-33320829 (SEQ ID NO: 36), пары оснований 42189557-42189683 (SEQ ID NO: 37), пары оснований 42355712-42355815 (SEQ ID NO: 38), пары оснований 42357215-42357341 (SEQ ID NO: 39), пары оснований 22403649-22403792 (SEQ ID NO: 40), пары оснований 32268843-32268943 (SEQ ID NO: 42), пары оснований 44079235-44079322 (SEQ ID NO: 43) и пары оснований 37841284-37841411 (SEQ ID NO: 44).

9. Способ пренатальной диагностики трисомии 21 хромосомы с использованием образца периферической крови матери, включающий:

а) физическое отделение гиперметилированной ДНК от гипометилированной ДНК в образце материнской периферической крови без химического изменения или ферментативного расщепления гипометилированной ДНК или гиперметилированной ДНК для получения образца гиперметилированной ДНК;

б) определение уровней множества дифференциально метилированных участков (ДМУ) на хромосоме 21 в образце гиперметилированной ДНК с получением значения гиперметилирования для образца гиперметилированной ДНК,

при этом множество ДМУ на хромосоме 21 включает восемь или более участков, выбранных из группы, состоящей из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 44161178-44161323 (SEQ ID NO: 34), пар оснований 33320735-33320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 42355712-42355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 32268843-32268943 (SEQ ID NO: 42) и пар оснований 37841284-37841411 (SEQ ID NO: 44) и их комбинаций; и

уровни множества ДМУ определяют количественной полимеразной цепной реакцией в режиме реального времени (КПЦР в режиме реального времени);

в) сравнение значения гиперметилирования образца гиперметилированной ДНК со стандартизированным нормальным эталонным значением гиперметилирования для указанного множества ДМУ на хромосоме 21 и

г) диагностику трисомии 21 хромосомы на основе указанного сравнения.

10. Способ по любому из предшествующих пунктов, отличающийся тем, что гиперметилированная ДНК физически отделяется от гипометилированной ДНК путем иммунопреципитации метилированной ДНК (MeDiP).

11. Способ по любому из предшествующих пунктов, отличающийся тем, что после физического отделения гиперметилированной ДНК от гипометилированной ДНК, гиперметилированная ДНК амплифицируется.

12. Способ по любому из предшествующих пунктов, отличающийся тем, что гиперметилированная ДНК амплифицируется путем опосредованной лигированием полимеразной цепной реакции (ОЛ-ПЦР).

13. Способ по любому из предшествующих пунктов, отличающийся тем, что уровни множества ДМУ также определены в общем образце не подвергнутой обработке ДНК крови матери в качестве контроля эффективности ОЛ-ПЦР.

14. Способ по п.9, отличающийся тем, что значение гиперметилирования для образца гиперметилированной ДНК сравнивают со стандартизированным нормальным эталонным значением гиперметилирования образца ДНК крови здоровой матери и диагноз трисомии 21 хромосомы ставится, когда значение гиперметилирования для образца гиперметилированной ДНК выше, чем стандартизированное нормальное эталонное значение гиперметилирования для образца ДНК крови здоровой матери.

15. Способ по п.9, отличающийся тем, что множество ДМУ на хромосоме 21 включает восемь участков с нуклеотидными последовательностями пары оснований 33320735-33320829 (SEQ ID NO: 36), пары оснований 42189557-42189683 (SEQ ID NO: 37), пары оснований 42355712-42355815 (SEQ ID NO: 38), пары оснований 42357215-42357341 (SEQ ID NO: 39), пары оснований 22403649-22403792 (SEQ ID NO: 40), пары оснований 32268843-32268943 (SEQ ID NO: 42), пары оснований 44079235-44079322 (SEQ ID NO: 43) и пары оснований 37841284-37841411 (SEQ ID NO: 44).

16. Набор для пренатальной диагностики трисомии 21 хромосомы для применения в способе по любому из пп.1-15, включающий:

а) две или несколько композиции нуклеиновых кислот для определения уровней множества дифференциально метилированных участков (ДМУ) на хромосоме 21, где по меньшей мере один из ДМУ содержит участок, выбранный из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 44161178-44161323 (SEQ ID NO: 34), пар оснований 33320735-33320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 42355712-42355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 32268843-32268943 (SEQ ID NO: 42) и пар оснований 37841284-37841411 (SEQ ID NO: 44); и

б) инструкции по использованию композиций нуклеиновых кислот для пренатальной диагностики трисомии 21 хромосомы.

17. Набор по п.16, отличающийся тем, что множество ДМУ на 21 хромосоме выбирают из списков, представленных в Приложении А.

18. Набор по п.16, отличающийся тем, что множество ДМУ на хромосоме 21 включает:

(а) три или более участка, выбранных из группы, состоящей из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 44161178-44161323 (SEQ ID NO: 34), пар оснований 44161239-44161371 (SEQ ID NO: 35), пар оснований 33320735-33320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 42355712-42355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 22403649-22403792 (SEQ ID NO: 40), пар оснований 29136735-29136844 (SEQ ID NO: 41), пар оснований 32268843-32268943 (SEQ ID NO: 42), пар оснований 44079235-44079322 (SEQ ID NO: 43), пар оснований 37841284-37841411 (SEQ ID NO: 44) и их комбинаций;

(б) восемь или более участков, выбранных из группы, состоящей из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 44161178-44161323 (SEQ ID NO: 34), пар оснований 44161239-44161371 (SEQ ID NO: 35), пар оснований 33320735-33320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 42355712-42355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 22403649-22403792 (SEQ ID NO: 40), пар оснований 29136735-29136844 (SEQ ID NO: 41), пар оснований 32268843-32268943 (SEQ ID NO: 42), пар оснований 44079235-44079322 (SEQ ID NO: 43), пар оснований 37841284-37841411 (SEQ ID NO: 44) и их комбинаций; или

(в) восемь участков с нуклеотидными последовательностями пары оснований 33320735-33320829 (SEQ ID NO: 36), пары оснований 42189557-42189683 (SEQ ID NO: 37), пары оснований 42355712-42355815 (SEQ ID NO: 38), пары оснований 42357215-42357341 (SEQ ID NO: 39), пары оснований 22403649-22403792 (SEQ ID NO: 40), пары оснований 32268843-32268943 (SEQ ID NO: 42), пары оснований 44079235-44079322 (SEQ ID NO: 43) и пары оснований 37841284-37841411 (SEQ ID NO: 44).

19. Набор по любому из пп.16-18, отличающийся тем, что композиции нуклеиновой кислоты включают одну или более пар олигонуклеотидных праймеров, выбранных из группы, состоящей из

GCTGGACCAGAAAGTGTTGAG (SEQ ID NO: 1) и GTGTGCTGCTTTGCAATGTG (SEQ ID NO: 2),

GGTCGAGTTTTTGGTGGTGT (SEQ ID NO: 3) и CCACCGTCACTGTTCCTAGA (SEQ ID NO: 4),

CCTCGTGCTCGTGTCTGTAT (SEQ ID NO: 5) и GAGGAAACAGCTTGGCTCTG (SEQ ID NO: 6),

CTGTTGCATGAGAGCAGAGG (SEQ ID NO: 7) и CGTCCCCCTCGCTACTATCT (SEQ ID NO: 8),

TGCAGGATATTTGGCAAGGT (SEQ ID NO: 9) и CTGTGCCGGTAGAAATGGTT (SEQ ID NO: 10),

TGAATCAGTTCACCGACAGC (SEQ ID NO: 11) и GAAACAACCTGGCCATTCTC (SEQ ID NO: 12),

CCGTTATATGGATGCCTTGG (SEQ ID NO: 13) и AAACTGTTGGGCTGAACTGC (SEQ ID NO: 14),

CCAGGCAAGATGGCTTATGT (SEQ ID NO: 15) и ACCATGCTCAGCCAATTTTT (SEQ ID NO: 16),

GACCCAGACGATACCTGGAA (SEQ ID NO: 17) и GCTGAACAAAACTCGGCTTC (SEQ ID NO: 18),

CCACATCCTGGCCATCTACT (SEQ ID NO: 19) и TTCCACAGACAGCAGAGACG (SEQ ID NO: 20),

TGAGCTCACAGGTCTGGAAA (SEQ ID NO: 21) и CCCCACAGGGTTCTGGTAAT (SEQ ID NO: 22),

ATTCTCCACAGGGCAATGAG (SEQ ID NO: 23) и TTATGTGGCCTTTCCTCCTG (SEQ ID NO: 24)

и их комбинаций.

20. Набор по любому из пп.16-19, отличающийся тем, что набор дополнительно включает средства для физического отделения гиперметилированной ДНК от гипометилированной ДНК без химического изменения или ферментативного расщепления гиперметилированной ДНК или гипометилированной ДНК в образце крови.

21. Набор по п.20, отличающийся тем, что способы для физического отделения гиперметилированной ДНК от гипометилированной ДНК включают антитело, которое иммунопреципитирует метилированную ДНК.

22. Набор по п.20, отличающийся тем, что он дополнительно включает способы амплификации гиперметилированной ДНК.

23. Набор по п.22, отличающийся тем, что способы амплификации гиперметилированной ДНК включают олигонуклеотидные линкеры или олигонуклеотидные праймеры для проведения опосредованной лигированием полимеразной цепной реакции (ОЛ-ПЦР).

