Белок, участвующий в разложении субстрата, представляющего собой н-алкан, или его функциональный фрагмент, кодирующая их молекула нуклеиновой кислоты, химерный ген, вектор и микроорганизм, содержащие указанную молекулу, и способ разложения указанного н-алкана

Есть еще 22 страницы.

Смотреть все страницы или скачать PDF файл.

Формула / Реферат

1. Молекула нуклеиновой кислоты, кодирующая белок, представляющий собой монооксигеназу или диоксигеназу, который участвует в разложении субстрата, представляющего собой н-алкан, имеющий 26 или более атомов углерода, включающая нуклеотидную последовательность, выбранную из группы, состоящей из:

(1) нуклеотидной последовательности SEQ ID NO:1;

(2) нуклеотидной последовательности, которая по меньшей мере на 80% идентична нуклеотидной последовательности SEQ ID NO:1;

(3) нуклеотидной последовательности, кодирующей белок с аминокислотной последовательностью SEQ ID NO:2;

(4) нуклеотидной последовательности, которая по меньшей мере на 85% идентична нуклеотидной последовательности, кодирующей белок с аминокислотной последовательностью SEQ ID NO:2; и

(5) нуклеотидной последовательности, комплементарной последовательности по любому из (1)-(4),

причем указанный белок:

(а) осуществляет окисление субстрата, представляющего собой н-алкан, имеющий 26 или более атомов углерода,

(б) вызывает образование спиртов, кислот и/или сложных эфиров из субстрата, представляющего собой н-алкан, имеющий 26 или более атомов углерода,

(в) способен снижать температуру потери текучести субстрата, содержащего н-алкан, имеющий 26 или более атомов углерода, или

(г) способен к комплементации мутации, ведущей к инактивации гена, кодируемого SEQ ID NO:1 в Acinetobacter sp. DSM17874.

2. Молекула нуклеиновой кислоты по п.1, включающая нуклеотидную последовательность, которая по меньшей мере на 90% идентична нуклеотидной последовательности, выбранной из группы, состоящей из:

(1) нуклеотидной последовательности SEQ ID NO:1 или

(2) нуклеотидной последовательности, кодирующей белок с аминокислотной последовательностью SEQ ID NO:2.

3. Молекула нуклеиновой кислоты по п.1 или 2, включающая нуклеотидную последовательность SEQ ID NO:1 или нуклеотидную последовательность, кодирующую белок с аминокислотной последовательностью SEQ ID NO:2.

4. Молекула нуклеиновой кислоты по п.1, кодирующая белок, вызывающий образование спиртов, кислот и/или сложных эфиров из субстрата, представляющего собой н-алкан, имеющий 26 или более атомов углерода, и:

(1) потребляющий по меньшей мере 30% субстрата, представляющего собой н-алкан, по сравнению со степенью потребления, которая достигается после экспозиции того же субстрата в течение того же времени в тех же условиях с белком, кодируемым SEQ ID NO:1, или

(2) продуцирующий по меньшей мере 30% продукта окисления по сравнению с количеством продукта, которое получают после экспозиции того же субстрата в течение того же времени в тех же условиях с белком, кодируемым SEQ ID NO:1.

5. Молекула нуклеиновой кислоты по п.1, кодирующая белок, который способен снижать температуру потери текучести субстрата, содержащего н-алкан, имеющий 26 или более атомов углерода, и:

(1) снижает температуру потери текучести указанного субстрата по меньшей мере на 30% от снижения, которое достигают после экспозиции того же субстрата в течение того же времени в тех же условиях с белком, кодируемым SEQ ID NO:1, или

(2) снижает температуру потери текучести указанного субстрата, содержащего н-алкан, по меньшей мере на 0,25°С.

6. Функциональный фрагмент молекулы нуклеиновой кислоты по любому из пп.1-5, имеющий по меньшей мере 60 нуклеотидов в длину.

7. Молекула нуклеиновой кислоты или ее функциональный фрагмент по любому из пп.1-6, где указанный н-алкан имеет 32 или более атомов углерода.

8. Белок, который участвует в разложении субстрата, представляющего собой н-алкан, имеющий 26 или более атомов углерода, представляющий собой монооксигеназу или диоксигеназу, который:

(1) кодируется молекулой нуклеиновой кислоты или ее функциональным фрагментом по любому из пп.1-7 или

(2) включает последовательность аминокислот, выбранную из группы, состоящей из:

(а) аминокислотной последовательности SEQ ID NO:2 или

(б) аминокислотной последовательности, которая по меньшей мере на 85% идентична аминокислотной последовательности SEQ ID NO:2.

9. Белок по п.8, последовательность которого по меньшей мере на 90% идентична аминокислотной последовательности SEQ ID NO:2.

10. Белок по п.8 или 9, имеющий аминокислотную последовательность SEQ ID NO:2.

11. Функциональный фрагмент белка по любому из пп.8-10 с делецией до 200 аминокислот относительно полноразмерной белковой молекулы.

12. Химерный ген, содержащий молекулу нуклеиновой кислоты или ее функциональный фрагмент по любому из пп.1-7, функциональным образом связанные с одной или более чем одной подходящей регуляторной последовательностью.

13. Вектор, содержащий молекулу нуклеиновой кислоты или ее функциональный фрагмент по любому из пп.1-7 или химерный ген по п.12.

14. Микроорганизм, подвергнутый генетическим манипуляциям таким образом, что он содержит молекулу нуклеиновой кислоты или ее функциональный фрагмент по любому из пп.1-7, химерный ген по п.12 или вектор по п.13 и способен экспрессировать белок по п.8.

15. Способ разложения н-алкана, имеющего 26 или более атомов углерода, в субстрате и снижения температуры потери текучести такого субстрата, включающий обеспечение взаимодействия указанного субстрата с:

(а) белком или его функциональным фрагментом по любому из пп.8-11,

(б) микроорганизмом по п.14 или встречающимся в природе микроорганизмом, способным экспрессировать белок или его фрагмент по любому из пп.8-11; или

(в) лизатом или экстрактом вышеуказанного микроорганизма.

16. Способ по п.15, где указанный субстрат представляет собой неочищенную нефть.

17. Способ по любому из пп.15 или 16, где на указанной стадии взаимодействия субстрата с указанным белком или его фрагментом используют белок или его фрагмент в выделенной, экстрагированной или очищенной форме.

18. Способ по п.15, где указанный микроорганизм является микроорганизмом по п.14.

19. Способ по любому из пп.15 или 16, где на указанной стадии взаимодействия субстрата с указанным белком или его фрагментом используют белок или его фрагмент в выделенной, экстрагированной или очищенной форме в комбинации с одним или более чем одним другим белком, причем указанный другой белок выбран из рубредоксина, редуктазы рубредоксина, алкогольдегидрогеназы, альдегиддегидрогеназы, алкангидроксилазы, ацил-КоА-синтетазы и КоА-лигазы жирных кислот.

Текст

Смотреть все

БЕЛОК, УЧАСТВУЮЩИЙ В РАЗЛОЖЕНИИ СУБСТРАТА, ПРЕДСТАВЛЯЮЩЕГО СОБОЙ н-АЛКАН, ИЛИ ЕГО ФУНКЦИОНАЛЬНЫЙ ФРАГМЕНТ, КОДИРУЮЩАЯ ИХ МОЛЕКУЛА НУКЛЕИНОВОЙ КИСЛОТЫ, ХИМЕРНЫЙ ГЕН, ВЕКТОР И МИКРООРГАНИЗМ, СОДЕРЖАЩИЕ УКАЗАННУЮ МОЛЕКУЛУ, И СПОСОБ РАЗЛОЖЕНИЯ УКАЗАННОГО н-АЛКАНА Предложена молекула нуклеиновой кислоты, включающая последовательность, указанную в SEQID NO:1, соответствующую последовательность белка, указанную в SEQ ID NO:2, и их варианты и функциональные фрагменты. Также предложены соответствующие химерные гены, векторы и микроорганизмы. Белок участвует в разложении длинноцепочечных н-алканов, и его можно использовать для модификации свойств субстратов, содержащих длинноцепочечные н-алканы. Также предложены способы применения белка по этому изобретению, например, для того, чтобы вызывать разложение длинноцепочечных н-алканов, а также способы идентификации ферментов,необходимых для метаболизма какого-либо субстрата. Настоящее изобретение относится к молекулам нуклеиновой кислоты, которые кодируют ферменты, участвующие в метаболизме твердых компонентов неочищенной нефти, кодируемым ферментам,бактериям, содержащим такие молекулы нуклеиновой кислоты и кодируемые ферменты, и способам применения таких бактерий и ферментов с целью биологического разложения восков, присутствующих в нефти, в частности, для снижения температуры потери текучести нефти, например, в промышленных процессах. Для того, чтобы оптимизировать извлечение нефти в промышленных способах получения нефти,выгодно снижать вязкость нефти так, что нефть становится способной легко течь. Когда нефть может течь, ее можно более легко нагнетать и перемещать и более легко извлекать из геологических формаций. Снижение вязкости нефти должно также помогать в удалении любой нежелательной нефти с почвы, когда она присутствует в качестве загрязнителя. Однако такого снижения вязкости трудно достичь, особенно в холодных областях, таких как Арктика и Антарктика, и в областях, где получают нефть, имеющую содержание н-алканов, которое делает температуру потери текучести нефти высокой, таких как Азербайджан. В попытках преодолеть эти проблемы, в настоящее время используют различные методики, такие как применение ингибиторов отложения воска или применение нагреваемых труб для транспортировки неочищенной нефти. Однако эти применяемые в настоящее время способы являются дорогими в осуществлении и сложными в логистическом отношении для доставки на место. Как упомянуто выше, особенно важны попытки препятствовать эффектам, которые возникают из-за высокого содержания длинноцепочечных н-алканов в неочищенной нефти, особенно в областях, где нефть от природы богата длинноцепочечными н-алканами. Температура плавления у алканов с более длинной цепью выше, чем у алканов с более короткой цепью, и они образуют твердые вещества при более высоких температурах. С 10-С 20 н-Алканы в общем, являются жидкими, но это также зависит от конкретных условий, которым подвергают эти алканы, например, от температур, которым их подвергают. Вместо внедрения корректирующих способов справляться с вредными эффектами высокого содержания н-алканов может быть возможным в обход некоторых или всех этих проблем путем разложения длинноцепочечных н-алканов, например, в неочищенной нефти. Эстерификация н-алканов, которая тоже может происходить во время разложения, также влияет на вязкость нефти (и имеет дополнительное преимущество повышения топливной отдачи нефти). Также известно, что привлекательным является превращение соединений нефти в активированные промежуточные соединения, например, для полимерной и общей химической промышленности, потому что функционализация углеводородов химическими способами является сложной, затратной по энергии и вредной для среды. Действительно, желательны новые промышленные синтетические способы для трудно синтезируемых комплексных молекул, таких как вторичные метаболиты (стероиды, поликетиды, терпены и т.д.) и фармацевтических и агрохимических промежуточных соединений. Аэробное и неаэробное разложение н-алканов является широко распространенным явлением в природе, и некоторые микробные штаммы и ферменты, участвующие в аэробном разложении н-алканов,выделены и изучены довольно подробно (рассмотрено в van Beilen and Funhoff, 2005, Curr Opin Biotechnol, 16(3): 308-14), например, цитохром Р 450, монооксигеназа и диоксигеназа. В частности, охарактеризованы ферменты, разлагающие короткоцепочечные н-алканы, и, таким образом, существуют встречающиеся в природе ферменты, которые потенциально могут использоваться для разложения таких короткоцепочечных н-алканов. Алкановые молекулы являются химически инертными и должны быть активированы для возможности дальнейших метаболических стадий. Хорошо исследован один из путей аэробного разложения коротко- и среднецепочечных алканов. В этом пути связанная с мембраной монооксигеназа AlkB (которая также известна как AlkM) исходно активирует алканы, окисляя их с образованием соответствующих первичных спиртов. Дальнейшие стадии (осуществляемые алкогольдегидрогеназами, альдегиддегидрогеназами и ацил-КоА-синтетазой) вызывают окисление получившихся спиртов и альдегидов до жирных кислот и поступление жирных кислот в путь -окисления. Хотя известно множество ферментов, разлагающих н-алканы, они главным образом являются ферментами, разлагающими короткоцепочечные н-алканы. Желательны дополнительные ферменты, разлагающие н-алканы (то есть, ферменты, которые катализируют одну или более чем одну стадию, которые включает в себя разложение н-алканов, как определено здесь), в частности те, которые могут разлагать длинноцепочечные н-алканы. В частности, очень желательны ферменты, которые могут разлагать длинноцепочечные н-алканы, имеющие 26 или более, 28 или более или 30 или более атомов углерода, и ферменты и микроорганизмы, содержащие такие ферменты, можно применять в способах добычи нефти. Однако идентификация таких ферментов трудна. Для идентификации ферментов, ответственных за определенный фенотип, эффективным способом является комбинация случайного транспозонного мутагенеза и тщательная стратегии селекции, и он имеет широкое применение (рассмотрено в Hayes, 2003,Annual Review of Genetics 37: 3-29). Тем не менее, в настоящее время нет способа специфичной селекции для идентификации ферментов, участвующих в метаболизме твердых компонентов неочищенной нефти(например длинноцепочечных н-алканов). Таким образом, также желательны способы идентификации бактерий, утилизирующих длинноцепочечные н-алканы, и конкретных ферментов в этих бактериях, которые отвечают за это свойство. В работе, приведшей к этому изобретению, изобретатели идентифицировали бактериальный штамм, способный использовать н-алканы с длиной цепи в диапазоне от декана (С 10 Н 22) до тетраконтана(С 40 Н 82) в качестве единственного источника углерода. Это штамм изолировали при использовании системы для скрининга микроорганизмов, способных расти на парафине (смешанные длинноцепочечные налканы). Изолят, идентифицированный в соответствии с его последовательностью 16S-pPHK как Acinetobacter venetianus, обозначен как Acinetobacter sp. DSM17874. Штамм DSM17874 был депонирован вDSMZ в открытой коллекции (номер депонирования DSM17874 на Mimmi Throne-Hoist), а также на условиях Будапештского договора 20 июня 2007 на Statoil ASA, под номером доступа DSM19446. При использовании этого штамма было показано, что паралоги alkM (alkMa, alkMb) играют центральную роль в утилизации алканов от С 10 до С 18. Это было достигнуто получением и анализом роста мутантов Acinetobacter sp. DSM17874 (обозначены в Throne-Hoist et al., 2006 как A. venetianus 6A2) с нарушенными генами alkMa и alkMb и двойного мутанта alkMa/alkMb (Throne-Hoist et al., 2006 Appl Microbiol Biotechnol 73(10):3327-32). Однако, поскольку двойные мутанты и оба мутанта по одному гену были способны расти на н-алканах с длинами цепи С 20 и длиннее, был сделан вывод, что в Acinetobacter sp. DSM17874 должен существовать по меньшей мере еще один дополнительный фермент для утилизация этих н-алканов. Для идентификации дополнительных ферментов в Acinetobacter sp. DSM17874, которые ответственны за использование н-алканов с длинами цепи больше чем С 20, был разработан новый высокопроизводительный способ. В этом новом способе генерировали мутантные штаммы Acinetobacter sp.DSM17874 и выращивали их на планшетах при использовании длинноцепочечного алкана в качестве источника углерода (например, н-алкана С 32), внесенного в виде порошка. Жизнеспособные клоны идентифицировали in situ окрашиванием хлоридом йоднитротетразолия (INT), и ущербные по росту клоны подвергали стадии контрселекции, например, на ацетате и короткоцепочечных алканах. Только те клоны, которые были ущербными по росту на длинноцепочечных алканах и которые могли расти на альтернативном субстрате, анализировали для идентификации генов, которые мутировали в этих клонах и которые, следовательно, нужны для роста на длинноцепочечных н-алканах. Это способ является особенно полезным, поскольку исходный штамм может расти как на субстрате С 32, так и на альтернативном субстрате. Как таковое, присутствие стадии контрселекции (то есть, стадии идентификации клонов, которые растут на альтернативной субстанции, но не могут расти на С 32) удаляет из исследования любые мутантные штаммы, которые имеют мутации, влияющие на другие пути, чем те, которые нужны для роста на субстрате, представляющем собой н-алкан С 32 (то есть, мутации, который влияют на общую жизнеспособность клеток). Другими словами, если мутантный штамм может расти на альтернативном субстрате, но не на субстрате, представляющем собой длинноцепочечный н-алкан, тогда как исходный штамм мог расти на обоих, мутированный ген, вероятно, представляет интерес, поскольку он специфично влияет на способность штамма расти на субстрате, представляющем собой длинноцепочечный налкан (например С 32). Указанный способ использовали для идентификации гена almA, который, как было показано, необходим для роста Acinetobacter sp. DSM17874 на длинноцепочечных алканах, таких как С 32 и С 36, но не нужен для роста на других субстратах (например С 16, С 20 или С 4). Эти признаки показывают, что AlmA играет центральную роль в утилизации н-алканов С 32 и С 36. Последовательность нуклеиновой кислоты гена almA указана в SEQ ID NO:1 (фиг. 6), тогда как последовательность кодируемого белка представлена в SEQ ID NO:2 (фиг. 7). Также идентифицирован дополнительный ген orf1 (также обозначен здесь как almB) на основании его близости к almA в геномеAcinetobacter sp. DSM17874. Последовательность нуклеиновой кислоты гена orf1 (almB) указана в SEQID NO:3 (фиг. 8), тогда как последовательность кодируемого белка представлена в SEQ ID NO:4 (фиг. 9). Локус almA-otf1 (almAB) представлен в SEQ ID NO:5 (фиг. 10), и схожесть организации этой области с областью, окружающей ACIAD3192 в ADP1 Acinetobacter sp., показана на фиг. 5. Таким образом, в этом изобретении предложена молекула нуклеиновой кислоты, предпочтительно выделенная молекула нуклеиновой кислоты, включающая или состоящая из молекулы нуклеиновой кислоты, выбранной из группы, состоящей из:(1) молекулы нуклеиновой кислоты с нуклеотидной последовательностью, указанной в SEQ IDNO:1, 3 или 5,(2) молекулы нуклеиновой кислоты с нуклеотидной последовательностью, которая по меньшей мере на 50%, предпочтительно по меньшей мере на 55, 60, 65, 70, 75, 80, 85, 90, 95, 98% и более предпочтительно по меньшей мере на 99% идентична последовательности молекулы нуклеиновой кислоты с нуклеотидной последовательностью, указанной в любой SEQ ID NO:1, 3 или 5,(3) молекулы нуклеиновой кислоты, которая гибридизуется с комплементом (1) в следующих условиях гибридизации: 0,1SSC (стандартный солевой раствор), 0,1% SDS (додецилсульфат натрия), 65 С; и условиях отмывки: 2SSC, 0,1% SDS, 65 С, с последующим 0,1SSC, 0,1% SDS, 65C (условия высо-2 020184(5) молекулы нуклеиновой кислоты с нуклеотидной последовательностью, комплементарной последовательности молекулы нуклеиновой кислоты по любому из (1) до (4). Иными словами, в этом изобретении предложена молекула нуклеиновой кислоты, предпочтительно выделенная нуклеиновая кислота, включающая или состоящая из молекулы нуклеиновой кислоты, выбранной из группы, состоящей из:(1) молекулы нуклеиновой кислоты, кодирующей белок с аминокислотной последовательностью,указанной в SEQ ID NO:2 или 4,(2) молекулы нуклеиновой кислоты с нуклеотидной последовательностью, которая по меньшей мере на 50%, предпочтительно по меньшей мере на 55, 60, 65, 70, 75, 80, 85, 90, 95, 98% и более предпочтительно по меньшей мере на 99% идентична последовательности молекулы нуклеиновой кислоты, кодирующей белок с аминокислотной последовательностью, указанной в SEQ ID NO:2 или 4,(3) молекулы нуклеиновой кислоты, которая гибридизуется с комплементом (1) в следующих условиях гибридизации: 0,1SSC, 0,1% SDS, 65 С; и условиях отмывки: 2SSC, 0,1% SDS, 65C, с последующим 0,1SSC, 0,1% SDS, 65C (условия высокой жесткости),(4) молекулы нуклеиновой кислоты, которая гибридизуется с комплементом (1) в следующих условиях гибридизации: 0,2-2SSC, 0,1% SDS, 55 С; и условиях отмывки: 2SSC, 0,1% SDS, 55C, с последующим 0,2-2SSC, 0,1% SDS, 55C (условия умеренной жесткости) и(5) молекулы нуклеиновой кислоты с нуклеотидной последовательностью, комплементарной последовательности молекулы нуклеиновой кислоты по любому из (1) до (5). В случае SEQ ID NO:1 или последовательности, кодирующей SEQ ID NO:2, уровень идентичности последовательности представляет собой предпочтительно по меньшей мере 75, 80, 85, 90, 95, 98% и более предпочтительно по меньшей мере 99%. Предпочтительно молекула нуклеиновой кислоты кодирует белок, который играет роль в разложении длинноцепочечных н-алканов, более предпочтительно роль в разложении н-алканов, имеющих 28 или более или 30 или более атомов углерода (например, С 30-С 36). Этот фермент может катализировать концевую и/или субконцевую модификацию алкана, например он может осуществлять окисление (моно- или диоксигеназа), например алкана в спирт. Продукты таких модификаций алкана могут включать в себя спирты, альдегиды, кислоты или сложные эфиры. Активность кодируемого белка можно альтернативно или дополнительно определять одним или более чем одним следующим способом. Было показано, что после экспозиции субстрата, содержащего длинноцепочечный н-алкан, кодируемому белку можно обнаружить образование спиртов, кислот и/или сложных эфиров. В некоторых случаях наблюдали эстерификацию до 70% субстрата. Это является выгодным, поскольку увеличивает топливную отдачу субстрата. Как таковую, в одной из альтернатив, активность кодируемого белка можно определять как вызывающую образование спиртов, кислот и/или сложных эфиров из н-алкана, предпочтительно из длинноцепочечного н-алкана, более предпочтительно длинноцепочечного н-алкана,имеющего по меньшей мере 26 или по меньшей мере 30 атомов углерода. Такие взаимодействия могут включать в себя снижение длины цепи н-алкана, или длина цепи может оставаться той же. Эту активность можно измерять экспонированием надлежащего субстрата кодируемому белку. Это можно осуществить с использованием очищенного белка или микроорганизма, который способен предоставлять указанный белок, или клеточного экстракта такого микроорганизма, за время и в условиях,которые делают возможными эти взаимодействия. Подходящие условия взаимодействия являются, например, такими, как указано в Maeng et al, 1996 J. Bacteriol. 