Рисунок 1

Текст

Смотреть все

СПОСОБЫ И КОМПОЗИЦИИ ДЛЯ НЕИНВАЗИВНОЙ ПРЕНАТАЛЬНОЙ ДИАГНОСТИКИ АНЕУПЛОИДИИ ПЛОДА Изобретение описывает способы и композиции для неинвазивной пренатальной диагностики анеуплоидии плода. Была идентифицирована большая панель дифференциально метилированных участков (ДМУ). Определенные такие ДМУ являются гипометилированными в ДНК крови взрослой женщины и гиперметилированными в ДНК плода, в то время как другие гиперметилированы в ДНК крови взрослой женщины и гипометилированы в ДНК плода. Более того, было доказано, что ДМУ, являющиеся гипометилированными в ДНК крови взрослой женщины и гиперметилированными в ДНК плода, точно предсказывают анеуплоидию плода в ДНК плода, присутствующей в образце крови матери во время беременности. В способах по изобретению гиперметилированную ДНК физически отделяют от гипометилированной ДНК преимущественно путем иммунопреципитации метилированной ДНК. Уровень техники В настоящее время пренатальная диагностика проводится с использованием обычного цитогенетического анализа (такого как кариотипирование) или анализа ДНК (такого как КФ-ПЦР), которые требуют получения генетического материала плода путем амниоцентеза, отбора ворсин хориона или хордоцентеза. Однако такие процедуры являются инвазивными и связаны со значительным риском потери плода (от 0,5 до 1% при отборе ворсинок хориона и амниоцентезе) (Hultn, M.A. et al. (2003) Reproduction 126:279297). Потребность в наличии эффективных тестов пренатальной диагностики особенно острая в случае синдрома Дауна, также известного как синдром трисомии 21 хромосомы, который считается наиболее частой формой задержки в умственном развитии с частотой возникновения 1 на 700 случаев рождаемости во всех популяциях по всему миру. Однако ввиду имеющегося в настоящее время риска пренатального тестирования, пренатальная диагностика рекомендована только для случаев беременности с высоким риском (6-8% всех случаев беременности), которые оцениваются путем скрининга сыворотки матери и ультразвука плода. Таким образом, существует настоятельная потребность в разработке диагностических процедур, которые не подвергают плод риску и обычно называют неинвазивной пренатальной диагностикой. В крови матери во время беременности была обнаружена несвязанная ДНК плода (ffДНК) (Lo, Y.M.et al. (1997) Lancet 350:485-487), что оказалось целью для альтернативных способов, направленных на разработку неинвазивных пренатальных тестов. ffДНК с успехом использовалась для определения пола плода и статуса RhD плода в плазме матери (Lo, Y.M. et al. (1998) N. Engl. J. Med. 339:1734-1738; Bianchi,D.W. et al. (2005) Obstet. Gynecol. 106:841-844). Тем не менее, прямой анализ ограниченного количестваffДНК (от 3 до 6%) в присутствии избытка материнской ДНК представляет собой большие трудности в разработке неинвазивного тестирования анеуплоидии плода. Недавние достижения в данной области показали, что физические и молекулярные характеристикиffДНК могут использоваться для ее отделения от материнской ДНК в крови или в качестве средства для обогащения ДНК плода (Chan, K.C. et al. (2004) Clin. Chem. 50:88-92; Poon, L.L. et al. (2002) Clin. Chem. 48:35-41). Например, разделение по фракциям использовалось применительно к ДНК плазмы для обогащения ДНК плода, т.к. ДНК плода обычно короче по длине, чем ДНК матери, присутствующей в крови(Chan, K.C. et al. (2004), см. выше). Более того, основываясь на том факте, что ffДНК в плазме матери имеет плацентарное происхождение, эпигенетические различия между ДНК из периферической (цельной) крови матери и плацентарной ДНК использовали для определения гипометилированной последовательности генов (maspin/SERPINB5) в плазме матери, полученной из плода (Masuzaki, H. et al. (2004) J.Acad. Sci. USA 102:14753-14758). Вследствие этого, было описано небольшое количество дополнительных дифференциальных эпигенетических молекулярных маркеров плода, включая ген RASSF1 А на хромосоме 3, а также маркер на хромосоме 21 (Chiu, R.W. et al. (2007) Am. J. Pathol. 170:941-950; Old, R.W.et al. (2007) Reprod. Biomed. Online 15:227-235; Chim, S.S. et al. (2008) Clin. Chem. 54:500-511). Несмотря на то, что такие исследования показали, что эпигенетические различия между ДНК плода(плацентарной ДНК, полученной из образца ворсинок хориона) и ДНК периферической крови матери могут служить в качестве потенциальных молекулярных маркеров плода для неинвазивной пренатальной диагностики, на данный момент было идентифицировано или тестировано только ограниченное количество геномных участков. Целый ряд исследований был направлен на изучение участков промотора одного гена (Chim, S.S. et al. (2005) см. выше; Chiu, R.W. et al. (2007, см. выше), в то время как другие исследования изучали островки CpG на хромосоме 21 (Old, R.W. et al. (2007) см. выше; Chim, S.S. et al. (2008) см. выше), которые составляют лишь небольшой участок хромосомы (Fazzari, M.J. et al. (2004) Nat. Rev.Genet. 5:446-455). Используемые в настоящее время способы, разработанные с использованием ffДНК для неинвазивной пренатальной диагностики, имеют ряд ограничений. Один способ, подвергнутый изучению, включает использование чувствительных к метилированию рестрикционных ферментов для удаления гипометилированной материнской ДНК, что позволяет проводить анализ ffДНК с использованием прямой полимеразной цепной реакции (ПЦР) (Old, R.W. et al. (2007), см. выше). Однако требования к участкам различно метилированной ДНК на предмет содержания сайта рестрикции для распознавания чувствительными к метилированию рестрикционными ферментами ограничивают число участков, подходящих для тестирования. Другой подвергнутый исследованию способ включает использование конверсии натрия бисульфитом для дискриминации дифференциального метилирования между ДНК матери и плода. В этом способе после конверсии натрия бисульфитом происходит специфическая относительно метилирования ПЦР или удлинение праймера одного нуклеотида, чувствительное к метилированию, и/или вызванное бисульфитом секвенирование (Chim, S.S. et al. (2005) см. выше; Chiu, R.W. et al. (2007) см. выше;Chim, S.S. et al. (2008) см. выше). Однако такой способ имеет две основные проблемы. Во-первых, точный анализ статуса метилирования после конверсии бисульфитом зависит от полной конверсии неметилированных цитозинов в урацилы, что достигается крайне редко. Во-вторых, деградация ДНК, полученная после обработки дисульфитом (описано в Grunau, С. et al. (2001) Nucl. Acids Res. 29:E65-5) осложняет дальнейшее тестирование и количественную оценку чрезвычайно малых количеств ДНК плода.-1 023565 Другой открытый недавно способ состоял в прямом секвенировании бесклеточной ДНК из плазмы беременных женщин с использованием высокорезультативного секвенирования способом "выстрела из дробового ружья" (Fan, Н.С. et.al (2008) Proc. Natl. Acad. Sci. USA 105:16266-71; Chiu, R.W. et.al. (2008)Proc. Natl. Acad. Sci USA 105:20458-63). Однако такой способ является технологически сложным, и высокая цена такого способа делает его применение слишком трудным для большинства диагностических лабораторий. В соответствии с этим необходимы дополнительные подходы и способы для неинвазивной пренатальной диагностики анеуплоидии плода для снижения риска потери плода и скрининга всех случаев беременности, не только для случаев беременности с высоким риском. Сущность изобретения Данное изобретение описывает новый способ неинвазивной пренатальной диагностики, основанной на определении ffДНК. В настоящее время с использованием системы, сочетающей в себе иммунопреципитацию метилированной ДНК (MeDiP) и матричный анализ мозаичной структуры олигонуклеотидов с высоким разрешением для идентификации образцов метилированной ДНК в хромосомах в ходе способов с высоким результатом, было идентифицировано большое число (более 2000) дифференциально метилированных участков (ДМУ) каждой исследуемой хромосомы (хромосомы 13, 18, 21, X и Y), которые поразному метилированы в ДНК из периферической крови женщины и плода (плацентарной ДНК). Более того, репрезентативные образцы субгруппы таких ДМУ, которые гиперметилированы в ДНК плода и гипометилированы в периферической крови женщины, использовали для точного предсказывания трисомии 21 хромосомы, и такой способ основывается на физическом отделении гиперметилированной ДНК от гипометилированной ДНК в образце крови матери, обычно во время первого триместра беременности, без химического изменения или ферментативного расщепления гиперметилированной ДНК или гипометилированной ДНК, и затем определении уровней множества ДМУ в образце гиперметилированного ДНК. Таким образом, была показана эффективность описанных ДМУ и способы диагностики анеуплоидии плода. В соответствии с этим в одном аспекте изобретение описывает способ пренатальной диагностики анеуплоидии плода с использованием образца крови матери, и такой способ включает: а) в образце материнской крови физическое отделение гиперметилированной ДНК от гипометилированной ДНК без химического изменения или ферментативного расщепления гипометилированной ДНК или гиперметилированной ДНК для получения образца гиперметилированной ДНК; б) в образце гиперметилированной ДНК определение уровней множества дифференциально метилированных участков (ДМУ) с получением значения гиперметилирования для образца гиперметилированной ДНК; в) сравнение значения гиперметилирования образца гиперметилированной ДНК со стандартизированным эталонным значением гиперметилирования для указанного множества ДМУ (например, нормального эталонного значения гиперметилирования матери при соответствующем сроке плода); и г) диагностика анеуплоидии плода на основе указанного сравнения. В преимущественном варианте воплощения изобретения образец крови матери представлен образцом периферической крови матери. Преимущественно, гиперметилированная ДНК физически отделяется от гипометилированной ДНК путем иммунопреципитации метилированной ДНК (MeDiP). Преимущественно, после физического отделения гиперметилированной ДНК от гипометилированной ДНК, гиперметилированная ДНК амплифицируется таким способом, как полимеразная цепная реакция, опосредованная лигированием (ОЛ-ПЦР). Множество ДМУ преимущественно выбирается из списков, представленных в Приложениях А-Е. В различных вариантах воплощения изобретения уровни множества ДМУ определяются для, по меньшей мере, трех, по меньшей мере, пяти, по меньшей мере, восьми, по меньшей мере, 10 или, по меньшей мере, 12 ДМУ, например, выбранных из списков, представленных в Приложениях А-Е. Более того, также могут использоваться контрольные участки (например, два контрольных участка). Преимущественно,уровни множества ДМУ в образце гиперметилированного ДНК определяют количественной полимеразной цепной реакцией в режиме реального времени (КПЦР в режиме реального времени). В одном варианте воплощения изобретения уровни множества ДМУ также определены в общем образце не подвергнутой обработке ДНК крови матери в качестве контроля эффективности ОЛ-ПЦР. Преимущественно, значение гиперметилирования для образца гиперметилированной ДНК сравнивается со стандартизированным эталонным значением гиперметилирования, например, определенного из ДНК матери, полученной у женщин, вынашивающих здоровый плод, и диагноз анеуплоидии плода ставится, когда значение гиперметилирования для образца гиперметилированной ДНК выше, чем стандартизированное нормальное эталонное значение гиперметилирования. В преимущественном варианте воплощения изобретения множество ДМУ находится на хромосоме 21 для диагностики трисомии 21 хромосомы. Преимущественно, множество ДМУ на хромосоме 21 включает три или более, пять или более, или восемь или более участков, выбранных из группы, состоящей из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 44161178-44161323 (SEQ IDNO: 44) и их комбинации. Преимущественные ДМУ на хромосоме 21 для использования в диагностике трисомии 21 хромосомы представлены SEQ ID NO: 36, 37, 38, 39, 40, 42, 43 и 44. В других вариантах воплощения изобретения множество ДМУ на хромосоме выбирают из группы, состоящей из хромосомы 13, хромосомы 18, хромосомы X и хромосомы Y. В другом аспекте изобретение описывает способ пренатальной диагностики трисомии 21 хромосомы с использованием образца периферической крови матери, и такой способ включает: а) в образце материнской периферической крови физическое отделение гиперметилированной ДНК от гипометилированной ДНК без химического изменения или ферментативного расщепления гиперметилированной ДНК или гипометилированной ДНК для получения образца гиперметилированной ДНК; б) в образце гиперметилированной ДНК определение уровней множества дифференциально метилированных участков (ДМУ) на хромосоме 21 с получением значения гиперметилирования для образца гиперметилированной ДНК; при этом множество ДМУ на хромосоме 21 включает восемь или более участков, выбранных из группы, состоящей из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 4416117844161323 (SEQ ID NO: 34), пар оснований 44161239-44161371 (SEQ ID NO: 35), пар оснований 3332073533320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 4235571242355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 2240364922403792 (SEQ ID NO: 40), пар оснований 29136735-29136844 (SEQ ID NO: 41), пар оснований 3226884332268943 (SEQ ID NO: 42), пар оснований 44079235-44079322 (SEQ ID NO: 43), пар оснований 3784128437841411 (SEQ ID NO: 44) и их комбинации, и при этом уровни множества ДМУ определяют количественной полимеразной цепной реакцией в режиме реального времени (КПЦР в режиме реального времени); в) сравнение значения гиперметилирования образца гиперметилированной ДНК со стандартизированным нормальным эталонным значением гиперметилирования для указанного множества ДМУ на хромосоме 21; и г) диагностика трисомии 21 хромосомы на основе указанного сравнения. Преимущественные ДНУ на хромосоме 21 для использования в диагностике трисомии 21 хромосомы представлены SEQ ID NO: 36, 37, 38, 39, 40, 42, 43 и 44. Преимущественно, гиперметилированная ДНК физически отделяется от гипометилированной ДНК путем иммунопреципитации метилированной ДНК (MeDiP). Преимущественно, после физического отделения гиперметилированной ДНК от гипометилированной ДНК, гиперметилированная ДНК амплифицируется таким способом, как полимеразная цепная реакция, опосредованная лигированием (ОЛ-ПЦР). В одном варианте воплощения изобретения уровни множества ДМУ также определены в общем образце не подвергнутой обработке ДНК крови матери в качестве контроля эффективности ОЛ-ПЦР. В другом варианте воплощения изобретения значение гиперметилирования для образца гиперметилированной ДНК сравнивается со стандартизированным нормальным эталонным значением гиперметилирования образца крови здоровой матери, и диагноз трисомии 21 хромосомы ставится, когда значение гиперметилирования для образца гиперметилированной ДНК выше, чем стандартизированное нормальное эталонное значение гиперметилирования. В еще одном аспекте изобретение описывает способ идентификации дифференциально метилированного участка (ДМУ) на интересующей хромосоме, подходящий для использования в диагностике анеуплоидии плода, и такой способ включает: а) обеспечение:(i) образца ДНК из периферической крови здоровой взрослой женщины (образец ПК); и(ii) образца ДНК из здоровой плаценты (образец ПЛ); б) в каждом образце а) физическое отделение гиперметилированной ДНК от гипометилированной ДНК без химического изменения или ферментативного расщепления гиперметилированной ДНК или гипометилированной ДНК для получения:(iii) сепарированного образца ПЛ; в) в каждом сепарированном образце б) определение уровней множества участков на интересующей хромосоме; и г) выбор гипометилированного участка в сепарированном образце ПК и гиперметилированного участка в сепарированном образце ПЛ для идентификации дифференциально метилированного участка(ДМУ) на интересующей хромосоме. В одном варианте воплощения изобретения, если образец ПЛ включает два разных образца, представленных образцом ПЛ на первом триместре и образцом ПЛ на третьем триместре, то этап г) дополнительно включает выбор участка, имеющего эквивалентную степень метилирования в сепарированном-3 023565 образце ПЛ из первого триместра и сепарированном образце ПЛ из третьего триместра. В преимущественном варианте воплощения изобретения интересующая хромосома представлена хромосомой 21. В других вариантах воплощения изобретения интересующую хромосому выбирают из группы, состоящей из хромосомы 13, хромосомы 18, хромосомы X и хромосомы Y. В преимущественном варианте воплощения изобретения анеуплоидия представлена трисомией. В другом варианте воплощения изобретения анеуплоидия представлена моносомией. В еще одном аспекте изобретение описывает набор для пренатальной диагностики трисомии 21 хромосомы, и такой набор включает: а) одну или несколько композиций нуклеиновых кислот для определения уровней множества дифференциально метилированных участков (ДМУ) на хромосоме 21; и б) инструкции по использованию композиций нуклеиновых кислот для пренатальной диагностики трисомии 21 хромосомы. Преимущественно множество ДМУ на хромосоме 21 выбирают из списка, представленного в Приложении А. Более преимущественно, множество ДМУ на хромосоме 21 включает три или более, пять или более, или восемь или более участков, выбранных из группы, состоящей из пар оснований 3927985639280004 (SEQ ID NO: 33), пар оснований 44161178-44161323 (SEQ ID NO: 34), пар оснований 4416123944161371 (SEQ ID NO: 35), пар оснований 33320735-33320829 (SEQ ID NO: 36), пар оснований 4218955742189683 (SEQ ID NO: 37), пар оснований 42355712-42355815 (SEQ ID NO: 38), пар оснований 4235721542357341 (SEQ ID NO: 39), пар оснований 22403649-22403792 (SEQ ID NO: 40), пар оснований 2913673529136844 (SEQ ID NO: 41), пар оснований 32268843-32268943 (SEQ ID NO: 42), пар оснований 4407923544079322 (SEQ ID NO: 43), пар оснований 37841284-37841411 (SEQ ID NO: 44) и их комбинации. Преимущественные ДНУ на хромосоме 21 для использования в диагностике трисомии 21 хромосомы представлены SEQ ID NO: 36, 37, 38, 39, 40, 42, 43 и 44. В преимущественном варианте воплощения изобретения композиции нуклеиновых кислот из набора включают один или более олигонуклеотидных праймеров, выбранных из группы, состоящей из SEQID NO: 1-24 и их комбинаций. В другом варианте воплощения изобретения набор дополнительно включает олигонуклеотидные праймеры (например, два или несколько) для определения контрольных участков. В другом варианте воплощения изобретения набор дополнительно включает средства для физического отделения гиперметилированной ДНК от гипометилированной ДНК без химического изменения или ферментативного расщепления гиперметилированной ДНК или гипометилированной ДНК в образце крови. Преимущественно, способы для физического разделения гиперметилированной ДНК и гипометилированной ДНК включают антитело, которое иммунопреципитирует метилированную ДНК. В другом варианте воплощения изобретения набор может дополнительно включать способы для амплификации гиперметилированной ДНК. В преимущественном варианте воплощения изобретения способы амплификации гиперметилированной ДНК включают олигонуклеотидные линкеры и/или олигонуклеотидные праймеры для проведения опосредованной лигированием полимеразной цепной реакции (ОЛ-ПЦР). В еще одном аспекте изобретение описывает композицию нуклеиновых кислот, включающую один или более изолированных олигонуклеотидных праймеров, выбранных из группы, состоящей из SEQ IDNO: 1-24 и их комбинаций Краткое описание фигур Фиг. 1 представляет собой диаграмму, отображающую обогащение метилированием ДНК участкаCHR21(A), проанализированного с использованием олигонуклеотидной матрицы. Диаграмма показывает различия в метилировании между образцами плаценты 3 триместра и периферической (цельной) крови, а также индивидуальный статус метилирования образцов ДНК из периферической (цельной) крови, плаценты 1 триместра и плаценты 3 триместра. Фиг. 2 представляет собой диаграмму, отображающую сравнение обогащения метилированием ДНК участка CHR21(A), определенного с использованием олигонуклеотидных матриц и ПЦР в режиме реального времени с использованием образцов ДНК из периферической крови, плаценты 1 триместра и 3 триместра. Ось Y указывает относительное кратное обогащение образца плаценты в сравнении с образцом ДНК из периферической крови, и ось X указывает положение в хромосоме в bp. Серые линии представляют собой олигонуклеотид, покрывающий специфический участок на хромосоме 21, при этом черные линии представляют собой продукты ПЦР (CHR21 (А 1) и CHR21 (А 2 при использовании количественной ПЦР в режиме реального времени. Пунктирные линии представляют собой результаты, полученные из образца плаценты 1 триместра, в то время как сплошные линии представляют собой результаты, полученные из образца плаценты 3 триместра. Фиг. 3 представляет собой столбчатую диаграмму, показывающую обогащение метилированием ДНК участка CHR21(B4) с использованием количественной ПЦР в режиме реального времени на MeDiP и введением образцов реплицируемой ДНК. Открытые столбцы представляют образцы периферической(цельной) крови; серые столбы представляют образцы ДНК плаценты 1 триместра; сплошные черные столбцы представляют образцы ДНК плаценты 3 триместра. Усы указывают на стандартное отклонение между техническими репликантами. WB: цельная (периферическая) кровь, PL: плацента. Фиг. 4 представляет собой столбчатую диаграмму, отображающую обогащение метилированием-4 023565 ДНК участка CHR13(HYP1) при использовании количественной ПЦР в режиме реального времени. Открытые столбцы представляют собой вводимую ДНК в сравнении с периферической (цельной) кровью; сплошные черные столбцы представляют собой иммунопреципитированную ДНК в сравнении с периферической (цельной) кровью; 1PL и 2PL представляют собой плаценту 3 триместра, и 3PL представляет собой плаценту 1 триместра. WB представляет собой цельную (периферическую) кровь, Р представляет собой плаценту. Фиг. 5 представляет собой графическую схему способа идентификации дифференциально метилированных участков (ДМУ). Фиг. 6 представляет графическую схему способа разработки и валидации неинвазивного диагностического теста трисомии 21 хромосомы (NID21). Фиг. 7 представляет схематическую иллюстрацию стратегии соотношения метилирования ДНК для неинвазивного определения трисомии 21 хромосомы с использованием анализа периферической крови матери путем относительного количественного определения специфических метилированных участков ДНК плода, расположенных на хромосоме 21. Фиг. 8 представляет схематическую иллюстрацию аналитического способа определения соотношения метилирования ДНК. Фиг. 9 представляет коробчатую диаграмму с результатами, полученными для четырех ДМУ (ЕР 1,ЕР 4, ЕР 7 и ЕР 10) для случаев нормы и трисомии 21 хромосомы. Подробное описание Данное изобретение основывается, по крайней мере, частично на идентификации исследователями большой панели дифференциально метилированных участков (ДМУ), характеризующихся гиперметилированием в ДНК плода и гипометилированием в ДНК матери. Кроме того, изобретение основывается, по меньшей мере, частично на доказательстве исследователями того, что гиперметилированная ДНК плода может быть очищена от гипометилированной ДНК матери путем физического разделения двух популяций ДНК без химического изменения или ферментативного расщепления двух образцов ДНК, что позволяет получить образец, обогащенный гиперметилированной ДНК плода. Кроме того, исследователями была точно диагностирована трисомия 21 хромосомы с использованием панели образцов периферической крови матери и репрезентативных и описанных здесь примеров ДМУ, что позволило доказать эффективность идентифицированных ДМУ и описанных способов в диагностике анеуплоидии плода. В следующих подглавах более подробно описаны различные аспекты данного изобретения.I. Способы неинвазивной пренатальной диагностики анеуплоидии плода. В одном аспекте изобретение описывает способ пренатальной диагностики анеуплоидии плода с использованием образца крови матери, и такой способ включает: а) в образце материнской крови физическое отделение гиперметилированной ДНК от гипометилированной ДНК без химического изменения или ферментативного расщепления гипометилированной ДНК или гиперметилированной ДНК для получения образца гиперметилированной ДНК; б) в образце гиперметилированной ДНК определение уровней множества дифференциально метилированных участков (ДМУ) с получением значения гиперметилирования для образца гиперметилированной ДНК; в) сравнение значения гиперметилирования образца гиперметилированной ДНК со стандартизированным эталонным значением гиперметилирования (например, стандартизированным нормальным эталонным значением гиперметилирования матери, которое более подробно обсуждается ниже) для указанного множества ДМУ; и г) диагностика анеуплоидии плода на основе указанного сравнения. Образец крови матери Образец крови матери может быть получен с использованием стандартных способов, таких как использование иглы и шприца. В преимущественном варианте воплощения изобретения образец крови матери представлен образцом периферической крови матери. С другой стороны, образец крови матери может быть представлен фракционированной частью периферической крови, такой как образец плазмы матери. Как только будет получен образец крови, вся ДНК может быть выделена из образца с использованием стандартных способов, неограничивающим примером которых является набор QIAmp DNA BloodMidi Kit (Qiagen). Как правило, затем вся ДНК фрагментируется, преимущественно до размеров примерно 300bp-800bp. Например, вся ДНК может быть фрагментирована ультразвуком. Отделение гиперметилированной ДНК от гипометилированной ДНК В данном способе гиперметилированная ДНК отделяется от гипометилированной ДНК без химического изменения или ферментативного расщепления гипометилированной ДНК или гиперметилированной ДНК для получения образца гиперметилированной ДНК. Преимущественно, такое физическое разделение сопровождается иммунопреципитацией метилированной ДНК (MeDiP), способом, который был описан в науке (см. например, Weber, M. et al. (2005) Nat. Genet. 37:853-862; и Rakyan, et al. (2008) Genome Res. 18:1518-1529; включено в данный документ посредством ссылки). В способе MeDiP исходную ДНК денатурируют, инкубируют с антителом, направленным против 5 метилцитозина, и затем метилированную ДНК изолируют путем иммунопреципитации. Например, для-5 023565 сопровождения иммунопреципитации, антитело к 5-метилцитозину может быть соединено с твердым субстратом (например, магнитными микрочастицами, микрочастицами агарозы или парамагнитными гранулами) для преципитации метилированной ДНК из раствора (прямая иммунопреципитация). С другой стороны, может использоваться вторичное антитело или реагент, которое распознает антитело к 5 метилцитозину (например, константный участок антитела), и которое соединено с твердым субстратом для обеспечения иммунопреципитации метилированной ДНК из раствора (непрямая иммунопреципитация). Для прямой или непрямой иммунопреципитации могут использоваться другие известные в науке способы для физического разделения компонентов в образце, такие как системы биотин/авидин или биотин/стрептавидин. Например, антитело к 5-метилцитозину может быть соединено с биотином и затем с авидином или стрептавидином, связанным с твердым субстратом, для обеспечения преципитации метилированной ДНК из раствора. Специалисту в данной области станет очевидно, что для использования в данном изобретении подходят и другие известные в науке варианты для вызова иммунопреципитации. Таким образом, в контексте данного изобретения термин "иммунопреципитация метилированной ДНК" или "MeDiP" обозначает любой и все способы, в которых антитело, распознающее различие между гиперметилированной ДНК и гипометилированной ДНК, контактирует с ДНК из образца крови матери с последующей преципитацией гиперметилированной ДНК (т.е. ДНК, которая специфически связывается с антителом) из раствора. В ходе физического отделения гиперметилированной ДНК от гипометилированной ДНК в образце крови матери ДНК в образце не подвергается химическому изменению или ферментативному расщеплению. В контексте данного изобретения термин "химическое изменение" обозначает реакцию ДНК с химическим веществом, не являющимся антителом, которое различает гиперметилированную ДНК и гипометилированную ДНК, таким как конверсия с помощью натрия бисульфита. Таким образом, в данном способе ДНК из образца крови матери не подвергается конверсии натрия бисульфитом или другой подобной (не вызванной антителом) химической реакции, которая разделяет гиперметилированную ДНК и гипометилированную ДНК. Более того, в контексте данного изобретения термин "ферментативное расщепление" обозначает реакцию ДНК с одной или несколькими чувствительными к метилированию рестриктазами для удаления гипометилированной ДНК. Таким образом, в данном способе ДНК из крови матери не подвергается обработке чувствительной к метилированию рестриктазой (-ами) для разделения гиперметилированной ДНК и гипометилированной ДНК. Следует отметить, однако, что фрагментация ДНК из образца периферической крови матери (которую обычно проводят перед отделением гиперметилированной ДНК от гипометилированной ДНК), которая обычно сопровождается воздействием ультразвуком, также может сопровождаться расщеплением ДНК рестриктазами. Однако такое общее расщепление ДНК в ходе фрагментации выполняется без использования чувствительной к метилированию рестриктазы(-з). Следовательно, требование того, чтобы ДНК из образца крови матери не была "ферментативно расщеплена", не обязательно должно включать использование нечувствительных к метилированию рестриктаз для достижения общей фрагментации(т.е. уменьшения размера) ДНК из образца крови матери. Амплификация ДНК В диагностическом способе, как правило, после физического отделения гиперметилированной ДНК от гипометилированной ДНК в образце крови матери, производят амплификацию гиперметилированной ДНК В контексте данного изобретения термин "амплификация" обозначает получение дополнительных копий ДНК для повышения числа копий ДНК, что обычно сопровождается использованием полимеразной цепной реакции (ПЦР). Преимущественный способ амплификации гиперметилированной ДНК заключается в опосредованной лигированием полимеразной цепной реакции (ОЛ-ПЦР), которая была описана в науке ранее (см. например, Ren, В. et al. (2000) Science 22:2306-2309; и Oberley, MJ. et al. (2004)Methods Enzymol. 376:315-334; содержание которых включено в данный документ посредством ссылки). В ходе ОЛ-ПЦР концы линкера лигируют с фрагментами образца ДНК посредством лигирования тупых концов, после чего в ПЦР используют олигонуклеотидные праймеры, распознающие нуклеотидные последовательности концов линкера, для амплификации фрагментов ДНК, к которым были присоединены линкеры. Таким образом, в преимущественном варианте воплощения данного диагностического способа после фрагментации ДНК из образца крови матери (например, на фрагменты примерно 300-800 bp) и перед физическим отделением гиперметилированной ДНК от гипометилированной ДНК (например, путем MeDiP), концы линкера вшивают во фрагментированную ДНК путем лигирования тупых концов. Затем, после физического отделения гиперметилированной ДНК от гипометилированной ДНК, восстановленная гиперметилированная ДНК подвергается ПЦР с использованием олигонуклеотидных праймеров, распознающих концы линкера, которые были лигированы в ДНК. Это приводит к амплификации образца гиперметилированной ДНК. Дифференциально метилированные участки (ДМУ) Диагностический способ по изобретению использует множество дифференциально метилированных участков (ДМУ). В контексте данного изобретения термин "дифференциально метилированный участок" или "ДМУ" обозначает участок в ДНК хромосомы, который имеет различное метилирование при сравнении ДНК матери и плода, и в преимущественном варианте воплощения изобретения выбранные-6 023565 ДМУ представлены гиперметилированными участками в ДНК плода и гипометилированными участками в ДНК матери. Таким образом, такие участки (выбранные ДМУ) имеют большую (т.е. высшую) степень метилирования в ДНК плода в сравнении с ДНК матери. В теории в данном диагностическом способе может использоваться любой ДМУ с представленными выше характеристиками в интересующей хромосоме. В частности, способы идентификации таких ДМУ описаны подробно ниже и в Примерах (см. Примеры 1 и 2). Более того, в настоящее время была идентифицирована большая панель (примерно 2000) ДМУ для каждой из хромосом 13, 18, 21, X и Y,подходящая для использования в диагностических способах. Такие ДМУ представлены в списках в Приложениях А-Е, которые содержат выбранные ДМУ для хромосом 21, 13, 18, X и Y, соответственно. В контексте данного изобретения термин "множество ДМУ" обозначает два или более ДМУ. В преимущественном варианте воплощения изобретения множество ДМУ выбирают из списков, представленных в Приложениях А-Е для хромосом 21, 13, 18, X или Y, соответственно. В различных вариантах воплощения изобретения уровни множества ДМУ определены для, по меньшей мере, двух, по меньшей мере, трех, по меньшей мере, четырех, по меньшей мере, пяти, по меньшей мере, шести, по меньшей мере, семи, по меньшей мере, восьми, по меньшей мере, девяти, по меньшей мере, десяти, по меньшей мере, одиннадцати или, по меньшей мере, двенадцати ДМУ. Опять-таки, более преимущественно множество ДМУ выбирают из списков, представленных в Приложениях А-Е. В преимущественном варианте воплощения изобретения множество ДМУ находится на хромосоме 21 для диагностики трисомии 21 хромосомы. В отдельном преимущественно варианте воплощения изобретения множество ДМУ на хромосоме 21 включает два или более, три или более, четыре или более,пять или более, шесть или более, семь или более, восемь или более, девять или более, десять или более,одиннадцать или более или двенадцать участков, выбранных из группы, состоящей из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 44161178-44161323 (SEQ ID NO: 34), пар оснований 44161239-44161371 (SEQ ID NO: 35), пар оснований 33320735-33320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 42355712-42355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 22403649-22403792 (SEQ ID NO: 40), пар оснований 29136735-29136844 (SEQ ID NO: 41), пар оснований 32268843-32268943 (SEQ ID NO: 42), пар оснований 44079235-44079322 (SEQ ID NO: 43), пар оснований 37841284-37841411 (SEQ ID NO: 44) и их комбинации. Относительно терминологии таких участков, термин "пары оснований 39279856-39280004" (и т.