178 (13): 3695. Например, субстрат (например н-алкан С 32, например 100 мкМ, добавленный к 100 мл 50 мМ Трис-HCl (рН 7,5), содержащим 1 мг детергента Plysurf A210G (Daiichi Kogyo Seuyaky, Kyoto, Japan можно смешать с надлежащим количеством фермента и инкубировать при приблизительно 30 С в течение 3 мин при встряхивании. Можно измерять либо потребление субстрата, либо образование продуктов, например, с помощью газовой хроматографии (ГХ) или газовой хроматографии/масс-спектрометрии (ГХ/МС). Таким образом,можно оценивать потребление субстрата, образование одного или более чем одного продукта и/или весь профиль или фингерпринт субстрата. Например, превращение алканов в соответствующие первичные спирты можно измерять с помощью ГХ и ГХ/МС, как это сделано у Feng et al., 2007 PNAS 104:56025607, где использовали реакционные смеси, содержащие 50 мМ Трис-HCl (рН 7,5), 1 мМ гексадекана(или других индивидуальных алканов), по 1 мМ каждого NADH и MgSO4 и адекватное количество тестируемого фермента. Смесь без фермента использовали в качестве контроля. Эти смеси инкубировали при 60 С при встряхивании в течение 5 мин и затем экстрагировали циклогексаном, и алкановые остатки в экстракте анализировали с помощью ГХ. Идентификацию продукта этого взаимодействия осуществляли с помощью ГХ/МС. Удельную активность выражали в единицах/мг фермента. Одну единицу активно-3 020184 сти фермента можно определить как количество фермента, которое катализирует потребление 1,0 мкмоль субстрата в этих условиях. Предпочтительно по меньшей мере 5, 10, 15, 20, 25, 30, 35, 40, 50, 60,70, 80, 90 или 95% субстрата потреблено или превращено в продукт после такого инкубирования. Подходящий клеточный экстракт можно получать путем суспендирования промытых клеток в буфере (например 50 мМ Трис-Cl) и разрушения клеток ультразвуком. Неочищенный экстракт или супернатант, полученный из экстракта, можно затем использовать в качестве источника фермента. В дополнительной альтернативе активность кодируемого белка можно определять как способность снижать температуру потери текучести субстрата, содержащего н-алкан, такого как неочищенная нефть. Температуру потери текучести определяют как температуру, при которой жидкость прекращает течь, то есть самую низкую температуру (в F или С), при которой жидкость остается переливаемой (то есть, все еще ведет себя как жидкость). Как отмечено выше, в нефтепродуктах температуру потери текучести обычно повышает высокое содержание парафина (или весьма длинноцепочечного н-алкана). Высокие значения температуры потери текучести обычно имеют место в неочищенных нефтепродуктах,которые имеют значительное содержание парафина. Парафины (или воски) должны начинать осаждаться при снижении температуры. В некоторой точке выпавшие в осадок продукты накапливаются до того, что жидкость больше не может течь. Температуру потери текучести для нефти можно определять способами,указанными в тесте ASTM D-97 на температуру потери текучести, в котором температуру потери текучести определяют как такую температуру, при которой нефть прекращает течь, когда пробу держат под 90 вертикально в течение пяти секунд. Выгодно снижать температуру потери текучести субстрата, такого как неочищенная нефть, так,чтобы он становился менее вязким и, следовательно, его было легче транспортировать и извлекать. Снижение температуры потери текучести субстрата даже в малой степени может влиять на способность субстрата течь и, следовательно, на способность транспортировать и извлекать этот субстрат. Как таковую, температуру потери текучести субстрата, содержащего н-алканы, можно измерять до и после экспозиции субстрата белку, который, как полагают, имеет общую активность с AlmA, за время и в условиях, которые достаточны для модификации температуры потери текучести указанного субстрата, и, если температура застывания была снижена, считают, что белок имеет общую активность с белкомAlmA. Предпочтительно, температуру потери текучести снижают по меньшей мере на 0,1, 0,25, 0,5, 1,1,5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 или более градусов. Упомянутые выше тесты можно также осуществлять параллельно с экспозицией того же субстрата ферменту AlmA, и степень или количество образования продукта, или потребления субстрата, или изменения температуры потери текучести, которые вызывает экспозиция белку, можно сравнивать, с тем, что достигают с этим ферментом. Предпочтительно потребляется по меньшей мере 30, 40, 50, 60, 70, 80 или 90% н-алканового субстрата при сравнении со степенью потребления, которую достигают после экспозиции того же субстрата белку, кодируемому геном almA, за то же время в тех же условиях. Альтернативно или дополнительно получают по меньшей мере 30, 40, 50, 60, 70, 80 или 90% продукта при сравнении с количеством продукта (например, одного или более чем одного спирта, кислоты или сложного эфира), которое достигают после экспозиции того же субстрата белку, кодируемому геном almA, за то же время в тех же условиях. Альтернативно, снижение температуры застывания представляет собой по меньшей мере 30, 40, 50, 60, 70, 80 или 90% того, что достигают после экспозиции того же субстрата белку, кодируемому геном almA, за то же время в тех же условиях. В дополнительной альтернативе активность кодируемого фермента можно описать как способность к комплементации мутации в гене almA Acinetobacter sp. DSM17874, то есть, способность к комплементации мутации, ведущей к инактивации гена, кодируемого или соответствующего SEQ ID NO: 1 в Acinetobacter sp. DSM17874. Авторы настоящего изобретения показали, что этому штамму продукт гена almA нужен для способности расти, когда единственным предоставленным источником углерода является налкан С 32. Подходящий анализ для определения жизнеспособности или способности конкретного штамма расти на н-алкане С 32 также раскрыт здесь в другом месте, хотя альтернативно можно использовать любой подходящий способ определения жизнеспособности или роста клеток. Белки, которые имеют общую каталитическую функцию с ферментом, кодируемого almA, следует считать способными к комплементации мутации в almB штамма DSM17874 Acinetobacter sp., который иначе не может расти на субстрате, представляющем собой длинноцепочечный н-алкан, такой как н-алкан С 32. Наличие или отсутствие этой способности у белка, который считают имеющим общую каталитическую активность с AlmA и/или Orf1 (AlmB), можно легко тестировать экспрессией гена, который кодирует этот белок, в мутантном штамме микроорганизма, который не содержит функциональный ген almA и/или ген orf1 (almB) и который не может расти на субстрате, представляющем собой н-алкан С 32, (например при использовании штамма DSM17874 Acinetobacter sp., в котором ген almA и/или ген orf1(almB) был разрушен, удален или иным образом изменен так, что это предотвращает экспрессию функционального белка AlmA и/или Orf1 (AlmB. Поскольку генные последовательности для этих двух белков сейчас известны, это можно делать очевидным образом (см. например Throne-Hoist M etal, 2007 Appl Геном, кодирующим белок, который считают имеющим общую каталитическую активность с AlmA и/или AlmB, можно трансфецировать мутантный штамм, или можно ввести этот ген в него при использовании стандартных методик, которые известны в данной области. Его необходимо поместить под контроль надлежащего промотора и/или других регуляторных последовательностей так, что он экспрессируется в мутантном микроорганизме. Затем после определенного периода времени можно определить комплементацию или отсутствие комплементации мутации экзогенным геном в мутантном штамме, то есть, определить, сделала ли экспрессия мутантный штамм жизнеспособным для роста на субстрате, представляющем собой н-алкан С 32,и компенсировала ли она отсутствие функционального AlmA и/или Orf1 (AlmB). Это можно осуществить тестированием признаков бактериального роста на субстрате, представляющем собой н-алкан С 32. Если экспрессия экзогенного белка позволяет мутантным штаммам выживать, то есть, она может компенсировать отсутствие экспрессии функционального AlmA, говорят, что экзогенный белок осуществил комплементацию мутации. Гены, чья экспрессия может приводить к комплементации мутации в гене almA, например, в штамме DSM17874 Acinetobactersp. (например, штамме MAV1, описанном в примерах), считают имеющими общую активность с белком AlmA. Гены, чья экспрессия может приводить к комплементации мутации в гене orf1 (almB), например, в штамме DSM17874 Acinetobacter sp., считают имеющими общую активность с белком orf1 (AlmB). Это изобретение также охватывает функциональные фрагменты указанных молекул нуклеиновой кислоты, под чем подразумевают фрагменты, которые кодируют белок, который имеет ту же или, по существу, ту же активность (например, каталитическую или ферментативную активность), какую имеет полноразмерный белок, как определено выше. Тесты для определения того, имеет ли белок, кодируемый таким фрагментом, такую же или, по существу, такую же активность (например, каталитическую или ферментативную активность), как и полноразмерный белок, определенный выше, включают в себя обсужденные выше. В норме эти функциональные фрагменты должны иметь только малые делеции молекул нуклеиновых кислот относительно полноразмерных молекул нуклеиновых кислот, например делеции менее чем 50, 40, 30, 20 или 10 нуклеотидов, например, на 5'-конце, кодирующем N-конец белка, 3'конце, кодирующем С-конец белка, или внутри кодирующей области, хотя более крупные делеции, например, по меньшей мере 60, 70, 80, 90,100, 150, 200, 300, 400, 500, 600, 700, 800, 900 или 1000 нуклеотидов, или делеции менее чем 60, 70, 80, 90,100,150, 200, 300, 400, 500, 600,700, 800, 900 или 1000 нуклеотидов также можно осуществлять, если фрагмент имеет ту же или, по существу, ту же активность (например, каталитическую или ферментативную активность), как и полноразмерный белок, как определено выше. Активность кодируемого белка можно легко тестировать для определения того, может ли он иметь общую активность с полноразмерным белком, например, как указано выше. Более короткие фрагменты молекулы нуклеиновой кислоты по этому изобретению можно использовать как зонды, например для способов ПЦР или гибридизации. Более короткие фрагменты могут быть, например, 10-30, 20-25 нуклеотидов в длину. Такие зонды полезны в способах идентификации дополнительных молекул нуклеиновой кислоты, которые имеют гомологию с молекулами нуклеиновой кислоты по этому изобретению. Термин "молекула нуклеиновой кислоты" при использовании здесь относится к полимеру РНК или ДНК, который представляет собой единичную или двойную цепь, возможно включающему в себя синтетические, неприродные или измененные нуклеотидные основания. Примеры таких полинуклеотидов включают в себя кДНК, геномную ДНК и двухцепочечную РНК, среди прочего. Предпочтительно молекула нуклеиновой кислоты представляет собой ДНК. При том, что последовательности нуклеиновой кислоты, упомянутые здесь, содержат тимидиновые("t") нуклеотиды, будет понятно, что это изобретение также относится к соответствующим последовательностям, где тимидин заменен уридином ("u"). Разложение длинноцепочечных н-алканов означает ферментативное применение длинноцепочечного н-алкана, как описано здесь, в качестве источника углерода. По альтернативному определению, оно означает ферментативное окисление длинноцепочечного н-алкана или ферментативное превращение молекулы длинноцепочечного н-алкана в алкан, имеющий более короткую длину цепи. Разложение алканов может приводить к образованию сложных эфиров, альдегидов, спиртов и/или кислот. Разложение может, таким образом, содержать или включать в себя одну или более чем одну стадию окисления или взаимодействия н-алкана, например, для превращения н-алкана в спирт, альдегид, кислоту или сложный эфир. Превращение может приводить к спирту, альдегиду, кислоте или сложному эфиру,имеющему такую же длину цепи, какую имеет н-алкан до разложения, или это может приводить к продукции молекулы, имеющей меньше атомов углерода, чем имеет н-алкан до разложения. н-Алкан означает алкан с прямой цепью. Длинноцепочечный н-алкан означает н-алкан, имеющий 20 или более чем 20 атомов или молекул углерода, например 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,33, 34, 35, 36 или более атомов углерода. Предпочтительными длинноцепочечными алканами являются те, которые имеют 26 или более атомов углерода, или 32 или более атома углерода (например 26-36, 2834 или 30-32 молекул углерода). Напротив, среднецепочечные н-алканы представляют собой н-алканы,-5 020184 имеющие от 11 до 20 атомов углерода, и короткоцепочечные алканы имеют 1-10 атомов углерода. Длинноцепочечные н-алканы также иногда называют парафинами. Это изобретение также относится к вариантам молекул нуклеиновой кислоты, определенной выше. Термин "вариант" включает в себя молекулы нуклеиновой кислоты, которые имеют единственные или множественные изменения нуклеотидов при сравнении с молекулами нуклеиновой кислоты по этому изобретению. Например, варианты могут иметь 1, 2, 3, 4 или 5 добавлений, замен, вставок или делеций одного или более чем одного нуклеотида. Это изобретение также относится к молекулам нуклеиновой кислоты, чьи последовательности являются вырожденными относительно последовательностей по этому изобретению, то есть, к молекулам,чьи последовательности содержат изменения нуклеотидов, которые не приводят к изменению в кодируемой аминокислотной последовательности. Однако в общем, такие варианты и вырожденные молекулы удовлетворяют критериям последовательности, которые указаны выше. В дополнительном аспекте в этом изобретении предложен белок, включающий или состоящий из последовательности аминокислот, выбранной из группы, состоящей из:(2) аминокислотной последовательности, которая идентична по меньшей мере на 50%, предпочтительно по меньшей мере на 55, 60, 65, 70, 75, 80, 85, 90, 95, 98% и более предпочтительно по меньшей мере на 99% аминокислотной последовательности, указанной в SEQ ID NO:2 или 4. Эта аминокислотная последовательность предпочтительно идентична по меньшей мере на 75%, более предпочтительно по меньшей мере на 80, 85, 90, 95, 98% и наиболее предпочтительно по меньшей мере на 99% аминокислотной последовательности, указанной в SEQ ID NO:2. Этот белок можно альтернативно определить с учетом последовательностей кодирующих нуклеиновых кислот и, как таковой, белок по этому изобретению может кодировать любая молекула нуклеиновой кислоты по этому изобретению, описанная выше. Это изобретение также включает функциональные фрагменты указанных белковых молекул, что означает фрагменты, которые имеют ту же или, по существу, ту же активность, что и полноразмерные белки, определенные выше, то есть, их надо считать функционально эквивалентными вариантами. Как отмечено здесь в другом месте, на это свойство можно тестировать различными способами прямым образом. В норме эти функциональные фрагменты должны иметь только малые делеции относительно полноразмерной белковой молекулы, например, менее чем 50, 40, 30, 20 или 10 аминокислот, хотя, как отмечено выше в связи с молекулами нуклеиновой кислоты, подходящими могут быть делеции большего размера, например до 60, 70, 80, 90,100,150, 200 аминокислот или по меньшей мере 60, 70, 80, 90, 100,150, 200 аминокислот. Во всех случаях фрагменты должны иметь ту же или, по существу, ту же активность, что и полноразмерные белки, определенные выше, то есть, их надо считать функционально эквивалентными вариантами. Эти делеции могут быть на N-конце, С-конце, или они могут быть внутренними делециями. Белок по этому изобретению, определенный выше, включает в себя варианты конкретных указанных последовательностей, то есть, последовательности, имеющие определенные уровни идентичности последовательности указанным последовательностям. Такие варианты могут быть встречающимися в природе вариантами, такими как сравнимые белки или гомологи, найденные в других видах, или, более конкретно, варианты, найденные в других микроорганизмах (которые имеют общие функциональные свойства с кодируемым белком, как определено здесь в другом месте). Варианты встречающегося в природе белка, как определено здесь, можно также получать синтетическим путем, например, при использовании стандартных методик молекулярной биологии, которые известны в данной области, например, стандартных методик мутагенеза, таких как направленный или случайный мутагенез (например, при использовании генной перестановки или подверженной ошибкам ПЦР). Такие методики мутагенеза можно использовать для разработки ферментов, которые имеют улучшенные или иные каталитические свойства. Таким образом, в еще дополнительном аспекте этого изобретения предложен способ идентификации остатков в разлагающем длинноцепочечные н-алканы белке, как определено здесь, который важен для осуществления разложения длинноцепочечных н-алканов, включающий стадии:(1) мутации или иного изменения одного или более аминокислотных остатков в разлагающем длинноцепочечные н-алканы белке и(2) тестирования влияния этих мутаций или изменений на свойство разложения длинноцепочечных н-алканов. В таком способе стадию (2) можно осуществлять путем оценки способности мутированного или иным образом измененного белка, разлагающего длинноцепочечные н-алканы, вызывать разложение субстрата, представляющего собой длинноцепочечный н-алкан, например, при использовании способов и анализов, описанных здесь в другом месте. Способность мутированного или иным образом измененного белка, разлагающего длинноцепочечные н-алканы, вызывать разложение длинноцепочечных налканов можно затем сравнивать относительно немутированного или иным образом измененного белка,разлагающего длинноцепочечные н-алканы. Таким образом, свойства мутированного или иным образом измененного белка, разлагающего длинноцепочечные н-алканы, например, продукцию различных продуктов, потребление субстратов и способность модифицировать температуру потери текучести субстрата, содержащего н-алканы, можно сопоставлять прямо с последовательностью дикого типа или исходной последовательностью, из которой произведен мутированный или иным образом измененный белок, разлагающий длинноцепочечные н-алканы. В таких способах мутации могут не иметь влияния на свойства разложения или могут улучшать или снижать, или ингибировать влияние на разложение. Остатки, которые, когда они мутированы, имеют положительное или отрицательное влияние на свойства разложения, затем идентифицируют как важные для функции. В зависимости от предложенного применения белка, разлагающего длинноцепочечные налканы, такие остатки либо представляют собой цели для дополнительной мутации (см. ниже), либо идентифицируются как остатки, которые должны быть сохранены в немодифицированной форме для того, чтобы сохранить важное функциональное свойство разложения длинноцепочечных н-алканов. Поэтому при альтернативном рассмотрении предложен способ получения белка, разлагающего длинноцепочечные н-алканы, с улучшенной или повышенной способностью вызывать разложение длинноцепочечного н-алкана. В настоящем изобретении дополнительно предложен способ идентификации, разработки или получения других белков, разлагающих длинноцепочечные н-алканы, или их вариантов, которые имеют способность действовать на другие субстраты/полимеры, включающий стадии:(1) получения или иного предоставления белка, разлагающего длинноцепочечные н-алканы, как определено здесь,(2) мутирования или иного изменения одного или более чем одного аминокислотного остатка в белке, разлагающем длинноцепочечные н-алканы,(3) оценки способности указанного мутированного или измененного белка, разлагающего длинноцепочечные н-алканы, разлагать или усиливать разложение субстрата, представляющего интерес,(4) идентификации мутированных или измененных белков, разлагающих длинноцепочечные налканы, проявляющих желаемые свойства. Подходящие субстраты для использования в указанных способах могут представлять собой любой субстрат, представляющие интерес, в частности любой длинноцепочечный н-алкан. Белок, разлагающий длинноцепочечные н-алканы, используемый в этих способах, имеет свойства,определенные здесь в другом месте, и может быть вновь идентифицированным белком, разлагающим длинноцепочечные н-алканы, или может быть известной молекулой, чьи свойства разложения длинноцепочечных н-алканов стали известными только в результате применения способов и анализов по этому изобретению, определенных здесь в другом месте. Также можно использовать производные белка, определенного здесь. Производное означает белок,описанный выше, или его вариант, который вместо встречающейся в природе аминокислоты содержит структурный аналог этой аминокислоты. Дериватизация или модификация (например, введение метки,гликозилирование, метилирование аминокислот в белке) также может иметь место постольку, поскольку не оказывает нежелательного влияния на функцию белка."Структурный аналог" означает нестандартную аминокислоту. Примерами таких нестандартных или структурных аналогов аминокислот, которые можно использовать, являются D-аминокислоты, изоэфиры амидов (такие как N-метиламид, ретроинвертированный амид, тиоамид, тиоэфир, фосфонат, кетометилен, гидроксиметилен, фторвинил, (Е)-винил, метиленамино, метилентио или алкан), L-Nметиламинокислоты, Dметиламинокислоты, D-N-метиламинокислоты. Идентичность последовательности можно оценивать любым удобным способом. Однако для определения степени идентичности последовательности между последовательностями полезны компьютерные программы, которые осуществляют множественные выравнивания последовательностей, к примеру,Clustal W. (Thompson, J. D et al., 1994, "CLUSTAL W.: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice". Nucleic Acid Res 22: 4673-4680). Программы, которые сопоставляют и выравнивают пары последовательностей, такие как ALIGN (E. Myers and W. Miller, 1988, "Optical Alignments in Linear Space", CABIOS 4:1117), FASTA (W.R. Pearson and D.J. Lipman, 1988, "Improved tools for biological sequence analysis", PNAS 85:2444-2448, and W.R. Pearson, 1990, "Rapid and sensitive sequence comparison with FASTP and FASTA"Methods in Enzymology 183:63-98) и учитывающая пробелы программа BLAST (Altschul, S.F. et al., 1997,"Gapped BLAST and PSI-BLAST: a new generation of protein database search programs". Nucleic Acid Res. 25: 3389-3402), также полезны для этой цели. Более того, сервер Dali при Европейском институте биоинформатики (European Bioinformatics Institute) предлагает выравнивание последовательностей белков на основе их структуры (Holm, 1993, J. Mol. Biology, 233: 123-38; Holm, 1995, Trends in Biochemical Sciences,20: 478-480; Holm, 1998, Nucleic Acid Research, 26: 316-9). Множественные выравнивания последовательностей и вычисления процента идентичности предпочтительно осуществлять при использовании стандартных параметров BLAST (при использовании последовательностей из всех доступных организмов, matrix Blosum 62, gap costs: existence 11, extension 1). В дополнительном воплощении этого изобретения предложен химерный ген, содержащий изолиро-7 020184 ванную молекулу нуклеиновой кислоты по этому изобретению, функциональным образом связанную с одной или более чем одной подходящей регуляторной последовательностью. Предпочтительно одна или более регуляторные последовательности представляют собой гетерологичные регуляторные последовательности, например гетерологичный промотор. В контексте этого изобретения термин "функциональным образом связаны" относится к ассоциации двух или более чем двух молекул нуклеиновой кислоты на одном фрагменте нуклеиновой кислоты, так что функция одной находится под влиянием другой. Например, промотор функциональным образом связан с кодирующей последовательностью, когда он способен влиять на экспрессию этой кодирующей последовательности (то есть, кодирующая последовательность находится под транскрипционном контролем промотора). Кодирующие последовательности могут быть функциональным образом связаны с регуляторными последовательностями в смысловой или антисмысловой ориентации. Термин "регуляторные последовательности" относится к нуклеотидным последовательностям, которые локализованы перед (5'-некодирующие последовательности), в пределах или после (3'некодирующие последовательности) кодирующей последовательности и влияют на транскрипцию, процессинг или стабильность РНК или трансляцию ассоциированной с ними кодирующей последовательности. Регуляторные последовательности могут включать в себя промоторы, операторы, энхансеры, лидерные последовательности трансляции, интроны и последовательности распознавания полиаденилирования. При использовании здесь термин "промотор" относится к нуклеотидной последовательности, способной контролировать экспрессию кодирующей последовательности или РНК. В общем, кодирующая последовательность находится с 3'-стороны от промоторной последовательности. Промоторы могут полностью происходить из нативного гена или они могут состоять из разных элементов, происходящих из разных промоторов, находимых в природе, или даже содержать синтетические нуклеотидные сегменты. Специалисты должны понимать, что разные промоторы могут управлять экспрессией гена в разных типах тканей или клеток, или на разных стадиях развития, или в ответ на разные условия среды. Промоторы, которые вызывают экспрессию фрагмента нуклеиновой кислоты в большинстве типов клеток в большинстве моментов времени, в общем обозначают как "конститутивные промоторы". Далее признано, что, поскольку в большинстве случаев точные границы регуляторных последовательностей определены не полностью, фрагменты нуклеиновой кислоты разных длин могут иметь идентичную промоторную активность. В дополнительном воплощении этого изобретения предложен вектор, содержащий молекулу нуклеиновой кислоты по этому изобретению, работоспособным образом связанную с одной или более чем одной подходящей регуляторной последовательностью. Можно конструировать векторы, содержащие пример изолированной молекулы нуклеиновой кислоты по этому изобретению (или химерный ген по этому изобретению). Выбор вектора зависит от способа, который надо использовать для трансформации клеток-хозяев, от способа, который используют для экспрессии белка, или от другого намеченного применения вектора. Специалист хорошо осведомлен о генетических элементах, которые должны присутствовать на векторе для того, чтобы успешно трансформировать, подвергать селекции и размножать клетки-хозяева, содержащие молекулу нуклеиновой кислоты или химерный ген по этому изобретению. Специалист также должен понимать, что разные независимые случаи трансформации должны приводить к разным уровням и паттернам экспрессии и, таким образом, что множественные случаи надо подвергать скринингу для получения линий, проявляющих желаемый уровень и паттерн экспрессии. Такой скрининг можно осуществлять Southern-анализом ДНК,Northern-анализом экспрессии мРНК, Western-анализом экспрессии белка, среди прочего. В этом изобретении дополнительно предложены микроорганизмы, которые содержат одну или более чем одну молекулу нуклеиновой кислоты по этому изобретению и, следовательно, способны экспрессировать один или более чем один белок по этому изобретению. Такие микроорганизмы могут быть встречающимися в природе микроорганизмами, или еще они могут быть подвергнуты генетическим манипуляциям, чтобы содержать