п.) относится к первому и последнему положению пары оснований на хромосоме 21 для дифференциально метилированного участка. Таким образом, для репрезентативного ДМУ в "парах оснований 3927985639280004" хромосомы 21 ДМУ включает участок на хромосоме 21, который начинается с пары оснований 39279856 и заканчивается парой оснований 39280004 (следовательно, данный участок включает участок с 148 парами оснований). Олигонуклеотидные праймеры для амплификации перечисленных выше ДМУ дополнительно описаны в Примере 3 и Таблице 7 и представлены SEQ ID NO: 1-24. Нуклеотидные последовательности перечисленных выше ДМУ представлены в Таблице 8 и SEQ ID NO: 33-44. Как это подробно описано в Примере 3, была отобрана подгруппа восьми из двенадцати ДМУ,представленных SEQ ID NO: 33-44, и идентифицирована в качестве подходящей для точной диагностики трисомии 21 хромосомы в образце крови матери во время беременности женщины, носящей плод с трисомией 21 хромосомы. Такие восемь преимущественных ДМУ на хромосоме 21 для использования в способах диагностики трисомии 21 хромосомы по изобретению состоят из пар оснований 3332073533320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 4235571242355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 2240364922403792 (SEQ ID NO: 40), пар оснований 32268843-32268943 (SEQ ID NO: 42), пар оснований 4407923544079322 (SEQ ID NO: 43) и пар оснований 37841284-37841411 (SEQ ID NO: 44). В различных других вариантах воплощения изобретения множество ДМУ на хромосоме выбирают из группы, состоящей из хромосомы 13, хромосомы 18, хромосомы X и хромосомы Y, для диагностики анеуплоидии любой из таких хромосом. Контрольные ДМУ также могут использоваться в диагностических способах по изобретению. Например, в диагностический способ в качестве контроля гиперметилирования могут быть включены другие ДМУ, которые, как известно, гиперметилированы. Преимущественные контрольные гиперметилированные участки включают CHR13(HYP1), праймеры для которых указаны в SEQ ID NO: 25 и 26, иCHR13(HYP2), праймеры для которых указаны в SEQ ID NO: 27 и 28. Более того, нуклеотидная последовательность амплифицированного продукта ПЦР для CHR13(HYP1) представлена в Таблице 8 и SEQ IDNO: 45. Кроме того или с другой стороны, в диагностический способ в качестве контроля гипометилирования могут быть включены другие ДМУ, которые, как известно, гипометилированы. Преимущественные контрольные гипометилированные участки включают CHR22(U1), праймеры для которых указаны вSEQ ID NO: 29 и 30, и CHR22(U2), праймеры для которых указаны в SEQ ID NO: 31 и 32. Более того,нуклеотидная последовательность амплифицированного продукта ПЦР для CHR22(U1) представлена в Таблице 8 и SEQ ID NO: 46. Контрольные ДМУ и их праймеры дополнительно рассматриваются в Примере 1 и описаны дополнительно в Таблицах 6, 7 и 8. Фактическую нуклеотидную последовательность любого ДМУ, представленного в Приложениях А-7 023565 Е, можно легко получить на основе представленной здесь информации наряду с другой информацией,известной в науке. Более специфически, каждый ДМУ, представленный в Приложениях А-Е, определяется по положению начальной и конечной пары оснований на отдельной хромосоме, такой как "пары оснований 39279856-39280004" на хромосоме 21, как это описано выше. Полные нуклеотидные последовательности каждой хромосомы человека 21, 13, 18, X и Y были определены и опубликованы в науке. Например, полные нуклеотидные последовательности для каждой из пяти таких хромосом получены изUCSC Genome Browser, Build 36 (http://genome.ucsc.edu). Более того, указанные положения начальной и конечной пар оснований для каждого отдельного ДМУ в каждой из пяти хромосом могут быть введены вGenome Browser для получения фактической нуклеотидной последовательности данного отрезка ДНК на хромосоме. Кроме того, затем могут быть разработаны олигонуклеотидные праймеры для определения и/или амплификации ДМУ с использованием стандартных способов молекулярной биологии, основанных на определении нуклеотидной последовательности ДМУ. В соответствии с этим, с учетом представленной здесь информации о положении начальной и конечной пар оснований для каждого ДМУ, представленного в Приложениях А-Е, а также нуклеотидных последовательностей для таких ДМУ, которые легко получить специалисту в данной области на основе информации о других известных в науке последовательностях в хромосоме, такой как информации, предоставляемой UCSC Genome Brower, полные нуклеотидные последовательности для каждого ДМУ, представленного в Приложениях А-Е, включены в данный документ посредством ссылки. Определение уровней ДМУ В данном диагностическом способе, после физического отделения гиперметилированной ДНК от гипометилированной ДНК и преимущественной амплификации восстановленной гиперметилированной ДНК, уровни множества дифференциально метилированных участков (ДМУ) определяют в образце гиперметилированной ДНК для получения значения гиперметилирования для образца гиперметилированной ДНК. В контексте данного изобретения термин "определение уровней множества ДМУ" обозначает определение количества, или превалирования, или числа копий ДМУ. Основой этому служит тот факт, что у плода с анеуплоидией плода отмечается большее количество (т.е. более высокое число копий) ДМУ в сравнении со здоровым плодом, что приводит к анеуплоидии. В преимущественном варианте воплощения изобретения, уровни множества ДМУ в образце гиперметилированной ДНК определяют количественной полимеразной цепной реакцией в режиме реального времени (КПЦР в режиме реального времени), способом, хорошо известным в науке. Репрезентативные и неограничивающие условия для КПЦР в режиме реального времени представлены в Примерах. В одном варианте воплощения изобретения уровни множества ДМУ также определены (например,путем КПЦР в режиме реального времени) в общем образце не подвергнутой обработке ДНК крови матери в качестве контроля эффективности ОЛ-ПЦР. В контексте данного изобретения термин "общий образец ДНК из крови матери, не подвергнутый обработке" обозначает образец ДНК, полученный из крови матери, который не был подвергнут обработке для физического отделения гиперметилированной ДНК от гипометилированной ДНК. Уровни множества дифференциально метилированных участков (ДМУ) определяют в образце гиперметилированной ДНК с получением "значения гиперметилирования" для образца гиперметилированной ДНК. В контексте данного изобретения термин "значение гиперметилирования" обозначает любое количественное представление уровня ДМУ в образце. Например, необработанные данные, полученные путем КПЦР в режиме реального времени, могут быть нормализированы в ходе различных контрольных и статистических анализов с получением одного или более числовых значений, которые представляют уровень множества ДМУ в образце гиперметилированной ДНК. Репрезентативные и неограничивающие примеры контрольных и статистических анализов, которые могут применяться к образцам, подробно описаны в Примере 3. Однако специалист в данной области оценит, что специфические статистические тесты, используемые для оценки данных в Примерах, являются репрезентативными статистическими способами, и что альтернативные статистические способы также могут быть применены в данному изобретению на основе руководства, представленного в Примерах и на фигурах. Сравнение со стандартизированным эталонным значением Как только будет определено значение гиперметилирования для гиперметилированной ДНК плода,присутствующей в периферической крови матери (также обозначается в данном тексте как "исследуемая ДНК"), полученное значение сопоставляют со стандартизированным эталонным значением гиперметилирования для такого же множества ДМУ, изучаемого в исследуемой ДНК, и диагноз анеуплоидии плода(или отсутствие такой анеуплоидии плода) выносят на основе данного сравнения. Как правило, значение гиперметилирования для образца гиперметилированной ДНК сравнивается со стандартизированным нормальным эталонным значением гиперметилирования для здорового плода, и диагноз анеуплоидии плода ставится, когда значение гиперметилирования для образца гиперметилированной ДНК выше, чем стандартизированное нормальное эталонное значение гиперметилирования для здорового плода. Таким образом, устанавливается "нормальное" значение гиперметилирования на основе данных, полученных для ДНК здорового плода, присутствующей в периферической крови матери (т.е.-8 023565 ДНК плода без анеуплоидии плода), и диагноз анеуплоидии плода для исследуемого образца может быть поставлен, если значение гиперметилирования для исследуемой ДНК выше, чем "нормальное" значение. Более преимущественно, стандартизированное нормальное эталонное значение гиперметилирования определяют с использованием образцов периферической крови матери, взятых у женщин, вынашивающих здоровый плод (т.е. плод без анеуплоидии плода) соответствующего возраста, в сравнении с "исследуемой ДНК" (например, если исследуемая ДНК получена у плода в возрасте 3 месяцев, тогда стандартизированное нормальное эталонное значение гиперметилирования определяют с использованием образцов периферической крови матери, взятых у женщин, вынашивающих здоровый плод в возрасте 3 месяцев). Например, стандартизированное нормальное эталонное значение гиперметилирования может быть установлено как "1", и тогда значение гиперметилирования для исследуемой ДНК выше "1" обозначает плод с патологией, в то время как значение гиперметилирования "1" или ниже обозначает здоровый плод. Кроме того или с другой стороны, значение гиперметилирования для образца гиперметилированной ДНК может быть сопоставлено со стандартизированным эталонным значением гиперметилирования для плода с анеуплоидией, и диагноз анеуплоидии плода может быть поставлен, когда значение гиперметилирования для образца исследуемой ДНК сопоставимо со стандартизированным эталонным значением гиперметилирования для плода с анеуплоидией. Таким образом, может быть установлено стандартное эталонное "аномальное" значение гиперметилирования или стандартное эталонное значение гиперметилирования для "анеуплоидии плода" на основе данных, полученных из ДНК плода с анеуплоидией, присутствующей в периферической крови матери (т.е. ДНК из плода с анеуплоидией), и диагноз анеуплоидии плода для исследуемого образца может быть поставлен, если значение гиперметилирования для исследуемой ДНК сопоставимо (подобно, находится в одинаковом диапазоне) с "аномальным" значением или значением "анеуплоидии плода". Для установления стандартизированных нормальных эталонных значений гиперметилирования для здорового плода, выбирают группу здоровых беременных женщин, вынашивающих здоровый плод. Эти женщины имеют одинаковый или похожий срок беременности, который подходит для скрининга состояний, таких как преэклампсия, хромосомальная анеуплоидия плода и преждевременные роды с использованием способов по данному изобретению. Подобным образом, стандартное эталонное значение может быть установлено с использованием образцов из группы здоровых небеременных женщин. Состояние здоровья выбранных беременных женщин и плода, который они носят, подтверждается хорошо известными, тщательно разработанными способами, включая, но не ограничиваясь, мониторинг давления крови женщин, запись начала родов и проведение генетического анализа плода с использованием ПВХ и амниоцентеза. Более того, выбранная группа здоровых беременных женщин, вынашивающих здоровый плод, должна иметь соответствующий размер для обеспечения статистической точности стандартизированного нормального эталонного значения гиперметилирования для здорового плода. Преимущественно,выбранная группа включает по меньшей мере 10 женщин. Для установления стандартизированного нормального эталонного значения гиперметилирования для здорового плода, образцы крови таких беременных женщин, вынашивающих здоровый плод, подвергают этапам диагностического способа (а) и (б), описанным выше, а именно физическому отделению гиперметилированной ДНК от гипометилированной ДНК (без химического изменения или ферментативного расщепления гиперметилированной ДНК или гипометилированной ДНК) с получением образца гиперметилированной ДНК, и затем определению уровней множества дифференциально метилированных участков (ДМУ) в образце гиперметилированной ДНК с получением значения гиперметилирования для образца гиперметилированной ДНК. Подобным образом, стандартизированные эталонные значения гиперметилирования для "аномального" плода могут быть установлены с использованием такого же самого способа, как описано выше для установления стандартизированных эталонных значений гиперметилирования для "здорового" плода, за исключением того, что образцы крови матери, используемые для установления "аномальных" эталонных значений, получают у беременных женщин, которые, как это было определено с использованием стандартных инвазивных диагностических способов, вынашивают плод с анеуплоидией. Примеры, в частности Пример 3, описывают подробно соответствующие статистические способы анализа, которые могут использоваться для анализа данных, полученных для образцов ДНК. Например,может использоваться статистический анализ с использованием U-критерия Манна-Уитни, критерия Фишера и пошагового анализа модели, как это подробно описано в Примерах. Однако специалист в данной области оценит, что специфические статистические тесты, используемые для оценки данных в Примерах, являются репрезентативными статистическими способами, и что альтернативные статистические способы также могут быть применены в данном изобретении на основе руководства, представленного в Примерах и на фигурах.II. Неинвазивный пренатальный диагностический тест трисомии 21 хромосомы. В другом аспекте изобретение описывает неинвазивный пренатальный диагностический тест трисомии 21 хромосомы (также обозначаемый здесь как "тест NID21"). Как это подробно описано в Примере 3, тест NID21 был разработан и прошел валидацию с использованием ДМУ, идентифицированных так,как это описано в Примерах 1 и 2. В разработке теста исследовали двенадцать ДМУ на хромосоме 21(как это описано в тексте данной заявки) с использованием образцов крови матерей, полученных у 40 женщин - 20 со здоровым плодом и 20 с аномальным плодом (т.е. у женщин, которые, как известно, вынашивают плод с трисомией 21 хромосомы). Статистический анализ результатов (подробно описано в Примере 3) выявил наиболее информативные участки хромосомы и показал, что тестирования только восьми специфических ДМУ (из всех двенадцати изначально исследуемых ДМУ) было достаточно для достижения 100% чувствительности и точности диагностики во всех здоровых и аномальных случаях. В соответствии с этим, в другом аспекте изобретение описывает способ пренатальной диагностики трисомии 21 хромосомы с использованием образца периферической крови матери, и такой способ включает: а) в образце материнской периферической крови физическое отделение гиперметилированной ДНК от гипометилированной ДНК без химического изменения или ферментативного расщепления гиперметилированной ДНК или гипометилированной ДНК для получения образца гиперметилированной ДНК; б) в образце гиперметилированной ДНК определение уровней множества дифференциально метилированных участков (ДМУ) на хромосоме 21 с получением значения гиперметилирования для образца гиперметилированной ДНК; при этом множество ДМУ на хромосоме 21 включает восемь или более участков, выбранных из группы, состоящей из пар оснований 39279856-39280004 (SEQ ID NO: 33), пар оснований 4416117844161323 (SEQ ID NO: 34), пар оснований 44161239-44161371 (SEQ ID NO: 35), пар оснований 3332073533320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 4235571242355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 2240364922403792 (SEQ ID NO: 40), пар оснований 29136735-29136844 (SEQ ID NO: 41), пар оснований 3226884332268943 (SEQ ID NO: 42), пар оснований 44079235-44079322 (SEQ ID NO: 43), пар оснований 3784128437841411 (SEQ ID NO: 44) и их комбинации, и при этом уровни множества ДМУ определяют количественной полимеразной цепной реакцией в режиме реального времени (КПЦР в режиме реального времени); в) сравнение значения гиперметилирования образца гиперметилированной ДНК со стандартизированным нормальным эталонным значением гиперметилирования для указанного множества ДМУ на хромосоме 21; и г) диагностика трисомии 21 хромосомы на основе указанного сравнения. В преимущественном варианте воплощения изобретения множество ДМУ на хромосоме 21 состоит из восьми участков с нуклеотидными последовательностями пар оснований 33320735-33320829 (SEQ ID NO: 36), пар оснований 42189557-42189683 (SEQ ID NO: 37), пар оснований 42355712-42355815 (SEQ ID NO: 38), пар оснований 42357215-42357341 (SEQ ID NO: 39), пар оснований 22403649-22403792 (SEQ ID NO: 40), пар оснований 32268843-32268943 (SEQ ID NO: 42), пар оснований 44079235-44079322 (SEQ ID NO: 43) и пар оснований 37841284-37841411 (SEQ ID NO: 44). Преимущественно гиперметилированная ДНК физически отделяется от гипометилированной ДНК путем иммунопреципитации метилированной ДНК (MeDiP) (подробно описано в Главе I выше). Преимущественно, после физического отделения гиперметилированной ДНК от гипометилированной ДНК,гиперметилированная ДНК амплифицируется таким способом, как полимеразная цепная реакция, опосредованная лигированием (ОЛ-ПЦР) (как это подробно описано в Главе I выше). Олигонуклеотидные праймеры для амплификации перечисленных выше ДМУ для хромосомы 21 описаны подробно в Примере 3 и Таблице 7 и представлены в SEQ ID NO: 1-24. Кроме того, в диагностическом способе также могут использоваться контрольные ДМУ. Например,в диагностический способ в качестве контроля гиперметилирования могут быть включены другие ДМУ,которые, как известно, гиперметилированы. Преимущественные контрольные гиперметилированные участки включают CHR13(HYP1), праймеры для которых указаны в SEQ ID NO: 25 и 26 (а нуклеотидные последовательности указаны в SEQ ID NO: 45), и CHR13(HYP2), праймеры для которых указаны в SEQID NO: 27 и 28. Кроме того или с другой стороны, в диагностический способ в качестве контроля гипометилирования могут быть включены другие ДМУ, которые, как известно, гипометилированы. Преимущественные контрольные гипометилированные участки включают CHR22(U1), праймеры для которых указаны в SEQ ID NO: 29 и 30 (а нуклеотидные последовательности указаны в SEQ ID NO: 46), иCHR22(U2), праймеры для которых указаны в SEQ ID NO: 31 и 32. Контрольные ДМУ и их праймеры дополнительно рассматриваются в Примере 1 и описаны дополнительно в Таблице 6. В одном варианте воплощения изобретения уровни множества ДМУ также определены в общем образце не подвергнутой обработке ДНК крови матери в качестве контроля эффективности ОЛ-ПЦР (как это описано в Главе I выше). Преимущественно значение гиперметилирования для образца гиперметилированной ДНК сравнивается со стандартизированным нормальным эталонным значением гиперметилирования для здорового плода, и диагноз трисомии 21 хромосомы ставится, когда значение гиперметилирования для образца гиперметилированной ДНК выше, чем стандартизированное нормальное эталонное значение гиперметилирования для здорового плода. Таким образом, устанавливается "нормальное" значение для множества ДМУ на хромосоме 21 на основе данных, полученных для ДНК здорового плода, присутствующей в пе- 10023565 риферической крови матери (т.