надлежащую молекулу нуклеиновой кислоты по этому изобретению, или генетический конструкт, содержащий надлежащую молекулу нуклеиновой кислоты, или химерный ген по этому изобретению, например, в форме вышеописанных векторов по этому изобретению. Примером микроорганизма, содержащего молекулы нуклеиновой кислоты по этому изобретению,который естественным путем экспрессирует эти молекулы нуклеиновой кислоты, является штаммDSM17874 Acinetobacter sp. (депонирован как DSM 17874 31 января 2006 в Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Германская коллекция микроорганизмов и клеточных культур. Этот штамм также депонирован в DSMZ на условиях Будапештского договора 20 июня 2007 на StatoilASA под номером доступа DSM19446. Таким образом, настоящее изобретение в одном из воплощений относится к штамму DSM17874 Acinetobacter sp. (депонирован как DSM 17874 и как DSM 19446). Дополнительным примером микроорганизма, который содержит одну из молекул нуклеиновой кислоты по этому изобретению, является вид Pseudomonas, депонированный как ТСС 55024. Как обсуждено в примерах, штамм М 1 Acinetobacter sp. и Acinetobacter sp. RAG также содержат молекулу нуклеиновой кислоты, имеющую высокие уровни идентичности последовательностей с SEQ ID NO:1. Такие микроор-8 020184 ганизмы можно описать как эндогенно содержащие одну или более чем одну молекулу нуклеиновой кислоты по этому изобретению. В другом альтернативном воплощении микроорганизм не представляет собой Acinetobacter sp.Pseudomonas, депонированный как ТСС 55024. Или же микроорганизмы можно подвергать генетическим манипуляциям так, что они содержат одну или более чем одну молекулу нуклеиновой кислоты по этому изобретению, и/или так, что они экспрессируют белок, кодируемый одной или более чем одной молекулой нуклеиновой кислоты по этому изобретению. В первом случае кодирующую последовательность, то есть одну или более чем одну молекулу нуклеиновой кислоты по этому изобретению, искусственно вводят в микроорганизм. Она может быть в форме одного или более химерного гена по этому изобретению или одного или более вектора по этому изобретению. Такие микроорганизмы можно описать как экзогенно содержащие одну или более чем одну молекулу нуклеиновой кислоты по этому изобретению. В дополнительной альтернативе микроорганизм эндогенно содержит одну или более молекулу нуклеиновой кислоты по этому изобретению, но этот микроорганизм подвергнут генетическим манипуляциям так, что это изменяет экспрессию продуктов, кодируемых одной или более молекулой нуклеиновой кислоты по этому изобретению. Это можно осуществить, например, введением дополнительной копии молекулы нуклеиновой кислоты по этому изобретению под контролем другого промотора, например сильного промотора или конститутивного промотора, или генетической манипуляцией с промотором,который контролирует экспрессию нуклеиновой кислоты по этому изобретению. В обоих указанных случаях в микроорганизме присутствует генетическое вещество, которое не присутствует в эквивалентном микроорганизме природного происхождения (то есть, присутствует экзогенное генетическое вещество). Поэтому в предпочтительном воплощении микроорганизм содержит экзогенное генетическое вещество, то есть микроорганизм является генетически модифицированным. В общем, экзогенное генетическое вещество вводят способом трансформации. Трансформация должна в типичных случаях включать в себя плазмидный вектор, который также должен содержать ген,который делает возможным идентификацию успешно трансформированных микроорганизмов, например ген устойчивости к антибиотику (например, к ампициллину). Другие способы селекции трансформантов известны специалисту и включают в себя применение светочувствительного вектора, lux-гена, который вызывает свечение положительных колоний в темноте. Другие подходящие носители для трансформации бактерий включают в себя космиды и молекулы бактериофагов. Микроорганизм предпочтительно представляет собой бактерию или архею. Микроорганизмы могут быть экстремофильными, например термофильными. Подходящие микроорганизмы могут также быть галофильными и анаэробными. Подходящие примеры включают в себя серовосстанавливающие бактерии, такие как штаммы Desulfovibrio-, Desulfobulbus-, Desulfobacter, Desulfococcus- и т.д., разные видыBacillus, виды Clostridium, Thermoanaerobacter, Thermoanaerobium, Thermobacteroides, Thermodesulfobacterium, некоторые Pseudomonas и т.д. Некоторые серовосстанавливающие бактерии могут также использовать другие метаболические пути через лактат или ацетат. Особые соображения нужны для клонирования генов в видах Thermus. Для клонирования гетерологичного гена в бактерии Thermus соответствующий ген надо либо (1) клонировать во вставочный вектор между последовательностями, происходящими из Thermus, что после трансформации должно приводить к вставке гена в хромосому гомологичной рекомбинацией, либо (2) вставить в вектор, содержащий точку начала репликации для Thermus. Часто используют челночные векторы, содержащие точку начала репликации как для Е. coli, так и для Thermus, что позволяет конструировать варианты плазмид в E. coli с последующей трансформацией Thermus получившимися вариантами плазмид. Как таковые, общепринятые способы, используемые для клонирования генов в Е. coli, применяют для создания плазмидных конструктов Thermus либо для вставки, либо для репликации. Затем бактерии Thermus трансформируют плазмидной ДНК, изолированной из Е. coli. Два разработанных способа трансформации Thermus раскрыты ниже. В первом использована их натуральная система трансформации, и он основан на способе Koyama etal., 1986, J. Bacteriol. 166:388-340 и Fridjonsson et al., 1999 Appl. Environ. Microbiol. 67:3955-3964). Свежую ночную культуру Thermus разбавляют 1:100 в среде Т 162 (Degryse E. et al., 1978, Arch. Microbiol. 117:189-196). Культуру выращивают при 65 С в течение 3-4 ч в присутствии 2 мМ MgCl2 и CaCl2 соответственно или, пока культура не достигает оптической плотности около 0,8 при 600 нм(OD600).Затем 500 мкл культуры переносят в пробирку Эппендорфа. Затем добавляют в культуре трансформирующую ДНК и встряхивают культуру при 60 С в течение 1-2 ч. Количество ДНК зависит от источника и формы ДНК. Например, можно альтернативно использовать приблизительно 200 нг ДНК, происходящей из Thermus, или 1-3 нг ДНК из E.coli (клонированной ДНК). Затем культуру охлаждают на льду приблизительно 5 мин и высевают на среду Т 162 при использо-9 020184 вании надлежащего селекционного агента(ов) и выращивают при 60 в течение 48 ч. Альтернативный способ основан на электропорации (например Thermus НВ 8 и НВ 27 (de Grado etal., (1999) Piasmid. 42:241-5). Клетки выращивают экспоненциально до OD600 около 0,8 и осаждают центрифугированием при 5000 g в течение 5 мин. Затем промывают клетки два раза в 10%-ном растворе глицерина при комнатной температуре и после второй промывки концентрируют в 10 раз. Это приводит к плотности клеток, достигающей 21010 (НВ 8) и 51010 (НВ 27) соответственно. Аликвоты по 100 мкл клеток инкубируют при 4 С в течение 5 мин с 1 пг ДНК. Клетки подвергают электропорации при использовании силы тока 12,5 кВ/см (максимум) в течение импульса в 5 мс. Эти параметры идентичны условиям Biorad Micropulser при использовании предустановленной программы(Cat. No 165-2100) pp 4). Клеткам дают восстанавливать их состояние в течение 2 ч при 65-70 Х при аэрации и затем высевают на среду Т 162 при использовании надлежащего селекционного агента(ов). Вдобавок к вышеописанным свойствам микроорганизма возможно дополнительно манипулировать микроорганизмом для добавления или удаления ферментативных или других активностей из микроорганизма. Как отмечено выше, можно ввести дополнительный ген, кодирующий, например, белок устойчивости к антибиотику, чтобы помочь процессу селекции генетических трансформантов. Альтернативно или дополнительно, можно также ввести в микроорганизм молекулы нуклеиновой кислоты, которые предназначены влиять на разложение н-алканов или других соединений. Как хорошо известно, введение экзогенных молекул нуклеиновой кислоты в микроорганизм может приводить к тому, что микроорганизм будет иметь активность, которую не находят в немодифицированном микроорганизме (например, если микроорганизм снабжают дополнительной активностью, такой как молекула нуклеиновой кислоты, кодирующая фермент, который не находят в немодифицированном микроорганизме), или экзогенную молекулу нуклеиновой кислоты, которая предназначена для введения,можно сконструировать так, что она вмешивается в нормальную транскрипцию и/или трансляцию одного или более чем одного гена, чей продукт в ином случае должен экспрессироваться в микроорганизме(то есть, экспрессию одного или более чем одного гена в модифицированном микроорганизме снижают,нарушают или элиминируют). Последнее можно осуществить различными способами, такими как разрушение гена после гомологичной рекомбинации или применение антисмысловой или малой интерферирующей РНК. В предпочтительном примере микроорганизм экспрессирует один или более чем один белок по этому изобретению (либо эндогенно, либо по причине введения экзогенных нуклеиновых кислот, как описано выше) и, вдобавок, не экспрессирует гены, которые кодируют ферменты, участвующие в разложении короткоцепочечных н-алканов, или не экспрессирует гены, которые кодируют ферменты, участвующие в разложение среднецепочечных н-алканов или н-алканов с длиной цепи С 20-С 24. Например, микроорганизм может не содержать эндогенные гены, которые кодируют ферменты, которые участвуют в разложении короткоцепочечных н-алканов, или не содержать эндогенные гены, которые кодируют ферменты, участвующие в разложение среднецепочечных н-алканов или н-алканов с длиной цепи С 20-С 24. Такой микроорганизм можно трансформировать при использовании надлежащей молекулы нуклеиновой кислоты так, что он экспрессирует один или более чем один белок по этому изобретению. Альтернативно, микроорганизм может содержать эндогенные гены, которые кодируют ферменты,которые участвуют в разложении короткоцепочечных н-алканов, и/или гены, который кодируют ферменты, участвующие в разложении среднецепочечных н-алканов или н-алканов с длиной цепи С 20-С 24, но в экспрессию одного или более чем одного этого эндогенного гена можно вмешаться, например, при использовании методик, упомянутых выше. Вдобавок микроорганизм должен экспрессировать один или более чем один белок по этому изобретению (либо эндогенно, либо по причине введения экзогенной нуклеиновой кислоты). Во всех случаях ферменты, участвующие в разложении среднецепочечных алканов или короткоцепочечных алканов, могут представлять собой любой фермент, который катализирует по меньшей мере одну стадию этого процесса (например, монооксигеназы, рубредоксины, редуктазы рубредоксинов, алкогольдегидрогеназы, альдегиддегидрогеназы, алкангидроксилазы и ацил-КоА-синтетазы/лигазы жирной кислоты и КоА). Примерами генов, которые кодируют ферменты, участвующие в разложении н-алканов с длиной цепи С 10-С 18, являются гены AlkMa и/или AlkMb (имеющие номера доступа в GenBank DQ009004 иDQ009005 соответственно). Таким образом, предпочтительный микроорганизм является мутантом штамма DSM17874 Acinetobacter sp. (депонирован как DSM 17874), в котором экспрессия генов AlkMa и/или AlkMb была нарушена или модифицирована, например, был получен нокаутный или делеционный мутант по гену AlkMa и/или AlkMb. Дополнительно предпочтительными воплощениями являются штаммы, которые не содержат гены AlkMa и/или AlkMb или их функциональные эквиваленты эндоген- 10020184 но, но которые содержат молекулу нуклеиновой кислоты по этому изобретению (либо эндогенно, либо по причине введения экзогенных нуклеиновых кислот, как описано выше). Белок по этому изобретению или микроорганизмы по этому изобретению (или их клеточные экстракты), описанные выше, можно приготавливать в виде препарата с жидкостью-носителем. Это может быть в форме, в которой белок по этому изобретению или микроорганизмы по этому изобретению наносят на субстрат, содержащий н-алкан. Таким образом, в этом изобретении предложена композиция, содержащая эти компоненты. При рассмотрении в другом аспекте, в этом изобретении предложено применение белка по этому изобретению или микроорганизмов по этому изобретению (или их клеточного экстракта), как описано выше, для изготовления обрабатывающих композиций для разложения длинноцепочечных н-алканов,снижения температуры потери текучести субстрата, содержащего длинноцепочечные н-алканы, или осуществления эстерификации длинноцепочечных н-алканов. Во всех случаях указанный длинноцепочечный н-алкан предпочтительно имеет по меньшей мере 26 или 32 атомов углерода в длину. Известны различные полимерные, олигомерные, неорганические и другие дисперсные носители, к которым можно присоединять белки и/или микроорганизмы, например частицы ионообменной смолы(см. US-A-4787455), частицы акриламидного полимера (см. ЕР-А-193369), желатиновые капсулы (см.US-3676363), олигомерные матрицы и капсулы (см. US-A-4986353 и US-A-4986354), керамические частицы (см. WO 99/54592, WO 96/27070 и ЕР-А-656459) и частицы самого обрабатываемого химического соединения (см. WO 97/45625). При рассмотрении в дополнительном аспекте в этом изобретении, таким образом, предложены частицы, импрегнированные белком по этому изобретению или микроорганизмами по этому изобретению,как описаны выше. Белок по этому изобретению или микроорганизмы по этому изобретению, как описаны выше, можно также присоединить к фильтру (например, для размещения в скважине). В этом изобретении предложен способ разложения длинноцепочечных н-алканов в субстрате, содержащем длинноцепочечные алканы, предпочтительно в неочищенной нефти, включающий экспонирование указанного содержащего длинноцепочечные н-алканы субстрата белку, который способен разлагать длинноцепочечные н-алканы (например, белку по этому изобретению). Как обсуждено выше, этот процесс разложения может иметь несколько следствий, например он может приводить к образованию соединений, содержащих более короткую н-алкановую цепь, например, дополнительных н-алканов, или к образованию сложных эфиров, спиртов, альдегидов и/или кислот. Альтернативно или дополнительно,можно снижать температуру потери текучести субстрата. Субстрат, содержащий длинноцепочечные н-алканы, означает любой субстрат, который содержит один или более чем один длинноцепочечный н-алкан, как определено выше. Предпочтительно этот субстрат представляет собой неочищенную нефть. Он может альтернативно содержать или состоять из очищенных или частично очищенных длинноцепочечных н-алканов, углеводородных фракций (например,углеводородной фракции, которую получают из неочищенной нефти фракционной перегонкой) и растительных и животных жиров или масел. Таким образом ясно, что в модификации разных субстратов в соответствии с этим изобретением имеются различные преимущества. Снижение вязкости субстрата в контексте получения и очистки нефти должно помогать в получении и перемещении нефти. Вдобавок, разложение субстрата, как описано выше, может изменять состав субстрата, например так, что он будет содержать более высокую долю спиртов, кислот, сложных эфиров или альдегидов. Эти различные компоненты можно разделять в соответствии со стандартными способами и использовать для различных химических синтезов. Альтернативно, также известно, что нефть, содержащая окисленные компоненты, может быть более ценной. Следовательно, свойствами субстрата можно манипулировать, как это желательно, путем выбора надлежащего субстрата и контроля экспозиции субстрата белкам, разлагающим н-алканы."Экспонирование" субстрата, содержащего длинноцепочечные н-алканы, белку, который способен разлагать длинноцепочечные н-алканы (например белку по этому изобретению), означает, что субстрат и белок приводят в контакт в надлежащем контексте и в надлежащих условиях так, что это позволяет белку взаимодействовать с компонентом субстрата, представляющего собой длинноцепочечные н-алканы,так что белок может оказывать свое действие, например, на длинноцепочечные н-алканы. Таким образом, субстрат, содержащий длинноцепочечные н-алканы, смешивают или приводят в контакт с надлежащим белком или источником белка в подходящих условиях так, что это делает возможным это взаимодействие. Поэтому подходящий контакт должен быть осуществлен между белком и длинноцепочечным н-алканом так, чтобы это позволило этим двум компонентам взаимодействовать. Таким образом, белок можно просто привести в контакт с субстратом, представляющим собой длинноцепочечный н-алкан, например, его добавлением прямо в субстрат, представляющий собой длинноцепочечный н-алкан. Этот контакт можно осуществить в биореакторе, который может быть периодическим биореактором или непрерывным биореактором. Или же, контакт можно осуществить в процессе промышленного получения нефти, например, в трубе, трубопроводе или скважине. Надо отметить, что во время этого процесса можно использовать любые надлежащие условия, и стадия "экспонирования" субстрата, представляющего собой длинноцепочечный н-алкан, белку по этому изобретению может иметь место в любом надлежащем контексте, например в биореакторе или перемешиваемом баке, или в контексте процесса промышленного получения нефти (например, в трубопроводе,трубе или скважине), в каковом случае стадия экспозиции может иметь место в наклонной скважине. Например, подходящие белки, лизаты или целые микроорганизмы, иммобилизованные или в свободной форме, можно инъецировать в область возле бура. Во всех случаях можно использовать иммобилизованные белки, лизаты или организмы, также как свободные живые организмы, как обсуждено подробно здесь в другом месте. Специалист должен понимать, что необходимое время инкубации, рН, температура, концентрации субстрата и концентрации белка не являются независимыми друг от друга. Таким образом, можно предвидеть большой диапазон условий, который легко может оценить специалист в данной области. В способе по этому изобретению белок, микроорганизм или его клеточный экстракт можно помещать in situ до и/или после субстрата. Предпочтительно белок, микроорганизм или его клеточный экстракт помещают in situ до субстрата, особенно в случае изготовления труб или других сосудов. Вышеописанную стадию экспозиции субстрата надлежащему белку или источнику белка можно осуществить приведением субстрата в контакт прямо с белком, или же приведением субстрата в контакт с микроорганизмом, который способен экспрессировать этот белок. Белок можно экспонировать субстрату в отдельности или в комбинации с одним или более чем одним другим белком. Примеры других белков, которые можно использовать, включают в себя монооксигеназы, рубредоксины и редуктазы рубредоксинов, алкогольдегидрогеназы, альдегиддегидрогеназы, алкангидроксилазы и ацил-КоАсинтетазы/лигазы жирной кислоты и КоА. В дополнительной альтернативе можно использовать экстракт микроорганизма, который способен экспрессировать белок. Подходящие микроорганизмы включают в себя те, которые экспрессируют надлежащий белок (например, белок по этому изобретению), и они обсуждены выше. Можно использовать любые обсужденные выше микроорганизмы. Подходящие формы белка по этому изобретению и его варианты и т.д., которые можно использовать в способах по настоящему изобретению, раскрыты выше. Таким образом, присутствующий белок по этому изобретению может быть во многих разных формах, например изолированным, экстрагированным или очищенным из различных источников или синтезированным различными способами. Например, используемый белок (например, белок по этому изобретению (или его вариант и т.д. может быть синтетическим белком, который был синтезирован химическим способом. Химические синтезы можно осуществлять способами, хорошо известными в данной области, включающими, в случае пептидов, циклические последовательности взаимодействий, представляющих собой снятие защиты с функциональных групп концевой аминокислоты и сочетание селективно защищенных аминокислотных остатков, за чем в конце следует полное снятие защиты со всех функциональных групп. Белки по этому изобретению для применения в этом изобретении могут быть существенно очищенными, например апирогенными, например, более чем на 70%, особенно предпочтительно более чем на 90% чистыми (при оценке, например в случае пептидов или белков, надлежащей методикой, такой как картирование, секвенирование или хроматография пептидов). Очистку можно осуществлять, например, хроматографией (например ВЭЖХ, эксклюзионная, ионообменная, аффинная, гидрофобная, с обращенной фазой) или капиллярным электрофорезом. Рекомбинантная экспрессия белков также хорошо известна в данной области, и подходящую последовательность нуклеиновой кислоты можно использовать для экспрессии подходящего белка (например,белка по этому изобретению (или его варианта, и т.д. для последующей экспрессии и возможной очистки при использовании методик, которые хорошо известны в данной области. Например, надлежащую последовательность нуклеиновой кислоты можно функциональным образом связать с промотором для экспрессии белка в бактериальных клетках, например Е coli. Может быть удобно экспрессировать белок под контролем индуцируемого промотора, в этом случае экспрессию белка надо индуцировать в культуре, чтобы вызвать экспрессию. В качестве альтернативы осуществлению очистки, лизаты или экстракты клеток, экспрессирующих молекулу нуклеиновой кислоты по этому изобретению, могут служить в качестве альтернативного источника белка (например белка по этому изобретению). Клеточные экстракты или лизаты можно получать в соответствии со стандартными методиками, которые известны в данной области, например, обработкой ультразвуком или другими способами разрушения клеток, использованием детергентов. Лизат и/или очищенный белок можно затем смешать с надлежащей жидкостью или раствором для введения в субстрат или добавления к субстрату, который надо ему экспонировать. Это подход является применимым как к рекомбинантным бактериям, так и к бактериям, которые естественно синтезируют белок (например, белок по этому изобретению). Также можно частично очищать или концентрировать подходящий белок из лизата бактерии, которая естественно продуцирует белок или экспрессирует белок рекомбинантным путем. Подходящие примеры осуществления этого для достижения требуемой концентрации или чистоты хорошо известны в данной области техники. Альтернативно, микроорганизм, который экспрессирует подходящий белок, можно привести в кон- 12020184 такт с субстратом, содержащим длинноцепочечный н-алкан. Это подход является применимым как к рекомбинантным бактериям, так и к бактериям, которые естественно синтезируют такой белок (например белок, по этому изобретению). Микроорганизм, лизат или его экстракт или белок можно доставлять на место, где он должен действовать на субстрат, сам по себе или внутри или на частицах, например пористых неорганических частицах (например, кремнезем, глинозем и т. д.) или полимерных частицах, либо в капсулах, например коллоидных, и т.д. Эти частицы-носители могут также нести питательные вещества для бактерий. Такие частицы обсуждены выше и хорошо известны в данной области техники. Как отмечено выше, стадия экспонирования субстрата надлежащему белку может происходить в биореакторе или трубах, или трубопроводах, или в скважине или других сосудах, или еще где-либо в промышленном нефтяном процессе. Стадии способа, который раскрыт выше, можно альтернативно использовать для достижения снижения температуры потери текучести субстрата, содержащего длинноцепочечные н-алканы, такого как неочищенная нефть. Эти стадии способа можно также альтернативно использовать для достижения увеличения потока субстрата, содержащего длинноцепочечные н-алканы, такого как неочищенная нефть, например в трубопроводах, и/или для превращения длинноцепочечных н-алканов в спирты, кислоты и/или сложные эфиры. Указанные выше ссылки на снижение в контексте этих способов означают, что после стадий способа, надлежащий параметр был снижен на любое количество, например, статистически достоверное количество. Например, в связи со снижением температуры потери текучести, это означает, что температуру потери текучести снижают, например, по меньшей мере на 0,1, 0,25, 0,5, 1, 1,5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 или 20 (в F или С) относительно субстрата, который не был экспонирован белку или микроорганизму по этому изобретению. Как обсуждено выше, авторы настоящего изобретения смогли идентифицировать вышеописанный ген, благодаря разработке высокопроизводительного способа скрининга, который позволил им идентифицировать гены, которые участвуют в разложении субстратов, представляющих собой длинноцепочечный н-алкан. В этом способе использованы мутантные штаммы, которые тестируют на их способность расти на субстратах в две или более чем две стадии селекции, и комбинация этих двух стадий позволяет идентифицировать мутации, которые специфично влияют на способность мутации, присутствующей в каждом мутантном штамме, влиять на рост на одном конкретном субстрате. Субстраты выбирают так,что немутированный или родительский штамм может расти на каждом субстрате, который используют в способе селекции (например, длинноцепочечном н-алкане, таком как н-алкан С 32, и среднецепочечном н-алкане, таком как н-алкан С 16). Ген, представляющий интерес, распознают идентификацией мутантных штаммов, которые не растут на одном субстрате (например, длинноцепочечном н-алкане, таком как н-алкан С 32), но являются жизнеспособными на другом субстрате (например, среднецепочечном налкане, таком как н-алкан С 16). Таким образом, мутантные штаммы, которые имеют эти свойства, содержат мутацию, которая является специфичной для пути разложения только одного субстрата. Таким образом, комбинация стадий селекции в этом способе устраняет идентификацию мутантов, которые содержат мутации, которые влияют на общую жизнеспособность клетки и не являются специфичными для разложения субстрата, представляющего интерес. Таким образом, в этом изобретении предложен способ идентификации гена в микроорганизме, кодирующего белок, необходимый для метаболизма субстрата, включающий стадии, на которых: а) предоставляют библиотеку мутантных штаммов бактерий, которые получены мутагенезом родительского штамма микроорганизмов,б) подвергают эти мутантные штаммы совокупности условий роста для отрицательной селекции,в) идентифицируют клоны, ущербные по росту или нежизнеспособные в этой совокупности условий роста,г) подвергают эти мутантные штаммы совокупности условий роста для положительной селекции,д) идентифицируют клоны, которые могут расти или являются жизнеспособными в этой совокупности условий роста, и е) идентифицируют мутировавший ген в идентифицированных клонах, причем родительский микроорганизм растет или является жизнеспособным, когда его подвергают совокупности условий роста для отрицательной селекции, и растет или является жизнеспособным, когда его подвергают совокупности условий роста для положительной селекции, и причем совокупность условий роста для отрицательной селекции является такой, что присутствует субстрат, представляющий интерес, и совокупность условий рост для положительной селекции является такой, что отсутствует субстрат, представляющие интерес, и присутствует другой субстрат. Указанный способ можно использовать для идентификации генов в любом микроорганизме. Предпочтительно микроорганизм представляет собой бактерию или архею. В экспериментальных условиях микроорганизмы могут расти на различных субстратах или ростовых средах. Во многих случаях возможен рост микроорганизмов на очень простой смеси питательных веществ и солей. В то время как в естественных условиях любой конкретный микроорганизм может расти, метаболизируя или разлагая многочисленные источники углерода и энергии, которые присутствуют там, где он растет, узнать больше о конкретных метаболических требованиях микроорганизмов можно выращиванием микроорганизмов на базальной или минимальной ростовой среде и обогащая базальную ростовую среду конкретным субстратом или хорошо определенной совокупностью субстратов. Затем определяют способность микроорганизмов расти на этих субстратах. Например, базальную ростовую среду можно обогатить конкретным н-алканом в виде жидкости или твердого вещества в отдельности или в комбинации с другими н-алканами или другими субстратами. Часто имеет место ряд субстратов, на которых может расти микроорганизм, и способность микроорганизма расти на любом одном субстрате указывает на то, что этот