е. ДНК плода без анеуплоидии плода) (как это подробно описано выше), и диагноз трисомии 21 хромосомы для исследуемого образца может быть поставлен, если значение гиперметилирования для исследуемой ДНК выше, чем "нормальное" значение. Например, "нормальное" значение гиперметилирования было рассчитано для двенадцати ДМУ, описанных в Примере 3, и, основываясь на таком факте, восемь преимущественных ДМУ была выбраны удовлетворительными для точной диагностики трисомии 21 хромосомы в исследуемом образце. Кроме того или с другой стороны, значение гиперметилирования для образца гиперметилированной ДНК может быть сопоставлено со стандартизированным эталонным значением гиперметилирования для плода с трисомией 21 хромосомы, и диагноз трисомии 21 хромосомы может быть поставлен, когда значение гиперметилирования для образца исследуемой ДНК сопоставимо со стандартизированным эталонным значением гиперметилирования для плода с трисомией 21 хромосомы. Таким образом, устанавливается "аномальное" значение гиперметилирования для множества ДМУ на хромосоме 21 на основе данных, полученных для ДНК плода с трисомией 21 хромосомы (т.е. ДНК плода с трисомией 21 хромосомы), и диагноз трисомии 21 хромосомы для исследуемого образца может быть поставлен, если значение гиперметилирования для исследуемой ДНК сопоставимо (подобно или находится в одном диапазоне) сIII. Способы идентификации дифференциально метилированных участков. В другом аспекте изобретение описывает способы идентификации дифференциально метилированных участков (ДМУ), которые гиперметилированы в ДНК плода и гипометилированы в ДНК матери, на основе физического отделения гиперметилированной ДНК от гипометилированной ДНК. Как это подробно описано в Примерах 1 и 2, описанные здесь способы были применены для большого числа хромосом для идентификации большой панели дифференциально метилированных участков на хромосомах 21,13, 18, X и Y, при этом в ДНК плода отмечалась большая степень метилирования (гиперметилирование) в сравнении с ДНК из периферической крови взрослой женщины. Более того, эти же самые способы могут применяться для идентификации дополнительных ДМУ на таких же хромосомах и для идентификации новых ДМУ на других хромосомах. В соответствии с этим в другом аспекте изобретение описывает способ идентификации дифференциально метилированного участка (ДМУ) на интересующей хромосоме, подходящий для использования в диагностике анеуплоидии плода, и такой способ включает: а) обеспечение:(i) образца ДНК из периферической крови здоровой взрослой женщины (образец ПК); и(ii) образца ДНК из здоровой плаценты (образец ПЛ); б) в каждом образце а) физическое отделение гиперметилированной ДНК от гипометилированной ДНК без химического изменения или ферментативного расщепления гипометилированной ДНК или гиперметилированной ДНК для получения:(i) сепарированного образца ПК; и (iii) сепарированного образца ПЛ; в) в каждом сепарированном образце б) определение уровней множества участков на интересующей хромосоме; и г) выбор гипометилированного участка в сепарированном образце ПК и гиперметилированного участка в сепарированном образце ПЛ для идентификации дифференциально метилированного участка(ДМУ) на интересующей хромосоме, который подходит для использования в описанных здесь диагностических способах. В одном варианте воплощения изобретения, если образец ПЛ включает два разных образца, представленных образцом ПЛ на первом триместре и образцом ПЛ на третьем триместре, то этап г) дополнительно включает выбор участка, имеющего эквивалентную степень метилирования в сепарированном образце ПЛ из первого триместра и сепарированном образце ПЛ из третьего триместра. В преимущественном варианте воплощения изобретения интересующая хромосома представлена хромосомой 21. В других различных вариантах воплощения изобретения интересующую хромосому выбирают из группы, состоящей из хромосомы 13, хромосомы 18, хромосомы X и хромосомы Y. Преимущественно, анеуплоидия представлена трисомией. В контексте данного изобретения термин "здоровая взрослая женщина" обозначает женщину, у которой нет хромосомной анеуплоидии. В контексте данного изобретения термин "нормальная плацентарная ДНК" обозначает ДНК из плаценты плода, у которого нет хромосомной анеуплоидии. В каждом образце гиперметилированную ДНК физически отделяют от гипометилированной ДНК без химического изменения или ферментативного расщепления гиперметилированной ДНК или гипометилированной ДНК, как это подробно описано в Главе I выше. Преимущественно, такое разделение сопровождается использованием иммунопреципитации метилированной ДНК (MeDiP), как это описано в Главе I, для получения "сепарированных" (разделенных) образцов. В контексте данного изобретения термины "сепарированный образец ПК" и "сепарированный образец ПЛ" обозначают часть оригинального образца периферической крови или оригинального образца плаценты, которые предположительно содержат гиперметилированную ДНК, от которой была отделена гипометилированная ДНК. Например,если MeDiP используют для разделения, "сепарированный" образец представляет собой фракцию образ- 11023565 ца ДНК периферической крови или плаценты, которая была иммунопреципитирована. Преимущественно после разделения ДНК сепарированного образца ПК и сепарированного образца ПЛ амплифицируется, преимущественно путем ОЛ-ПЦР. Таким образом, в данном варианте воплощения изобретения тупые концы линкера сшиваются с ДНК перед сепарацией, и затем после сепарации проводится ПЦР на сепарированных образцах ДНК с использованием олигонуклеотидных праймеров, которые распознают концы линкера, как это подробно описано в Главе I. Уровни множества участков на интересующей хромосоме определяют в сепарированных образцах,как это описано выше в Главе I, преимущественно путем КПЦР в режиме реального времени. Кроме того, как это описано выше, к необработанным данным могут применяться контрольные и статистические анализы для определения значения гиперметилирования для множества участков. Наконец, для идентификации специфического дифференциально метилированного участка (ДМУ) на интересующей хромосоме выбирают участок, который гипометилирован в сепарированном образце периферической кровиIV. Наборы по изобретению. В другом аспекте изобретение описывает наборы, которые могут использоваться в диагностических способах по изобретению. Такие наборы обычно включают по меньшей мере один реагент и инструкции по использованию набора. В преимущественном варианте воплощения изобретение описывает набор для пренатальной диагностики трисомии 21 хромосомы, и такой набор включает: а) одну или несколько композиций нуклеиновых кислот для определения уровней множества дифференциально метилированных участков (ДМУ) на хромосоме 21; и б) инструкции по использованию композиций нуклеиновых кислот для неинвазивной пренатальной диагностики трисомии 21 хромосомы. Множество ДМУ на хромосоме 21 может быть выбрано, например, из ДМУ хромосомы 21, представленных в списке Приложения А. Преимущественно, множество ДМУ на хромосоме 21 включает, по меньшей мере, один участок, выбранный из группы, состоящей из пар оснований 39279856-39280004(SEQ ID NO: 43), пар оснований 37841284-37841411 (SEQ ID NO: 44) и их комбинации. В других вариантах воплощения изобретения множество ДВУ хромосомы 21 включает два или более, три или более, четыре или более, пять или более, шесть или более, семь или более, восемь или более, девять или более,или десять или более указанных выше участков. В преимущественном варианте воплощения изобретения множество ДМУ на хромосоме 21 включает восемь участков с последовательностями SEQ ID NO: 36, 37,38, 39, 40, 42, 43 и 44, соответственно. Олигонуклеотидные праймеры для амплификации перечисленных выше двенадцати ДМУ дополнительно описаны в Примере 3 и Таблице 7 и представлены SEQ ID NO: 124. В соответствии с этим, в преимущественном варианте воплощения изобретения композиции нуклеиновых кислот из набора включают один или более олигонуклеотидных праймеров, выбранных из группы, состоящей из SEQ ID NO: 1-24 и их комбинаций. Кроме того, в набор может быть включен один или более олигонуклеотидных праймеров для амплификации контрольных гиперметилированных или гипометилированных участков. Например, преимущественные контрольные гиперметилированные участки включают CHR13(HYP1), праймеры для которых указаны в SEQ ID NO: 25 и 26 (а нуклеотидные последовательности указаны в SEQ ID NO: 45), и CHR13(HYP2), праймеры для которых указаны в SEQID NO: 27 и 28. Преимущественные контрольные гипометилированные участки включают CHR22(U1),праймеры для которых указаны в SEQ ID NO: 29 и 30 (а нуклеотидные последовательности указаны вSEQ ID NO: 46), и CHR22(U2), праймеры для которых указаны в SEQ ID NO: 31 и 32. Контрольные ДМУ и их праймеры дополнительно рассматриваются в Примере 1 и описаны дополнительно в Таблице 6. В другом варианте воплощения изобретения набор дополнительно включает средства для физического разделения гиперметилированной ДНК и гипометилированной ДНК без химического изменения или ферментативного расщепления гиперметилированной ДНК или гипометилированной ДНК в образце крови. Предпочтительные способы для физического отделения гиперметилированной ДНК от гипометилированной ДНК включают антитело, которое иммунопреципитирует метилированную ДНК, такое как антитело, которое специфически связывает 5-метилцитозин. В другом варианте воплощения изобретения набор дополнительно включает способы для амплификации гиперметилированной ДНК. Преимущественные способы амплификации гиперметилированной ДНК включают олигонуклеотидные линкеры и/или олигонуклеотидные праймеры для проведения опосредованной лигированием полимеразной цепной реакции (ОЛ-ПЦР).V. Композиции нуклеиновых кислот. В другом аспекте изобретение описывает композиции нуклеиновых кислот, которые могут исполь- 12023565 зоваться в способах и наборах по изобретению. Такие композиции нуклеиновых кислот эффективны для определения ДМУ. Например, в преимущественном варианте воплощения изобретения композиция нуклеиновых кислот включает один или более олигонуклеотидных праймера, которые эффективны для амплификации одного или более ДМУ по изобретению, таких как один или более ДМУ, выбранные из списка, представленного в Приложении А. Преимущественно, олигонуклеотидные праймеры "изолированы", т.е. они очищены или отделены от других праймеров, имеющих различную (нежелательную) специфичность. Более того, "изолированные" олигонуклеотидные праймеры очищены или отделены от других нуклеиновых кислот, которые могут изменять последовательность праймера естественным или природным образом, такой как ДНК хромосомы или другая естественная или природная форма нуклеиновой кислоты. В преимущественном варианте воплощения изобретение описывает композицию нуклеиновой кислоты, включающую один или более изолированных олигонуклеотидных праймера, для амплификации ДМУ ЕР 1-ЕР 12 (как это описано в Таблице 7), выбранных из группы, состоящей из и их комбинации. В другом варианте воплощения изобретение описывает композицию нуклеиновой кислоты, включающую один или более изолированных олигонуклеотидных праймеров, для амплификации контрольного гиперметилированного или гипометилированного участка (-ов), выбранных из группы, состоящей изVI. Примеры. Данное изобретение дополнительно описано следующими примерами, которые не должны рассматриваться в качестве ограничивающих. Содержание всех ссылок, приложений, записей Genbank, патентов и опубликованных заявок на патенты, процитированных по всему тексту данной заявки, включено в данный документ во всей своей полноте посредством ссылки. Пример 1. Идентификация сайтов дифференциального метилирования ДНК между ДНК плаценты и периферической крови. В данном примере дифференциально метилированные участки (ДМУ) идентифицировали для хромосом 13, 18, 21,X И Y С использованием системы, комбинирующей в себе MeDiP и матричный анализ мозаичной структуры олигонуклеотидов с высоким разрешением для высокорезультативной идентификации схем метилирования ДНК в хромосомах. Эксперименты, описанные в данном примере, также описаны в Papageorgiou, E.A. et al. (2009) Am.J. Pathol. 174:1609-1618. содержание которого, включая все дополнительные данные и материалы, включено сюда во всей своей полноте посредством ссылки. Материалы и способы(Оксон, Великобритания). Такие образцы, источником которых служит Biochain Institute (Hayward, CA),были подвергнуты одобрению с использованием утвержденных протоколов Внутреннего совета по этике(IRB). В целом в данном исследовании использовали пять образцов периферической крови здоровых женщин и пять образцов ДНК здоровой плаценты. Три образца ДНК плаценты были получены в течение первого триместра беременности, из которых один образец был получен в случае беременности плодом женского пола, и два были получены в случае беременности плодом мужского пола. Оставшиеся два образца ДНК плаценты были получены в течение третьего триместра беременности, из которых один образец был получен в случае беременности плодом женского пола, и один был получен в случае беременности плодом мужского пола. Анализ MeDiP в комбинации с амплификацией ОЛ-ПЦР Анализ MeDIP (Weber, M. et al. (2005) Nat.Genet. 37:853-862) проводился с последующей опосредуемой лигированием ПЦР (ОЛ-ПЦР), как это описано в Ren, В. et al. (2000) Science 22:2306-2309 и Oberley, M.J. et al. (2005) Methods Enzymol. 376:315334. но с дополнительными модификациями. Краткое описание; 2,5 мкг ДНК в общем объеме 100 мкл было изначально расщеплено ультразвуком на фрагменты примерно 300bp-1000bp по размеру с использованием ультразвукового прибора Virsonic300 (Virtis; Gardiner, NY). На фрагментированной ДНК были образованы тупые концы после комбинации с 1X NEB буфером 2 (New England BioLabs; Ipswich, UK),10X БСА (New England BioLabs; Ipswich, UK), 100 мМ dNTP смеси, Т 4 ДНК-полимеразой (3 Ед/мкл)(New England BioLabs; Ipswich, UK) и дистиллированной водой до финального объема 120 мкл. После 20 минут инкубации при 12 С, реакционная смесь была очищена с использованием DNA Clean and Concentrator-5 (Zymo Research Corp; Глазго, Шотландия) в соответствии с протоколом производителя. Однако финальный этап промывания проводили в 30 мкл буфера ЕВ с использованием набора для очистки QiAquick PCR (Qiagen; West Sussex, UK). Очищенный образец затем был смешан с 40 мкл комплементарных линкеров (50 мкМ) (SIGMA Genosys; Gillingham, UK), полученных в соответствии с описанием,представленным в Ren, В. et al. (2000) см. выше, Oberley, M.J. et al. (2004) см. выше, Т 4 ДНК-лигазой 10 Х буфером (Roche; Mannheim, Germany), 6 мкл Т 4 ДНК-лигазой (5 Ед/мкл) (Roche; Mannheim, Germany) и доведен дистиллированной водой до финального объема 101 мкл. Затем образец был инкубирован в течение ночи при 16 С для обеспечения лигирования адапторов. Очистка образца проводилась с использованием набора DNA Clean and Concentrator-5, как это описано выше. Элюированный образец затем был скомбинирован со смесью 100 мМ dNTP, 1x PCR золотого буфера (Roche; Mannheim, Germany), 1,5 мМMgCl2 (Roche; Mannheim, Germany) и 5 Ед AmpliTaq полимеразой. Затем образец был инкубирован при 70 С в течение 10 минут для связи выступающих концов ДНК и очищен с использованием DNA Cleanand Concentrator-5, как это описано выше. 50 нг ДНК было удалено и оставлено для использования в качестве исходного геномного контроля ДНК. Оставшийся образец лигированной ДНК (700 нг-1,2 мкг) был подвергнут MeDiP, как это описано ранее (Weber, M. et al. (2005) см. выше), после пропорционального уменьшения реакции соответствующим образом. Иммунопреципитированный образец ДНК затем был очищен DNA Clean and Concentrator-5 (с использованием связующего буфера 700 мкл) в соответствии с инструкциями производителя. Опосредованная лигированием ПЦР (ОЛ-ПЦР) проводилась с использованием 10 нг каждой исходной и ммунопреципитированной фракции ДНК с использованием набора Advantage-GC Genomic PCR(Clontech; Saint-Germain-en-Laye, France). Используемые термальные условия циклизации составили 95 С в течение 2 мин, 20 циклов при (94 С в течение 30 с и 68 С в течение 3 мин) и 68 С в течение 10 минут. После амплификации ПЦР, реакционная смесь была очищена с использованием