микроорганизм имеет один или более чем один ген, который кодирует белок, который может разлагать этот субстрат. Аналогичным образом, неспособность мутантного штамма микроорганизма расти на таком субстрате может указывать на то, что этот мутантный штамм имеет мутацию в гене, которая влияет на способность штамма разлагать субстрат, на котором его выращивают, или еще что он может иметь мутацию в гене, который иным образом влияет на жизнеспособность штамма. Как обсуждено выше, способ по этому изобретению различает мутации в генах, которые являются специфичными для разложения конкретного субстрата, и в генах,которые иным образом влияют на рост и/или жизнеспособность клеток. Более того, поскольку метаболические пути в микроорганизмах не являются все отдельными линейными путями, в микроорганизме существуют белки, которые нужны микроорганизму для способности метаболизировать множество родственных или отличных субстратов (как в пути alk, где имеют место несколько копий исходного фермента, гидроксилирующего алканы, AlkM). Эти варианты одного и того же фермента имеют слегка разные субстратные специфичности. После исходной стадии последующее разложение идет одним и тем же путем. Способ, описанный выше, учитывает это наличием стадии контрселекции (положительной селекции). Два субстрата, используемые для стадий отрицательной и положительной селекции, можно выбрать так, чтобы идентифицировать белок,который находится в метаболическом пути субстрата, представляющего интерес, в соответствующем положении. Например, если надо идентифицировать белок, который нужен для метаболизма субстрата,представляющего собой н-алкан С 32, то выбирают родительский штамм, который растет на этом субстрате, а также на другом субстрате, таком как субстрат, который представляет короткоцепочечный (например С 6) н-алкан или среднецепочечный н-алкан (например С 16), и мутантные штаммы тестируют на их способность расти на этих двух субстратах. Такой способ должен идентифицировать гены, кодирующие белки, который являются необходимыми для разложения н-алканов С 32, но не для разложения налканов С 16, и его использовали для идентификации генов по этому изобретению, и, хотя возможно, что такой способ может идентифицировать гены, чьи продукты нужны для метаболизма н-алканов С 32, 36,20 и 24, продукт гена almA, оказывается ненужным, по меньшей мере, для роста на алканах С 20 и С 24,хотя он нужен для роста на алканах С 32 и С 36 (см. Пример 2). Если требуется идентифицировать белок, который специфично необходим для метаболизма субстрата, представляющего собой н-алкан С 32, но не другие длинноцепочечные алканы, такие как алканы С 20 и С 24, можно осуществить стадию контр-селекции на таком субстрате, как С 20 и/или С 24, или еще можно осуществить одну или более чем одну дополнительную стадию контр-селекции на дополнительных субстратах, таких как С 20 и/или С 24. Действительно, в примере 2 стадия исходной селекции была основана на отсутствии роста мутантных клонов на С 32, но наличии роста на С 16. Дополнительную характеризацию ростовых способностей мутантов (выращиванием их на выборке разных субстратов) также можно осуществлять для сужения процедуры селекции, и экспозицию этим разным условиям роста можно осуществлять параллельно или последовательно. Ввиду указанных соображений можно видеть, что "необходимый для метаболизма" означает любую молекулу, такую как белок (в частности, фермент), которая необходима микроорганизму для роста на определенном субстрате, но не является таковой для общей жизнеспособности клетки. Предпочтительно этот способ используют для идентификации молекул, например белков, которые необходимы для специфичного метаболизма определенного субстрата в том смысле, что они не нужны для метаболизма других отличающихся субстратов. Поэтому этот способ предпочтительно используют для идентификации молекул, например генов, кодирующих белки, которые необходимы для роста на длинноцепочечных налканах (или по меньшей мере одном длинноцепочечном н-алкане), но не нужны для роста на среднеили короткоцепочечных н-алканах. Более предпочтительно этот способ используют для идентификации генов, кодирующих белки, которые необходимы для роста на длинноцепочечных н-алканах (или, по меньшей мере, одном длинноцепочечном н-алкане), имеющих по меньшей мере 26, 28, 30, 32 или 34 атома углерода, но не нужны для роста на н-алканах с более короткими цепями, таких как С 24 или С 16. Из вышеизложенного ясно, что специалист должен быть способен идентифицировать и выбрать надлежащую комбинацию микроорганизма и субстратов на основании предоставленной выше информации так, чтобы быть способным осуществить этот способ для того, чтобы идентифицировать ген, имеющий конкретное свойство. Библиотека означает коллекцию или совокупность индивидов. Мутантные штаммы, которые явля- 14020184 ются членами библиотеки, все происходят из одного и того же родительского штамма в том смысле, что получены мутагенезом одного и того же родительского штамма. Таким образом, они имеют общие характеристики и признаки с родительским штаммом, но отличаются в том, что содержат мутации в своем геноме. Мутации можно вызывать любым удобным способом, таким как экспозиция родительского штамма химическим мутагенам, или инсерционный мутагенез, такой как применение транспозонного мутагенеза,как указано в примере 1. Предпочтительно мутагенез осуществляют так, что каждый член библиотеки содержит единичную мутацию. Как обсуждено выше, условия роста выбирают так, что в первой совокупности условий роста присутствует субстрат, представляющий интерес. Этот субстрат можно добавить к ростовой среде в любой подходящей форме. Например, твердые н-алканы можно добавлять в виде порошка на ростовую среду на поверхности твердой ростовой среды или в виде капель в жидкую ростовую среду, и жидкие н-алканы можно добавлять в виде капли жидкости либо в твердую, либо в жидкую ростовую среду. Ростовой средой может быть любая стандартная основная или минимальная среда, которая делает возможным рост микроорганизма при добавлении подходящего источника углерода в форме добавленного субстрата, представляющего интерес. Можно также добавлять, где необходимо, другие подходящие добавочные соединения (например, антибиотики для селекционных целей). Примеры подходящих субстратов включают в себя длинноцепочечные н-алканы, например один или более чем один н-алкан С 20, С 22, С 24, С 26, С 28, C3D, С 32, С 34, С 36, С 38, С 40, С 42, С 44. Как обсуждено выше, подходящие субстраты выбирают в зависимости от природы гена, который надо идентифицировать. Субстрат, представляющий интерес, добавляют к ростовой среде в соответствующей концентрации для возможности постоянного роста в течение достаточного времени для образования колонии, например, в течение по меньшей мере 2-3 суток, предпочтительно, по меньшей мере 3-5 суток. В общем, для этой стадии культуры клоны высевают, например, в 96-луночные планшеты или планшеты Omnitray так, что местоположение каждого клона в пределах планшета является известным. Сохранение реплик планшетов должно быть полезным для возможности пересева идентифицированных клонов. Можно использовать любой подходящий культуральный аппарат, который делает возможным последующее осуществление идентификации клонов. В общем, штаммы инкубируют в течение 2-3 суток в подходящих условиях культивирования (например, приблизительно 30 или 37 С, 70-75 С или 65, в зависимости от природы микроорганизма). Эту стадию можно осуществлять параллельно для более чем одного субстрата или источника углерода, в зависимости от природы гена, который надо идентифицировать, например должно быть возможно выращивать клоны как на С 16, так и на С 32 одновременно, и затем идентифицировать те, которые были способный расти на С 16, но не на С 32, чтобы подвергнуть их дополнительному анализу. Как обсуждено выше, условия роста выбирают так, что в положительной совокупности условий роста отсутствует субстрат, представляющий интерес, и присутствует альтернативный источник углерода или субстрат. Как это имеет место и в случае первого субстрата (то есть, субстрата, представляющего интерес), альтернативный субстрат можно добавлять к ростовой среде в любой подходящей форме. Как уже обсуждено выше, ростовая среда может представлять собой любую стандартную минимальную среду, которая делает возможным рост микроорганизма при добавлении подходящего источника углерода в форме добавленного субстрата, представляющего интерес. Ростовая среда для этой совокупности условий может быть такой же (не считая добавленного субстрата) или другой, чем ростовая среда для отрицательной совокупности условий роста, но предпочтительно, она является такой же, то есть, она имеет тот же состав. Также можно добавлять, где необходимо, другие надлежащие добавочные соединения, (например антибиотики для селекционных целей). Примеры подходящих субстратов для включения во вторую совокупность условий роста включают в себя короткоцепочечные н-алканы, среднецепочечные н-алканы или длинноцепочечные алканы с менее чем 30 атомами углерода, например один или более чем один н-алкан С 6, С 8, С 10, С 12, С 14, С 15, С 18,С 20, С 22, С 24, С 26, С 28. Дополнительной альтернативой является использование ацетата, поскольку это позволяет исключать любые мутанты, несущие мутации в генах "домашнего хозяйства". Как обсуждено выше, подходящие субстраты можно выбирать в зависимости от природы гена, который надо идентифицировать, например, генов, кодирующих белки, участвующие в метаболических путях, общих для всех микроорганизмов. Субстрат, представляющий интерес, добавляют к ростовой среде в надлежащей концентрации для возможности постоянного роста в течение по меньшей мере 2-3 суток, предпочтительно по меньшей мере 3-5 суток. В общем, для этой стадии культуры клоны высевают, например в 96-луночные планшеты или планшеты Omnitray так, что местоположение каждого клона в пределах планшета является известным. Реплики планшетов можно сохранять для возможности пересева. В общем, штаммы инкубируют в течение 2-3 суток в соответствующих условиях культивирования(например, приблизительно 30 или 37 С, 70-75 С или 65, в зависимости от природы микроорганизма). Как обсуждено выше, идентифицированные клоны можно подвергать дополнительной стадии селекции на основании природы гена, который надо идентифицировать. Например, если ищут ген, участвующий в метаболизме н-алканов С 32, первая совокупность условий роста может представлять собой рост на С 32, условия контр-селекции или второй стадии роста могут представлять собой рост на С 16, и то, что не растет на С 32, но растет на С 16, можно затем подвергать выращиванию на дополнительных налкановых субстратах, таких как С 20 или С 24. Такие дополнительные стадии можно осуществлять, например, если число клонов, которые идентифицированы на стадии (д), является большим. Дополнительной альтернативой является использование ацетата, поскольку это позволяет исключать любые мутанты,несущие мутации в генах" домашнего хозяйства", например генов, кодирующих белки, участвующие в метаболических путях, общих для всех микроорганизмов. На стадиях (в) и (г), указанных выше, делают различие между "ущербными по росту" клонами и теми, которые являются жизнеспособными. На каждой этой стадии необходимо идентифицировать те клоны, которые могут расти в конкретных условиях роста, которым их подвергали. Это означает, что клоны, которые не способны расти или выживать на конкретном субстрате, отличаются от тех, которые способны расти. Жизнеспособные клетки, которые растут в конкретных использованных условиях роста, можно идентифицировать наблюдением измеримого или детектируемого количества клеточного роста, например, может иметь место статистически достоверное увеличение числа клеток, например, по меньшей мере пятикратное, десятикратное, двадцатикратное, тридцатикратное или пятидесятикратное увеличение числа клеток, например, при измерении надлежащим способом, например спектрофотометрическим определением увеличения поглощения клеточной культурой (например ростовой средой) или увеличения оптической плотности, например OD600, или другими спектрофотометрическими или колориметрическими анализами на белки или другие клеточные компоненты, например, окрашиванием колоний соединением, которое может детектировать жизнеспособные клоны, таким как INT (хлорид йоднитротетразолия) или измерением количества белка на литр культуры. Этот рост можно детектировать любым удобным или желательным способом. Клон признают ущербным по росту, если после инкубации в определенных условиях роста отсутствует увеличение числа клеток, если после инкубации в определенных условиях роста имеет место только ограниченное увеличение числа клеток, и/или если после инкубации в определенных условиях роста отсутствует детектируемых живых клеток. Нежизнеспособные клоны определяют по отсутствию детектируемых живых клеток после инкубации в определенных условиях роста. Ограниченное увеличение должно относиться к малому числу делений клеток, например, представляющему собой 2-5 делений клеток. Идентификацию растущих и нерастущих, и жизнеспособных и нежизнеспособных клонов можно облегчить с помощью соответствующих контролей. Например, в качестве положительного контроля параллельно с тестируемыми планшетами на каждой стадии культуры можно реплицировать клоны в контрольный планшет и инкубировать в условиях, которые известны поддержанием роста родительского штамма, предпочтительно, в условиях, в которых нельзя ожидать, что на рост любых мутантных штаммов влияют мутации гена, представляющего интерес. В этих условия должны расти все штаммы. Подходящей ростовой средой для применения в таком положительном контроле должна быть ростовая среда,которая содержит смесь разных источников углерода, такая как широко распространенный бульон LB. Дополнительным положительным контролем является использование родительского штамма и измерение или наблюдение роста этого штамма в различных условиях тестовой культуры. Негативную пробу или планшет можно помещать в условия, которые известны тем, что не поддерживают рост родительского штамма, например, это основная или минимальная ростовая среда без любого дополнительного источника углерода. Сравнения количества роста, наблюдаемого в этих положительных