набора QIAquickPCR (Qiagen; West Sussex, UK) и элюирована в 50 мкл дистиллированной воды, предварительно нагретой до 50 С. Гибридизация матрицы Фракции исходной и иммунопреципитированной ДНК из образца ДНК периферической крови здоровой женщины, образца ДНК плаценты на 3 триместре и образца ДНК плаценты на 1 триместре (оба плацентарных образца были получены при беременности плодом мужского пола) были отосланы в RocheNimbleGen Inc (Reykjsvik, Iceland) для гибридизации. Используемые матричные платформы были представлены матрицами мозаичной структуры олигонуклеотидов с высоким разрешением, специфичными относительно хромосом 13, 18, 21, X и Y с медианой межзондового расстояния 225 bp для хромосомы 13,170 bp для хромосомы 18, 70 bp для хромосомы 21, 340 bp для хромосомы X и 20 bp для хромосомы Y. Краткое описание: исходная ДНК для геномного контроля и иммунопреципитированная ДНК каждого образца были по-разному помечены флуоресцирующими красителями (Су 3, Су 5) и затем были согибридизированы на олигонуклеотидных матрицах. Необработанные данные могут быть получены в ArrayExpress (http://www.ebi.ac.uk/microarrayas/ae/) с кодом доступа Е-ТАВМ-507. Анализ данных олигонуклеотидных мозаичных матриц- 14023565 Для вычисления относительных различий в метилировании между плацентой и периферической кровью, из нормализированных значений отношения олигонуклеотидной матрицы log2, полученных из ДНК периферической крови (иммунопреципитированной в сравнении с исходной фракцией), были вычтены значения соотношения log2 (иммунопреципитированной в сравнении с исходной фракцией), полученные из плацентарной ДНК с использованием R-статистического расчета (http://www.r-project.org). Положительная разница представляет собой относительное гиперметилирование в плацентарной ДНК,отрицательная разница представляет собой относительно гипометилирование. Затем были созданы файлы General Feature Format (GFF) для вычтенных данных соотношений log2, и результаты были проанализированы с использованием инструмента SignalMap (система NimbleGen; Reykjsvik, Iceland) вместе с генами, островками CpG и содержимым CG для хромосом 13, 18, 21, X и Y. Данные по генам были загружены из геномного браузера Ensembl, (NCBI build36) (http://www.ensembl.org.), в то время как данные по островкам CpG и содержанию CG были загружены из геномного браузера UCSC, (NCBI build36)(http://genome.ucsc.edu.). Для автоматического выбора участков с повышенным и значительным дифференциальным метилированием между плацентарной кровью и плацентой, нами был использован динамический программный алгоритм Смита-Уотермана, адаптированный для Array-CGH (SW-ARRAY), который ранее использовался для запроса Copy Number Variation (CNV) (Price, T.S. et al. (2005) Nucleic Acids Res. 16:3455-3464). Такой алгоритм использовался для идентификации сегментов или "островков" последовательных олигонуклеотидов, указывая на повышенное метилирование или пониженное метилирование в плацентарной ДНК в сравнении с ДНК периферической крови. Каждые данные олигонуклеотидной матрицы были проанализированы с использованием плеча хромосомы. Пороговые значения (to) для SW-ARRAY между 0,2 и 1 были тестированы для идентификации оптимального значения для вызова сегментов с относительно высокими показателями или "островков" на основе идентификации, по меньшей мере, двух последовательных олигонуклеотидов, имеющих один и тот же статус метилирования и наивысший показатель среди показателей, полученных с использованием разных пороговых значений(to). Было проведено прямое сравнение между дифференциально метилированными участками, идентифицированными SW-ARRAY, и положениями генов, участков промоторов (которые были определены как участки до 2kb в направлении 5' конца каждого гена) и островками CpG. В то время как представленный выше анализ идентифицирует дифференциально метилированные участки генома, для использования MeDiP в качестве способа обогащения перед проведением количественных анализов числа копий (т.е. для идентификации трисомии 21 хромосомы, например) для неинвазивной пренатальной диагностики, важно, чтобы выбранные мишени у плода были гиперметилированы. Таким образом, MeDiP будет использоваться для обеднения гипометилированной ДНК матери, что позволит провести анализ гиперметилированной ДНК плода. Следовательно, нами были идентифицированы все участки, в которых показатели иммунопреципитирования в сравнении с исходными показателями были положительные для образцов плаценты и отрицательными для образцов периферической крови(гиперметилирование в плаценте). Для других систем анализов, которые изучались другими исследователями, гипометилирование ДНК в плаценте необходимо, поэтому мы также записали все участки, в которых соотношение иммунопреципитированных в сравнении с исходными данными для плаценты было отрицательно и положительно для образцов периферической крови. Для достижения этого, из нормализированных значений соотношения log2 олигонуклеотидной матрицы, полученных из ДНК периферической крови (иммунопреципитированная фракция в сравнении с исходной фракцией), были вычтены значения соотношения log2 (иммунопреципитированная фракция в сравнении с исходной фракцией), полученные из плацентарной ДНК только в случае различия знака соотношений. Из этого набора данных для дальнейшей валидации и анализа с использованием произвольного среза дифференциального соотношения более 1,0 (по меньшей мере, одного из последовательных образцов с показателем соотношения log21) было отобрано небольшое количество наиболее дифференциально метилированных участков в ДНК плаценты (8 участков на хромосоме 21 и один участок на хромосоме 18 плюс участок промотора SERPINB5). Подтверждение данных матрицы мозаичной структуры олигонуклеотидов количественной ПЦР в режиме реального времени Повышение метилирования выбранных участков на хромосоме 21 и хромосоме 18 было подтверждено количественной ПЦР в режиме реального времени. Для этой цели мы использовали пять образцов ДНК из периферической крови женщины и пять образцов ДНК из плаценты первого и третьего триместров беременности. Праймеры, специфические относительно интересующих участков, были разработаны с использованием веб-сайта primer3 (http://frodo.wi.mit.edu/.). Дизайн праймера был оптимизирован для получения продукта длиной 80-150 bp, как это рекомендуется для оптимального анализа кривой плавления с флуоресценцией в зеленом свете SYBR. Кроме того, значение Tm для всех праймеров было выбрано приблизительно около 60 С. Уникальность последовательностей праймера и последовательностей продукта ПЦР была подтверждена их картированием относительно эталонной последовательности человека с использованием Blat. Праймеры были приобретены у Sigma Genosys (Gillingham, UK). Каждая реакция количественной ПЦР проводилась при финальном объеме 25 мкл с 20 нг иммунопреципитированной ДНК или исходной геномной ДНК. Нами использовалась мастер-смесь SYBR GreenPCR (Eurogentec; Seraing, Belgium) и система для определения последовательностей ABI Prism 7900HT(Applied Biosystems). Вначале была выбрана оптимальная концентрация каждого праймера после тестирования серии разведений (150-900 нМ) с использованием нормальной геномной ДНК. Для каждой выбранной концентрации праймера были рассчитаны стандартные кривые для серийных разведений 1:2(200 нг до 3,125 нг), и, наконец, были проведены реакции с образцами в трех повторностях. Программа амплификации включала 2 мин при 50 С и 10 мин при 95 С, с последующими 40 циклами денатурации в течение 15 с при 95 С и нормализации/расширения в течение 1 мин при 60 С. После амплификации был проведен анализ кривой плавления путем нагревания реакционной смеси от 60 до 95 С при скорости 0,2 С/с. Реакции амплификации были тщательно проверены на предмет наличия неспецифических продуктов с использованием электрофореза в геле агарозы. Для оценки обогащения указанных последовательностей после MeDiP, нами были рассчитаны соотношения вычисленной циклической разницы (CT) между исследуемой ДНК (иммунопреципитированной или исходной ДНК) (CTtest) и неподвергнутой обработке нормальной геномной ДНК (CTcontrol) (CT = CTcontrol - CTtest) в иммунопреципитированной ДНК в сравнении с исходной геномной ДНК. Кроме того, для оценки повышения метилирования в плацентарных образцах в сравнении с периферической кровью, мы рассчитали соотношение плацентарной иммунопреципитированной ДНК к иммунопреципитированной ДНК периферической крови. Более того, для каждого прогона для тестирования возможных погрешностей MeDiP или амплификации ПЦР использовались контрольные участки с похожим статусом метилирования ДНК в образцах ДНК периферической крови и ДНК плаценты, как это показано нашими результатами олигонуклеотидной матрицы. Путем вычисления среднего значения всех значений соотношения различных исследуемых образцов или технических репликатов специфического участка (среднее IP/INPUT) были получены значения медианы вариабельности и медианы воспроизводимости повышения метилирования между отдельными экспериментами или между техническими реплицируемыми экспериментами, после чего каждое значение соотношения было поделено на среднее значение соотношения для получения показателя воспроизводимости каждого теста и выражено в процентах (IPi / INPUTi) / среднее (IPi / INPUTi, IPii / INPUTii, ) = Ri (DPi: иммунопреципитированная ДНК "i-того" образца, INPUTi: исходная ДНК "i-того" образца, RI = воспроизводимость "i-того" образца). Медиана воспроизводимости была получена путем расчета медианы всех различных значений воспроизводимости: медиана (Ri, Riis, ). Наконец, вариабельность рассчитывалась по следующей формуле: (1-Ri)100= Vi и медиана вариабельности: медиана (Vi, Vii, ). (Vi= вариабельность "i-того" образца). Результаты Выбор кандидатов дифференциально метилированного маркера Значения соотношений log2 нормализованной олигонуклеотидной матрицы, полученные для хромосом 13, 18, 21, Х и Y в образцах ДНК плаценты и периферической крови, изначально использовали для расчета разницы соотношения (относительного метилирования) между ДНК плаценты и периферической крови. Для идентификации дифференциально метилированных участков между ДНК плаценты и периферической крови мы использовалиSW-ARRAY. Оптимальный порог SW-ARRAY для идентификации участков был установлен как 0,9 для всех хромосом. Дифференциально метилированные участки, идентифицированные путем анализа SWARRAY для ДНК 1 и 3 триместра в сравнении с ДНК периферической крови представлены в Приложениях А-Е для хромосом 21, 13, 18, X и Y, соответственно. Нами было обнаружено, что количество участков, которые были идентифицированы как гиперметилированные, было примерно равным количеству участков, которые были гипометилированы во всех пяти исследуемых хромосомах, как это обобщено ниже в Таблице 1. Кроме того, общее количество дифференциально метилированных участков сопоставимо для образцов плаценты 1 и 3 триместра как это обобщено ниже в Таблице 1. Прямая корреляция идентифицированных локусов с положением генов, участками промотора и положением островков CpG представлена в Приложениях А-Е.- 16023565 Таблица 1. Дифференциально метилированные участки в образцах ДНК плаценты в сравнении с ДНК периферической крови для хромосом 13, 18, 21, X и Y. 17,5-43,6% идентифицированных участков были расположены в пределах генов, и их статус метилирования варьировал между хромосомами, а также между триместрами, как это обобщено ниже в Таблице 2. Для хромосом 13 и Y, большая часть дифференциально метилированных участков (расположенных в пределах генов) гипометилирована в образце плаценты 1 триместра, однако большинство становится гиперметилированной в образце плаценты 3 триместра. В хромосомах 21 и X большинство участков было гипометилировано в образцах плаценты 1 и 3 триместра, в то время как для хромосомы 18 было выявлено равное количество гиперметилированных и гипометилированных участков, как это обобщено ниже в Таблице 2. Таблица 2. Дифференциально метилированные участки, расположенные в пределах генов на хромосомах 13, 18, 21, X и Y. Кроме того, небольшой процент (1,6-11,0%) идентифицированных участков (в пределах и за пределами генов) перекрывался с островками CpG, как это обобщено ниже в Таблице 3 А. Большинство островков CpG, которые были идентифицированы как дифференциально метилированные, были расположены в пределах генов (включая соответствующие сайты промоторов, определенные как участки до 2kb в направлении 5' конца каждого гена), причем значительное количество таких участков (до 65,5%) располагалось специфическим образом внутри участков промоторов. Статус метилирования таких участков в каждой хромосоме и в образцах плаценты 1 и 3 триместров представлен ниже в Таблице 3 В. Таблица 3 В. Статус метилирования генных, негенных и промоторных островков CpG, расположенных в пределах дифференциально метилированных участков на хромосомах 13, 18, 21, X и Y Валидация результатов олигонуклеотидной матрицы с мозаичной структурой Для валидации матричного анализа, вначале мы проанализировали статус метилирования исследуемого ранее участка путем количественной ПЦР в режиме реального времени. Нами было обнаружено,что участок промотора SERPINB5 был гипометилирован в плаценте и гиперметилирован в периферической крови, что соответствует исследованию Chim, S.S. et.al (2005) Proc. Natl. Acad. Sci. USA 11:1475314758. Для дальнейшей валидации различий в метилированиии, идентифицированных матричным анализом с высоким разрешением, путем количественной ПЦР в режиме реального времени были проанализированы дополнительные 9 выбранных участков, включая участок промотора SERPINB5 (Chim, S.S. et al.(2005) см. выше). Для покрытия каждого участка были разработаны различные праймеры. Каждый праймер был тестирован перед использованием, и была определена оптимальная концентрация для каждого праймера. В качестве примера: результаты олигонуклеотидной матрицы для участка, расположенного на 21 хромосоме (см. фиг. 1), могут быть сопоставлены с результатами количественной ПЦР в режиме реального времени, как это показано на фиг. 2. Такие же образцы ДНК периферической крови и плаценты использовались для валидации ПЦР, что и образцы, используемые для гибридизаций олигонуклеотидной матрицы. Оба способа выявили увеличение метилирования в плаценте в сравнении с периферической- 18023565 кровью. Кроме того, олигонуклеотидная матрица и количественная ПЦР в режиме реального времени выявили более низкую степень повышения метилирования в образце ДНК плаценты 1 триместра в сравнении с образцом ДНК плаценты 3 триместра. Тем не менее, повышение метилирования, отмечаемое для плаценты 1 триместра, было выше в сравнении с повышением метилирования, отмеченным для образца ДНК периферической крови. Для всех 9 выбранных участков, а также участка промотора SERPINB5 нами было установлено соответствие дифференциального метилирования между матричным анализом и количественной ПЦР. Однако, как правило, относительное кратное повышение, полученное с использованием количественной ПЦР в режиме реального времени, было больше, чем повышение, полученное путем анализа олигонуклеотидной матрицы. Оценка эффективности MeDiP-ОЛПЦР Экспериментальная воспроизводимость процедуры MeDiP была оценена путем проведения технических повторностей для одного образца ДНК плаценты, при этом статус метилирования двух участков на хромосоме 21, которая подлежала оценке, устанавливался при помощи количественной ПЦР в режиме реального времени. Медиана воспроизводимости для участков была найдена как 98,62 и 95,84%. Оценка статуса метилирования выбранных участков у разных индивидуумов Для оценки нормальной вариабельности в статусе метилирования между индивидуумами, нами использовался анализ количественной ПЦР в режиме реального времени для 9 выбранных участков, т.е. 5 разных образцов периферической крови и 3 разных образцов плаценты 1 триместра. Статус метилирования для двух образцов плаценты 3 триместра исследовался только для 4 выбранных участков. Дальнейшее исследование межиндивидуальной изменчивости образцов плаценты 3 триместра не было необходимым в данном исследовании, в котором мы преимущественно тестировали образцы плаценты 1 триместра, т.к. такой срок наиболее подходящий для разработки неинвазивной пренатальной диагностики. Результаты для участка CHR21(B4) представлены на фиг. 3. Было выявлено, что все пять образцов периферической крови гипометилированы в сравнении с пятью образцами ДНК плаценты с изменчивостью повышения метилирования ДНК между индивидуумами, как это обобщено ниже в Таблице 4. Меньшая степень метилирования отмечалась в образцах плаценты 1 триместра в сравнении с образцами плаценты 3 триместра, что подтверждает результаты олигонуклеотидной матрицы (см. фиг. 3). Между разными плацентами одного и того же срока беременности отмечался более низкий уровень изменчивости. Таблица 4. Процентная изменчивость метилирования между различными образцами ткани одного происхождения (периферическая кровь (ПК) или плацента (ПЛ и срока беременности (плаценты),рассчитанная для множества участков, расположенных на хромосомах 18 и 21- 19023565 Большая часть исследуемых участков с использованием количественной ПЦР в режиме реального времени обладала изменчивостью в метилировании между образцами ДНК плаценты разного срока беременности (см. Таблицу 4). Однако такой эффект отмечался не для всех участков. Одним примером служит участок, расположенный на хромосоме 18 (CHR18 (А, представленный в Таблице 4. В данном участке отмечалось только незначительное отличие в уровне метилирования между образцами плаценты 1 и 3 триместра. Кроме того, нами были идентифицированы участки с противоположным статусом метилирования ДНК между образцами плаценты 1 и 3 триместра, а также для других участков с дифференциальным метилированием, примеры которых представлены в Таблице 5 ниже. Таблица 5. Примеры участков с противоположным статусом метилирования между образцами ДНК плаценты 1 и 3 триместра, или образцами с дифференциальным метилированием при специфическом гестационном возрасте в сравнении с ДНК периферической крови Дифференциально метилированные контрольные участки Для оценки эффективности MeDiP во всех экспериментах, нами было отобрано 2 гиперметилированных и 2 гипометилированных участка, которые имеют похожую степень дифференциального метилирования, установленную в ходе матричных экспериментов, для использования в качестве контроля. Праймеры, используемые для определения таких контрольных участков, обобщены ниже в Таблице 6, при этом праймеры CHR13(HYP1) и CHR13(HYP2) распознают гиперметилированные контрольные участки и праймеры CHR22(U1) и CHR22 (U2) распознают гипометилированные контрольные участки.- 20023565 Таблица 6. Контрольные праймеры, используемые для оценки эффективности MeDiP для различных образцов с применением количественной ПЦР в режиме реального времени. Статус метилирования таких участков оценивался путем количественной ПЦР в режиме реального времени на множестве образцов периферической крови и плаценты. Результаты для участка на хромосоме 13, который ожидаемо был гиперметилированным в образцах ДНК периферической крови и плаценты, представлены на фиг. 4. Такие же самые образцы ДНК использовали для тестирования всех контрольных праймеров. Медиана воспроизводимости повышения метилирования между индивидуумами была установлена как 98,48% для участка CHR13 (HYP1), 96,02% для участка CHR13 (HYP2), 98,71% для участка CHR22 (U1) и 99,75% для участка CHR22(U2). Пример 2. Дополнительное описание идентификации дифференциально метилированных участков(ДМУ). Данный пример предоставляет дополнительное описание способа идентификации дифференциально метилированных участков (ДМУ) из ряда ДМУ, преимущественно выбранных таким образом, чтобы они были гипометилированы в ДНК матери и гиперметилированы в ДНК плода. Схема способа представлена на Фигуре 5. Схема показывает применение способа MeDiP ОЛ-ПЦР и процедуры гибридизации олиго-матрицы относительно идентификации ДМУ для хромосом 13, 18, 21,Х и Y. Образцы Образцы ДНК от одного образца периферической крови здоровой женщины (ПК), одного образца здоровой плаценты первого триместра (PL1) и одного образца здоровой плаценты третьего триместра(Europe) Ltd (Oxon, UK) с первоначальным источником образцов Biochain Institute (Hayward, CA). Одобрение таких образцов было получено с использованием утвержденных протоколов Внутреннего совета по этике (IRB). Идентификация ДМУ Вначале к образцам ДНК, полученным из одного образца периферической крови здоровой женщины (ПК), одного образца здоровой плаценты первого триместра (PL1) и одного образца здоровой плаценты третьего триместра (PL3), была применена иммунопреципитация метилированной ДНК (MeDiP) и опосредованная лигированием ПЦР (ОЛ-ПЦР). Более подробно: анализ MeDIP (описанный дополнительно в Weber, M. et al. (2005) Nat. Genet. 37:853-862) проводился с последующей ОЛ-ПЦР (описано подробно в Ren, В. et al. (2000) Science 22:2306-2309 и Oberley, M.J. et al. (2004) Methods Enzymol. 376:315-334). Использовали способ, описанный ранее (Rakyan, K.V. et al. (2008) Genome Research 18: 1518-1529) с незначительными модификациями. На Фигуре 5 представлена схема процедуры. Фрагментация ДНК и присоединение линкера Краткое описание: 2,5 мкг образцов ДНК в общем объеме 100 мкл было изначально расщеплено ультразвуком на фрагменты примерно 300bp-1000bp по размеру с использованием ультразвукового прибора VirSonic Digital 600 (Virtis; Gardiner, NY) (фиг. 1). На фрагментированной ДНК из образцов были образованы тупые концы после комбинации с 1X- 21023565 мМ dNTP смеси, Т 4 ДНК-полимеразой (3 Ед/мкл) (New England BioLabs; Ipswich, UK) и дистиллированной водой до финального объема 120 мкл (фиг. 5). Спустя 20 мин инкубации при 12 С, реакционная смесь была очищена с использованием набора для очистки QIAquick PCR (Qiagen; West Sussex, UK) в соответствии с протоколом производителя. Однако финальный этап элюирования был проведен в 30 мкл буфера ЕВ. Очищенные образцы затем были смешаны с 40 мкл комплементарных линкеров (50 мкМ)Mannheim, Germany), 6 мкл Т 4 ДНК-лигазой (5 Ед/мкл) (Roche; Mannheim, Germany) и доведены дистиллированной водой до финального объема 101 мкл. Затем образцы были инкубированы в течение ночи при 16 С для обеспечения лигирования адапторов (фиг. 5). Очистка образца проводилась с использованием набора для очистки QIAquick PCR, как это описано выше. Элюированные образцы затем были скомбинированы со смесью 100 мМ dNTP, 1x PCR золотого буфера (Roche; Mannheim, Germany), 1,5 мМMgCl2 (Roche; Mannheim, Germany) и 5 Ед AmpliTaq полимеразой. Затем образцы были инкубированы при 70 С в течение 10 мин для связи выступающих концов ДНК и очищены с использованием набора для очистки QIAquick PCR, как это описано выше (фиг. 5). Выделение исходной ДНК и ДНК после MeDiP В целом было извлечено 50 нг лигированной ДНК из каждого образца и оставлено для использования в качестве исходной геномной контрольной ДНК (фиг. 5). Оставшиеся образцы лигированной ДНК(800 нг-1,2 мкг) были подвергнуты MeDiP, как это описано ранее, после пропорционального уменьшения реакции соответствующим образом (Weber, M. et al. (2005) см. выше). Образцы иммунопреципитированной ДНК затем были очищены с использование набора для очистки QIAquick PCR в соответствии с инструкциями производителя (фиг. 5). ОЛ-ПЦР Опосредованная лигированием амплификация ПЦР (ОЛ-ПЦР) проводилась отдельным образом с использованием 10 нг каждой исходной и ИП фракции ДНК с использованием набора Advantage GC Genomic LA Polymerase Mix (Clontech; Saint-Germain-en-Laye, France) (фиг. 5). Термальные циклические условия составили 94 С в течение 1 мин, 20 циклов при (94 С в течение 30 с, 60 С в течение 30 с и 72 С в течение 2 мин) и 72 С в течение 5 мин. После амплификации ПЦР, реакционная смесь была очищена с использованием набора QIAquick PCR и элюирована в 50 мкл дистиллированной воды, предварительно нагретой до 50 С (фиг. 5). Когибридизация с олиго-матрицами, специфичными для хромосом 13, 18, 21, X, Y, и анализ данных Фрагменты исходной и ИП ДНК каждого образца были когибридизированы на олиго-матрицах,специфичных для хромосом 13, 18, 21, X и Y. Значения соотношения ПК были вычтены из значений соотношения PL1 и от значений соотношения PL3 для выявления ДМУ в интересующих хромосомах (хромосомы 13, 18, 21, X и Y) в образцах плаценты первого и третьего триместров. Кроме того, был проведен анализ данных с использованием алгоритма динамического программирования, адаптированного дляArray-CGH (SW-ARRAY) для автоматического выбора участков со значительным дифференциальным метилированием в плацентарной ДНК в сравнении с ДНК периферической крови (фиг. 5). Для анализа и валидации идентифицированных выше ДМУ было проведено несколько экспериментов. Такие эксперименты включают подтверждение статуса метилирования ряда таких ДМУ путем количественной ПЦР в режиме реального времени для множества образцов ДНК. Сравнение результатов,полученных для образцов плаценты первого и третьего триместров, проводилось для идентификации любого возможного дифференциального метилирования между плацентами разного срока беременности. Кроме того, была проведена оценка изменчивости и воспроизводимости уровней метилирования между индивидуумами и между техническими репликантами (как в Примере 1). Пример 3. Разработка и валидация неинвазивного диагностического теста для трисомии 21 хромосомы. В данном примере для разработки и валидации неинвазивного диагностического теста для трисомии 21 хромосомы (указанного здесь как NID21), использовали ДМУ, идентифицированные в соответствии со способом, описанным в Примерах 1 и 2. Схема способа представлена на Фигуре 6. Схема отображает процедуру эксперимента с использованием 20 нормальных случаев и 20 случаев трисомии 21 хромосомы для разработки и валидации теста NID21. Выбор ДМУ для разработки неинвазивного диагностического теста для трисомии 21 хромосомы Тщательное исследование идентифицированных ДМУ между образцами ДНК периферической крови женщины и ДНК плаценты (Примеры 1 и 2) привели к выбору 12 участков, расположенных на хромосоме 21. Вместе с выбранными участками для разработки теста NID21, в качестве гиперметилированного и гипометилированного контроля использовали два дополнительных участка, расположенных на хромосомах 13 и 22, соответственно. Критерий выбора 12 участков основывался на статусе метилирования участков в образцах ДНК периферической крови и плаценты. Более специфически, выбранные участки должны были иметь гиперметилированный статус в плаценте и гипометилированный статус в периферической крови. Во-вторых, выбранные участки должны были иметь общий статус метилирования для образцов плаценты первого и третьего триместров для обеспечения специфичности ткани относительно- 22023565 статуса метилирования. Наконец, уровень дифференциального метилирования, отмечаемый для данных участков, должен быть выше значения "1" по логарифмической шкале для обеспечения достаточной дискриминации статуса метилирования при тестировании незначительных количеств образцов гиперметилированной ДНК, присутствующей на основном фоне гипометилированной ДНК. Основываясь на представленной выше оценке, выбранные ДМУ, или их часть, могут использоваться в качестве ДМУ для теста NID21. Однако, оценка, подобная той, которая здесь описана, может идентифицировать другие ДМУ из списков, представленных в Приложениях А-Е для теста NID21. Более того,оценка и выбор ДМУ может использоваться в подобном или другом способе для НИПД анеуплоидии хромосом 13, 18, X и Y. Образцы В целях разработки теста NID21, мы использовали 20 образцов периферической крови матерей, носящих здоровый плод, и 20 образцов периферической крови матерей, носящих плод с синдромом Дауна(трисомией 21 хромосомы) (плод Т 21). Все образцы ДНК периферической крови матери были получены для первого триместра беременности в "Институте нейрологии и генетики Кипра" посредством сотрудничества с Центрами на Кипре и в Греции. Формы согласия, утвержденные Национальным комитетом Кипра по биоэтике, были получены для каждого участвующего образца. Разработка и валидация теста NID21 Подготовка к MeDiP и ОЛ-ПЦР ДНК была экстрагирована из всех образцов с использованием набора QIAamp DNA blood Midi Kit(Qiagen; West Sussex, UK). ДНК, изолированная из 20 образцов периферической крови матерей, носящих здоровый плод, и 20 образцов периферической крови матерей, носящих плод Т 21, была подвергнута обработке для фрагментации, присоединения линкера, проведения MeDiP и ОЛ-ПЦР с образованием фрагментов исходной ДНК и ИП ДНК, как это показано на фиг. 6. Представленные выше способы описаны в Примерах 1 и 2. кПЦР в режиме реального времени и оценка данных Для всех 40 образцов периферической материнской крови для всех фрагментов исходной ДНК и ИП ДНК для 12 предварительно выбранных ДМУ на хромосоме 21 и двух контрольных участков на хромосомах 13 и 22 (фиг. 6) была проведена кПЦР в режиме реального времени. Вначале праймеры, специфические относительно интересующих участков, были разработаны с использованием веб-сайта primer3(http://frodo.wi.mit.edu/.). Праймеры для использования с кПЦР в режиме реального времени представлены ниже в Таблице 7. Таблица 7. Праймеры, разработанные для участков, тестируемых на хромосоме 21, и контрольных участков на хромосомах 13 и 22- 23023565 Дизайн праймера был оптимизирован для получения продукта длиной 80-150 bp, как это рекомендуется для оптимального анализа кривой плавления с флуоресценцией в зеленом свете SYBR. Кроме того, значение Tm для всех праймеров было выбрано приблизительно около 60 С. Нуклеотидные последовательности двенадцати ДМУ (ЕР 1-ЕР 12), амплифицированных праймерами, указанными в Таблице 7,представлены ниже в Таблице 8 вместе с нуклеотидными последовательностями двух контрольных участков (HYP113 И U122). Таблица 8. Нуклеотидные последовательности участков, тестируемых на хромосоме 21, и контрольных участков на хромосомах 13 и 22 Уникальность последовательностей праймера и последовательностей продукта ПЦР была подтверждена их картированием относительно эталонной последовательности человека с использованием Blat. Праймеры были приобретены у Sigma Genosys (Gillingham, UK). Каждая реакция кПЦР в режиме реального времени проводилась при финальном объеме 25 мкл с 20 нг исходной или ИП ДНК. Нами использовалась мастер-смесь SYBR Green PCR (Eurogentec; Seraing, Belgium) и система для определения последовательностей ABI Prism 7900 НТ (Applied Biosystems). Вначале была выбрана оптимальная концентрация каждого праймера после тестирования серии разведений (150-900 нМ) с использованием нормальной геномной ДНК (Таблица 7). Для каждой выбранной концентрации праймера были рассчитаны стандартные кривые для серийных разведений 1:2 (200 нг до 3,125 нг), и, наконец, были проведены реакции с образцами в трех повторах. Программа амплификации включала 2 мин при 50 С и 10 мин при 95 С, с по- 24023565 следующими 40 циклами денатурации в течение 15 с при 95 С и нормализации/расширения в течение 1 мин при 60 С. После амплификации был проведен анализ кривой плавления путем нагревания реакционной смеси от 60 до 95 С при скорости 0,2 С/с кПЦР в режиме реального времени, как это описано выше, позволила получить значения CT для всех исходных и ИП фрагментов (фиг. 6). Полученные значения CT были подвергнуты серии этапов нормализации. Вначале среднее значениеCT из трех повторностей реакций кПЦР в режиме реального времени было рассчитано для каждого исходного образца и образца ИП. Таким образом, эффективность ПЦР реакций, проводимых в ходе MeDiP и ОЛ-ПЦР, была нормализирована с использованием формулы: где РВ=периферическая кровь и Т 21= трисомия 21 хромосомы. Представленная выше нормализация проводилась для каждого образца и для каждого выбранного ДМУ и контроля отдельным образом. Затем для дополнительной нормализации использовали эффективность праймера для кПЦР в режиме реального времени с использованием формулы: Нормализованные значения, полученные для контрольных праймеров, соответствуют показателю метилирования каждого контрольного участка в каждом "исследуемом образце". После нормализации реакций ПЦР и нормализации на основе эффективности праймера кПЦР в реальном времени, для каждого выбранного ДМУ по-отдельности с использованием следующей формулы была рассчитана медиана значения NormCTPB-Norrnal: Расчеты значения Медиана Norm CTPB-Norrnal необходимы для определения значения соотношения каждого образца в каждом исследуемом ДМУ. Значение соотношения определяется по формуле: Значения соотношений, полученные для нормальных случаев, были сопоставлены со значениями,полученными для случаев трисомии 21 хромосомы для каждого исследуемого ДМУ, для оценки степени дискриминации случаев нормы от случаев патологии. Однако статистический анализ представленных данных был необходим для определения точности статистической значимости для различения случаев нормы от случаев патологии. Статистический анализ Статистическая значимость каждого из 12 ДМУ при дискриминации случаев нормы от трисомии 21 хромосомы оценивалась с использованием U-критерия Манна-Уитни. Этот критерий является непараметрическим критерием для оценки того, имеют ли два независимых набора наблюдений (в нашем случае это набор с образцами нормы и набор с образцами трисомии 21 хромосомы) одно и то же распределение. Значение р сообщалось для каждого из 12 ДМУ. Показатель р 0,05 рассматривался значимым. Кроме оценки данных представленных выше результатов, значения соотношения случаев нормы и трисомии 21 хромосомы для всех исследуемых ДМУ использовались для повторной оценки статистической значимости дискриминации случаев нормы от случаев трисомии 21 хромосомы. Вначале была оценена значимость каждого из 12 участков в установке различий между случаями нормы и трисомии 21 хромосомы. Во-первых, для каждого ДМУ отдельным образом были рассчитаны значения медианы для всех случаев трисомии 21 хромосомы и всех случаев нормы. Использовалась следующая формула: Затем значения медианы соотношения для случаев трисомии 21 хромосомы были поделены на медиану значений соотношения случаев нормы, как это указано в следующей формуле:- 25023565 Медиана значений соотношения, полученная для ДМУ, была ранжирована в убывающем порядке,указывая на степень разделения между случаями нормы и трисомии 21 хромосомы. Затем мы использовали (непараметрический) критерий для значений медианы. Этот критерий представлен критерием хиквадрата для определения наличия у двух групп одинаковой медианы. Значение р сообщалось для каждого из 12 ДМУ. Показатель р 0,05 рассматривался значимым Кроме того, использовался многопараметрический критерий Фишера. Этот критерий комбинировал значения р различных ДМУ и давал общую оценку статистической значимости дискриминации случаев нормы от случаев трисомии 21 хромосомы. Финальная часть нашего анализа должна была корректно интерпретировать результаты нового случая и точно классифицировать случай в качестве нормы или трисомии 21 хромосомы В целях достижения этого, мы использовали т.н. "дискриминантный анализ" (ДА), который проводился с использованием программы вычислений SPSS v16.0. ДА является способом, основанным на построении прогностической модели группы участников на основе наблюдаемых характеристик для каждого случая. Другими словами, в ДА можно прогнозировать состав группы на основе набора (как правило, непрерывных) прогностических переменных. ДА генерирует функции из ряда случаев, для которых известен состав группы; функции затем могут применяться для новых случаев с измерениями прогностических переменных, но без известного состава группы. "Линейное дискриминантное уравнение" построено таким образом, что две группы отличаются настолько, насколько это возможно на D. "Линейное дискриминантное уравнение" представлено следующим: Более подробно: "а" и "b" являются значениями, которые были рассчитаны с использованием набора известных образцов и используются для построения уравнения. Каждое значение "b" специфическое для одного ДМУ и, следовательно, в каждом новом случае классификация значения "X" для специфического ДМУ умножается на значение "b", которое было рассчитано ранее для такого же ДМУ. По причине равного представления случаев нормы и трисомии 21 хромосомы в нашем исследовании (20 случаев нормы и 20 случаев трисомии 21 хромосомы), уравнение было построено таким образом, что если D приобретает положительное значение (D 0), новый случай считается патологией (трисомия 21 хромосомы), в то время как отрицательное значение (D 0) указывает на то, что новый случай является нормой. Дополнительный способ классификации случаев в виде нормы или трисомии 21 хромосомы заключается в использовании т.н. "коэффициентов функции классификации Фишера". Для каждого случая функция D вычисляется для каждой группы и образец классифицируют в группу, для которой значение соответствующей функции D максимальное. В нашем исследовании было создано две группы (одна для случаев нормы и одна для случаев трисомии 21 хромосомы), и, следовательно, было построено две функции наподобие (1). D1 с коэффициентами для Группы 1 (норма) и D2 с коэффициентами для Группы 2 (трисомия 21 хромосомы). Для классификации нового случая, оцениваются две функции (Х 1, ,Хр). Если D1D2, субъект классифицируют в Группу 1 (норма), в противном случае - в Группу 2 (трисомия 21 хромосомы). В целях нашего исследования, среди различных типов ДА мы использовали пошаговый дискриминирующий анализ, в котором статистические критерии определяют порядок введения. Здесь мы сконцентрировались на пошаговом ДА, использующим наиболее экономичный способ выбора, а именно лямбдакритерий Уилкса. Как и для пошаговой множественной регрессии, можно устанавливать критерии для ввода и удаления (F критерии или р критерии). Способность дискриминантного анализа выводить дискриминантные функции для получения точных классификаций, повышается, когда удовлетворяются предположения нормальности, линейности, однородности переменной (гомоскедастичности), независимости предикторов, отсутствия мультиколлинеарности и влияния впадающих значений. Несмотря на то, что в нашем исследовании мы использовали специфические статистические критерии для оценки наших данных, как это описано выше, для получения таких же самых выводов могут использоваться альтернативные статистические способы. В нашем исследовании использованием 12 ДМУ, имеющих нуклеотидные последовательности,представленные в Таблице 8 (ЕР 1-ЕР 12), было определено, что для точной идентификации трисомии 21 хромосомы в образцах крови матери во время беременности женщин, носящих плод с трисомией 21 хромосомы, достаточно подгруппы из всего лишь восьми таких ДМУ, а именноЕР 4 (SEQ ID NO: 36), ЕР 5(SEQ ID NO: 37), ЕР 6 (SEQ ID NO: 38), ЕР 7 (SEQ ID NO: 39), ЕР 8 (SEQ ID NO: 40), ЕР 10 (SEQ ID NO: 42), ЕР 11 (SEQ ID NO: 43) и ЕР 12 (SEQ ID NO: 44). Пример 4. Дополнительное описание и валидация неинвазивного диагностического теста для трисомии 21 хромосомы. В данном примере подробно описан неинвазивный диагностический тест на трисомию 21 хромосомы, указанный в Примере 3. Кроме того, применение такого способа анализа специфического соотноше- 26023565 ния метилирования у плода обеспечивает 100% точность с правильной диагностикой 46 случаев нормальной беременности и 34 случаев беременности с трисомией 21 хромосомы, что обеспечивает валидацию такого диагностического теста. Образцы, используемые в данном примере В целях используемой диагностической стратегии, нами изначально использовались 40 образцов периферической крови матерей с известным кариотипом (20 для случаев нормальной беременности и 20 для случаев беременности с трисомией 21 хромосомы). Такие 40 образцов периферической крови матерей были получены при сроке переменности 11,1-14,4 недель. Кроме того, слепым образом использовались 40 дополнительных образцов для идентификации их кариотипа, при этом результаты кариотипа были скрыты от исследователя, проводившего тест. Используемые 80 образцов были получены в ходе первого триместра беременности в "Институте нейрологии и генетики Кипра" посредством сотрудничества с гинекологическими центрами на Кипре и госпиталем "Митера" в Афинах, Греция. Образцы были собраны в пробирки EDTA и хранились в течение 6 часов после сбора при -80 С до дальнейшего использования. Формы согласия, утвержденные Национальным комитет Кипра по биоэтике, были получены у всех участников. 40 образцов были группированы в группы по шесть членов (три случаев нормы и три случая трисомии 21 хромосомы). Значение медианы образцов трех случаев нормы, участвующих в одном эксперименте, было сопоставлено только с образцами трисомии 21 хромосомы специфического эксперимента. Выбор ДМУ для неинвазивного пренатального определения трисомии 21 хромосомы Тщательное исследование изученных нами ранее ДМУ, описанных в Примере 1, привело к выбору 12 ДМУ, расположенных на хромосоме 21, для дальнейшего исследования. 12 ДМУ были выбраны на основе трех критериев. Во-первых, они должны доказывать гиперметилированный статус в плаценте и гипометилированный статус в периферической крови для достижения повышения метилирования специфической для плода ДНК, и, следовательно, повышать количество ffДНК в крови матери. Во-вторых,выбранные участки должны иметь общий статус метилирования для образцов плаценты первого и третьего триместров для обеспечения специфичности ткани относительно статуса метилирования. Наконец,степень дифференциального метилирования, отмечаемая для таких ДМУ, должна быть выше значения"1" по логарифмической шкале в, по меньшей мере, одной олигонуклеотидной пробе, включенной в участок. Вместе с 12 ДМУ, в качестве контроля гиперметилирования и гипометилирования использовались два дополнительных участка, расположенных на хромосомах 13 (HYP113) И 22 (U122), соответственно,как это описано в Примере 3. Разработка и валидация способа с применением соотношения метилирования ДНК, специфического для плода Применение MeDiP и КПЦР в режиме реального времени ДНК была экстрагирована из 1 мл каждого образца с использованием набора QIAamp DNA bloodMidi Kit (Qiagen; West Sussex, UK). Изолированная ДНК из 80 образцов была подвергнута иммунопреципитации метилированных участков, как это описано в Примерах 1-3. Краткое описание: 2,5 мкг ДНК было подвергнуто воздействию ультразвука для разбиения на фрагменты размером примерно 300bp-1000bp. На фрагментированной ДНК были образованы слепые концы, к которым были присоединены линкеры. В целом было извлечено 50 нг лигированной ДНК из каждого образца и оставлено для использования в качестве исходной геномной контрольной ДНК. Оставшиеся образцы лигированной ДНК (800 нг-1,2 мкг) были подвергнуты MeDiP, как это описано в Примерах 1-3. Наконец, были проведены опосредованные лигированием ПЦР (ОЛ-ПЦР) с использованием 10 нг каждой фракции исходной и ИП ДНК для повышения количества ДНК. Затем ко всем исходным фрагментам ДНК и ИП фрагментам для отобранных ДМУ на хромосоме 21 и двум контрольным участкам была применена КПЦР в режиме реального времени. Затем проводилась процедура для дизайна праймеров, оптимизации и условий циклизации, как это описано в Примерах 1-3. Праймеры, используемые для тестируемых участков на хромосоме 21 и контрольных участков на хромосомах 13 и 22, представлены в Таблице 7 Примера 3. Способ статистического анализа Для оценки степени дискриминации 12 отобранных ДМУ использовали 40 образцов с известным кариотипом. Для достижения этого, значения соотношения специфического метилирования плода 20 нормальных случаев были сопоставлены со значениями соотношения 20 случаев трисомии 21 хромосомы для каждого из 12 ДМУ. Для нормализации необработанных данных, с помощью кПЦР в режиме реального времени, как это описано выше, были получены значения CT для всех фрагментов исходной и ИП ДНК. Полученные значения CT были подвергнуты серии этапов нормализации. Вначале среднее значение CT из трех повторов реакций кПЦР в режиме реального времени было рассчитано для каждого исходного образца и образца ИП. Таким образом, эффективность ПЦР реакций, проводимых в ходе MeDiP и ОЛ-ПЦР, была нормализирована с использованием формулы:IP= иммунопреципитированный. Представленная выше нормализация проводилась для каждого образца и для каждого выбранного ДМУ и контроля отдельным образом. Затем для дополнительной нормализации использовали эффективность праймера для кПЦР в режиме реального времени с использованием формулы:Norm= нормализованный. Нормализованные значения, полученные для контрольных праймеров, соответствуют показателю метилирования каждого контрольного участка в каждом исследуемом образце. После нормализации реакций ПЦР и нормализации на основе эффективности праймера кПЦР в реальном времени, для каждого выбранного ДМУ по-отдельности с использованием следующей формулы была рассчитана медиана значения NormCTPB Norrnal: Расчеты значения Медиана NormCTPB Norrnal необходимы для определения значения соотношения специфического для плода метилирования для каждого образца в каждом исследуемом ДМУ. Значение соотношения определяется по формуле: В теории значение соотношения случаев нормы должны быть 1, а для случаев трисомии 21 хромосомы 1,5. Однако отмечаемые соотношения обычно имеют меньшие значения для нормальных случаев и большие значения для случаев трисомии 21 хромосомы в результате межиндивидуальной изменчивости уровней метилирования (как это описано в Примере 1), а также по причине присутствия фоновой ДНК матери. Дополнительный статистический анализ был важен для точного определения статистической значимости каждого ДМУ. Статистическая оценка проводилась с использованием U-критерия МаннаУитни. Данный критерий является непараметрическим критерием для оценки того, имеют ли два независимых набора наблюдений общее распределение. Финальная часть нашего анализа должна была корректно интерпретировать результаты случая и точно классифицировать случай в качестве нормы или трисомии 21 хромосомы. Для достижения этого,мы использовали т.н. "дискриминантами анализ" (ДА). ДА генерирует функции из ряда случаев, для которых известен состав группы; функции затем могут применяться для новых случаев с измерениями прогностических переменных, но без известного состава группы. "Линейное дискриминантное уравнение" построено таким образом, что две группы отличаются настолько, насколько это возможно на функции ДА. В целях нашего исследования, среди различных типов ДА мы использовали пошаговый дискриминирующий анализ, в котором статистические критерии определяют порядок введения. Здесь мы сконцентрировались на пошаговом ДА, использующим наиболее экономичный способ выбора, а именно лямбдакритерий Уилкса. Для включения ДМУ в финальную модель, должен быть выполнен целый ряд критериев (критериев F). Критерии устанавливаются путем расчета максимальной значимости F для ДМУ для установления включения ДМУ в финальную модель и минимальной значимости F для ДМУ для исключения из финальной модели. Как только было создано прогностическое уравнение, следовало провести дополнительную валидацию наших результатов путем проведения слепого исследования. Мы использовали 40 слепых образцов и тестировали повышение метилирования 8 выбранных ДМУ. Значения соотношения, полученные для каждого образца, использовались для прогностического уравнения и определяли их статус (норма или трисомия 21 хромосомы). Оценка эффективности MeDiP Для оценки эффективности способа MeDiP, мы использовали известный гиперметилированный(HYP113) И гипометилированный (U122) контрольный участок с использованием 80 описанных выше образцов периферической крови матери. Образцы Р 1-Р 40 являются образцами с известным кариотипом для создания прогностического уравнения, в то время как образцы Р 41-Р 80 представлены образцами, участвующими в слепом исследовании. Образцы Р 1-20 и Р 41-Р 66 являются образцами, полученными у женщин, вынашивающих здоровый плод, в то время как образцы Р 21-Р 40 и Р 67-Р 80 являются образцами,полученными у женщин, вынашивающих плод с трисомией 21 хромосомы. Для образцов Р 1-20 и Р 41-66 ("нормальных" образцов), значения повышения метилирования для контрольного участка HYP113 были в диапазоне 3,66-8,68 (значение медианы = 5,27), и для образцов Р 21- 28023565 Р 40 и Р 67-Р 80 (образцы "трисомии 21 хромосомы") значения повышения метилирования для контрольного участка HYP113 были в диапазоне 3,15-12,32 (значение медианы = 4,68). Для образцов Р 1-20 и Р 4166 ("нормальных" образцов), значения повышения метилирования для контрольного участка U122 были в диапазоне 0,00-0,15 (значение медианы = 0,03), и для образцов Р 21-Р 40 и Р 67-Р 80 (образцы "трисомии 21 хромосомы") значения повышения метилирования для контрольного участка U122 были в диапазоне 0,000,51 (значение медианы = 0,04). Таким образом, высокие показатели метилирования отмечались при тестировании контрольного участка HYP113, указывающего на статус гиперметилирования со значениями с 3,15-кратным повышением или выше для случаев нормы и трисомии 21 хромосомы. С другой стороны,при тестировании контрольного участка U122 статус гипометилирования соответствовал ожидаемому для случаев нормы и трисомии 21 хромосомы со значением 0,51-кратного изменения или ниже. Эффективность способа соотношения метилирования ДНК специфического для плода Как это описано в тексте данной заявки, нами был разработан способ для определения соотношения метилирования ДНК в случаях нормы и трисомии 21 хромосомы с использованием 40 образцов с известным кариотипом (20 случаев нормы и 20 случаев с трисомией 21 хромосомы). Используемый здесь способ соотношения специфического для плода метилирования иллюстративно представлен на фиг. 7, при этом способность различать случаи нормы от трисомии 21 хромосомы достигается путем сравнения значений соотношения, полученных для случаев нормы и трисомии 21 хромосомы и специфических для плода метилированных участков, расположенных на хромосоме 21. Плод с трисомией 21 хромосомы имеет лишнюю копию специфического для плода метилированного участка в сравнении со здоровым плодом. После завершения повышения метилирования ДНК, количество ДНК плода в крови матери повышается. Однако количество специфических для плода метилированных участков будет большим у плодов с трисомией 21 хромосомы в сравнении со случаями нормы по причине лишней копии участка. Таким образом, соотношения нормальных контрольных случаев с нормальным исследуемым образцом в периферической крови матери будет отклоняться от значения соотношения нормальных контрольных случаев в сравнении со случаями трисомии 21 хромосомы. Аналитический способ для определения соотношения метилирования ДНК в случаях нормы и трисомии 21 хромосомы схематически представлен на фиг. 8. Как только будет завершено повышение метилирования специфического для плода метилированного участка, проводится КПЦР в режиме реального времени применительно к специфическому для плода метилированному участку для определения относительного количества ДНК плода в случаях нормы и трисомии 21 хромосомы. Для получения соотношения метилирования ДНК, нормализированное значение (Norm) CT, полученное для нормального случая, делят на медиану нормализированного значения нормальных контрольных случаев. Такая же процедура проводится для случаев трисомии 21 хромосомы. Ожидаемые значения соотношения для нормальных случаев равны или ниже значения 1, а для случаев трисомии 21 хромосомы - выше значения 1. Значения соотношения для 12 выбранных ДМУ (ЕР 1 - ЕР 12), полученных из 40 образцов с известным кариотипом, которые участвовали в создании дискриминирующего/прогностического уравнения,обобщены ниже в Таблице 9: Таблица 9. Обзор значений соотношения специфического для плода метилирования, полученных для каждого из 12 выбранных ДМУ из 40 образцов с известным кариотипом Как это указано в Таблице 9, нормальные случаи имеют соотношение медиан на уровне или ниже значения 1,00, в то время как случаи трисомии 21 хромосомы имеют соотношение медиан выше 1,00, за исключением ЕР 8 (для него отмечался целый диапазон значений соотношения метилирования) и ЕР 11. На фиг. 9 представлена коробчатая диаграмма с результатами, полученными для четырех ДМУ

МПК / Метки

МПК: C12Q 1/68

Метки: пренатальной, плода, диагностики, композиции, неинвазивной, способы, анэуплоидии

Код ссылки

<a href="http://easpatents.com/30-23565-sposoby-i-kompozicii-dlya-neinvazivnojj-prenatalnojj-diagnostiki-aneuploidii-ploda.html" rel="bookmark" title="База патентов Евразийского Союза">Способы и композиции для неинвазивной пренатальной диагностики анеуплоидии плода</a>

Похожие патенты