и отрицательных контролях, с клонами должны помочь в определении того, считать или не считать любой конкретный клон ущербным по росту или жизнеспособным в любых конкретных условиях тестирования. Клоны можно экспонировать условиям роста в любом порядке, то есть, стадия культивирования и ассоциированная с ней стадия идентификации клонов, которые являются ущербными по росту в совокупности культуральных условий для отрицательной селекции, могут иметь место до, после или параллельно стадии для идентификации клонов, которые являются жизнеспособными в совокупности условий культуры для положительной селекции. Однако последовательное осуществление этих стадий облегчает этот процесс, поскольку каждая стадия идентификации будет исключать необходимость в дополнительном исследовании конкретных клонов. Как таковой, в предпочтительном воплощении, это способ содержит стадии, на которых: а) предоставляют библиотеку мутантных штаммов бактерий, которые были получены мутагенезом родительского штамма микроорганизмов,б) подвергают мутантные штаммы совокупности условий роста для отрицательной селекции,в) идентифицируют клоны, которые являются ущербными по росту или нежизнеспособными в этой совокупности условий роста,г) подвергают клоны, идентифицированные на стадии (в) совокупности условий роста для положительной селекции,д) идентифицируют клоны, которые могут расти или являются жизнеспособными в этой совокупности условий роста, и е) идентифицируют ген, который является мутированным в идентифицированных клонах,причем родительский микроорганизм может расти или является жизнеспособным, когда его подвергают совокупности условий роста для отрицательной селекции, и может расти или является жизнеспособным, когда его подвергают совокупности условий роста для положительной селекции, и причем совокупность условий роста для отрицательной селекции является такой, что присутствует субстрат,представляющий интерес, и совокупность условий роста для положительной селекции является такой,что отсутствует субстрат, представляющий интерес, и присутствует другой субстрат. В дополнительном предпочтительном воплощении этот способ включает стадии, на которых: а) предоставляют библиотеку мутантных штаммов бактерий, которые были получены мутагенезом родительского штамма микроорганизмов,б) подвергают мутантные штаммы совокупности условий роста для положительной селекции,в) идентифицируют клоны, которые могут расти или являются жизнеспособными в этой совокупности условий роста,г) подвергают клоны, идентифицированные на стадии (в) совокупности условий роста для отрицательной селекции,д) идентифицируют клоны, которые являются ущербными по росту или нежизнеспособными в этой совокупности условий роста,г) идентифицируют ген, который является мутированным в идентифицированных клонах,причем родительский микроорганизм может расти или является жизнеспособным, когда его подвергают совокупности условий роста для отрицательной селекции, и может расти или является жизнеспособным, когда его подвергают совокупности условий роста для положительный селекции, и причем совокупность условий роста для отрицательной селекции является такой, что присутствует субстрат,представляющий интерес, и совокупность условий роста для положительной селекции является такой,что отсутствует субстрат, представляющий интерес, и присутствует другой субстрат. Как обсуждено выше, можно добавлять дополнительные стадии селекции, как подходит. После идентификации мутантных клонов, которые отвечают требованиям этого способа к росту,идентифицируют ген, который был разрушен или мутирован в клоне. Это можно осуществлять при использовании стандартных методик молекулярной биологии, известных в данной области, например, способами на основе ПЦР и/или Southern-блоттинга. Если библиотека мутантов была генерирована транспозонным мутагенезом, должно быть возможно в помощь клонированию мутированной области использовать известные последовательности из последовательности транспозона. Таким образом, этот способ возможно включает в себя дополнительные стадии клонирования и секвенирования мутированного гена. Это изобретение теперь будет описано подробнее в следующих неограничивающих примерах, в которых: На фиг. 1 показана физическая карта pLOFKm. Указаны ген транспозазы и маркер устойчивости к канамицину; mini-Tn10 фланкирован двумя вставочными последовательностями IS10. На фиг. 2 показано изображение планшета Omnitray, заполненного твердой средой СВ с С 32, нанесенном на ее верх в виде порошка. Клетки реплицировали на этот планшет из 96-луночного планшета и выращивали в течение ночи при 30 С. Затем приблизительно 20 мл верхнего агара INT наносили для детектирования жизнеспособных клеток. Некоторые пятна колоний отсутствуют из-за остановки роста соответствующих клонов в выбранных условиях (показывая отсутствие роста этих колонии на С 32). На фиг. 3 показаны физические карты pSOK804 (А) и pLAL50 (В). Ori: точка начала репликацииpBR322; AmR: маркер, придающий устойчивость к апрамицину; oriT: точка начала переноса. Указаны рестрикционные сайты (Xbal и ВатHI) и клонированные фрагменты. На фиг. 4 показаны кривые роста штаммов Acinetobacter sp. DSM17874 (дикий тип), AVM1004A7(мутированный транспозоном штамм) и MAV1 (штамм, нокаутный по almA), выращиваемых в среде СВ с антибиотиками и С 20, С 24, С 32 и С 36 в качестве исключительных источников углерода. На фиг. 5 показано схематическое изображение окружающих областей для гомологичных генов almA в Acinetobacter venetianus 6A2 (Acinetobacter sp. DSM17874) и ACIAD3192 в Acinetobacter sp. ADP1 обозначает предполагаемую монооксигеназу из флавин-связывающего семейства. rpsM, rpsK, rpoA иrplQ представляют собой рибосомальные белки, fadE кодирует ацил-СоА-дегидрогеназу. almB представляет собой потенциально секретируемый белок с пока еще неизвестной функцией. Участие Orf1 (AlmB) в метаболизме алканов, возможно связанное с AlmA, в настоящее время исследуется. Непомеченные элементы являются теоретическими. На фиг. 6 показана нуклеотидная последовательность кодирующей области almA. На фиг. 7 показана пептидная последовательность белка AlmA. На фиг. 8 показана нуклеотидная последовательность кодирующей области orf1 (almB). На фиг. 9 показана пептидная последовательность белка Orf1 (AlmB). На фиг. 11 показана пептидная последовательность М-1 AlmA Acinetobacter sp. На фиг. 12 показана нуклеотидная последовательность М-1 AlmA Acinetobacter sp. На фиг. 13 показаны результаты комплементации активности almA в дефицитном по almA мутанте(Б). Рост измеряли по увеличению белка в культурах с течением времени. Представленные величины являются средними по двум независимым экспериментам. Примеры Пример 1. Получение транспозонной библиотеки Acinetobacter venetianus 6A2 (Acinetobacter sp.DSM17874) Транспозонную библиотеку штамма DSM17874 Acinetobacter sp. конструировали конъюгационным переносом Е. coli S17-1 ( pir), несущей плазмиду, содержащую pLOFKm, в штамм DSM17874 Acinetobacter sp. и селекцией по хромосомной интеграции транспозона.Acinetobacter sp. DSM17874 пересевали из культуры в 25%-ном глицерине при -80 С на LBпланшеты, содержащие 25 мкг/мл хлорамфеникола. Е. coliS17-1 ( pir), несущие плазмиду pLOFKm (фиг. 1), пересевали из культуры в 25%-ном глицерине при -80 С на LB-планшеты, содержащие 150 мкг/мл ампициллина и 75 нг/мл канамицина. Оба типа планшетов инкубировали в течение ночи при 30 С. 50 мл среды LB (на литр: 10 г триптона, 5 г дрожжевого экстракта, 10 г NaCl; для планшетов: дополнительно 15 г/л бактериального агара), содержащей указанные концентрации антибиотиков, инокулировали веществом из планшетов и инкубировали в течение ночи при 30 С. На следующие сутки 50 мл среды LB, содержащей указанные концентрации антибиотиков, инокулировали при использовании 500 мкл из двух 50-мл предварительных культур. Культуру Е. coli начинали через 2 ч после культуры 6 А 2. После роста Acinetobacter sp. DSM17874 в течение 4,5 ч и Е. coli S17-1( ,pir)/pLOFKm в течение 2,5 ч культуры показали OD600 приблизительно 0,4. По 1 мл каждой из двух культур смешивали и центрифугировали при 8000 об/мин, 5 мин, К.Т. Осадок ресуспендировали в 100 мкл среды LB и помещали в виде капли на верх LB-планшета, содержащего 500 мкМ изопропилОтиогалактопиранозида (IPTG). Планшет герметизировали парафильмом и инкубировали вверх дном при 30 С в течение ночи. На следующие сутки клетки собирали из LB/IPTG-планшета в 500 мкл среды LB и высевали в разведениях на LB-планшеты, содержащие 150 мкг/мл ампициллина и 75 мкг/мл канамицина (105, 106, 107),содержащие 25 мкг/мл хлорамфеникола (105, 106, 107), и на транспозон-селективные планшеты. Для последних из них 43 порции по 100 мкл разведений 10 высевали на 43 больших LB-планшета, содержащих 25 мкг/мл хлорамфеникола, 75 мкг/мл канамицина и 500 мкМ IPTG. Все планшеты инкубировали в течение ночи при 30 С. На следующие сутки соотношение донора и реципиента определяли как 1:587, и суммарное число изолированных клонов определяли как составляющее приблизительно 6800. Эти клоны из транспозон-селективных планшетов собирали и при использовании робота Qpix переносили в 71 96 луночный планшет (AVM1A-AVM71A), которые содержали на лунку 150 мкл среды LB, содержащей 75 мкл/мл канамицина. Эти планшеты в количестве 71 формировали AVM-библиотеку. Планшеты инкубировали в течение ночи при 30 С со встряхиванием при 500 об/мин в инкубаторе при 85% влажности. Планшеты реплицировали в новые 96-луночные планшеты, содержащие 150 мкл среды LB с 75 мкг/мл канамицина на лунку. Эти так называемые планшеты серии Б (AVM1B-AVM71B) снова инкубировали при 30 С со встряхиванием при 500 об/мин в инкубаторе при 85% влажности в течение ночи. После репликации исходных планшетов с получением серии Б и репликации для эксперимента со скринингом по С 32 (см. ниже) исходные планшеты и планшеты серии Б после добавления 50 мкл 50%-ного глицерина на лунку и герметизации планшетов замораживали при -80 С. Пример 2. Высокопроизводительный скрининг на штаммы, ущербные по росту на С 32 Для эксперимента по высокопроизводительному скринингу исходные библиотечные планшеты отAVM1A до AVM71A реплицировали в планшеты Omnitray с твердой средой СВ (на литр: 3 г NaNO3, 1 гK2HPO4, 0,5 г MgSO4, 0,5 г KCl, 0,01 г FeSO4; для планшетов: дополнительно 15 г/л бактериального агара), содержащие 75 мкг/мл канамицина, на которые добавляли алкан С 32 в виде порошка при использовании стерильного чайного ситечка. Твердый алкан получали помещением стерильных капель н-алкана в стерильную ступку, добавлением жидкого азота и тщательным перетиранием капель. Планшеты инкубировали при 30 С в течение двух (AVM36A-AVM71 А) и трех суток (AVM1A-AVM35A) соответственно. Для идентификации клонов в AVM-библиотеке, не способных расти на С 32, реплицированные планшеты Omnitray, содержащие твердую среду СВ (75 мкг/мл канамицина, добавлен алкан С 32), окрашивали добавлением приблизительно 20 мл верхнего агара с INT (среда СВ, 0,05% INT, 1,5% агара) к каждому планшету Omnitray. После нескольких минут "колонии" становились видимыми, проявляя красную окраску (пример см. фиг. 2). Мутанты, которые показали плохой рост или отсутствие роста при использовании алкана С 32 в ка- 18020184 честве единственного источника углерода (475 клонов), переносили при использовании робота Qpix (Genetix) в 6 96-луночных планшетов со 120 мкл среды LB, содержащей 75 мкг/мл канамицина, на лунку. Перенос делали при использовании планшетов AVM1B-AVM71B серии Б, которых во время перенесения оттаивали и снова замораживали. После переноса инкубировали планшеты (AVM1001-AVM1004 для клонов без роста и AVM1005-AVM1006 для клонов с плохим ростом) в течение ночи при 30 С со встряхиванием при 500 об/мин в инкубаторе при 85%-ной влажности. Клоны из планшетов после переноса AVM1001-AVM1006 реплицировали на нижеследующие планшеты Omnitray:LB + 75 мкг/мл канамицина + 25 мкг/мл хлорамфеникола; СВ + 75 мкг/мл канамицина + 0,5 % ацетата натрия; СВ + 75 мкг/мл канамицина + алкан С 16 (400 мкл алкана С 16 наносили на крышки для планшетов,капли получали автоклавированием твердых н-алканов и пипетированием жидкости 50-мкл аликвотами на стерильную чашку Петри); СВ + 75 мкг/мл канамицина + алкан С 32 (алкан С 32 добавляли в виде порошка). Планшеты инкубировали в течение ночи при 30 С. Это высевание реплик с контр-селекцией необходимо для идентификации клонов с нарушенным или отсутствующим ростом только на алкане С 32. Идентификация генов, участвующих в разложении длинноцепочечных алканов, возможна только из мутантных клонов, показывающих нарушенный рост исключительно на длинноцепочечных алканах и проявляющих нормальный рост на более короткоцепочечных алканах и на комплексной среде. Эта процедура исключает мутантные клоны с транспозонными нарушениями в генах, не участвующих в разложении алкана С 32. Из реплицированных планшетов 20 клонов показали отсутствие роста на алканах С 16 и С 32 и нормальный рост на среде LB и на среде СВ, содержащей ацетат. 34 клона не росли при использовании алкана С 32 в качестве единственного источника углерода, но показали рост на алкане С 16, LB и СВ + ацетат. Эти последние 34 клона характеризовали дополнительно в отношении роста на различных алканах. По 1 мкл (при использовании 1-мкл инокуляционных петель) каждого из 34 мутантов ресуспендировали в 200 мкл среды LB. Эти клеточные суспензии использовали для посева штаммов на твердую среду СВ, содержащую 75 мкг/мл канамицина с добавлением одного из нижеследующих источников углерода: 0,5%-ный ацетат, алканы С 12, С 16, С 20, С 22, С 24, С 32, С 36. Жидкие алканы добавляли в виде 400 мкл на покрышки, твердые алканы добавляли в виде порошков. Планшеты инкубировали при 30 С. Рост клонов регистрировали, и 12 мутантных штаммов, все еще растущих на алкане С 24 и в то же время не растущих на алканах С 32 и С 36, выбирали для дополнительного анализа. 123 мл среды LB, содержащей 25 мкг/мл хлорамфеникола и 75 мкг/мл канамицина, инокулировали 12-ю соответствующими мутантными штаммами (AVM1001H3, Е 6, А 11; AVM1002C8, AVM1003E4, F5, G6; AVM1004A2, С 4, D5,А 6, А 7). Культуры инкубировали в течение ночи при 30 С и 200 об/мин на встряхиваемом инкубаторе для консервации штаммов и получения хромосомной ДНК. После инкубации клоны замораживали при 80 С при конечной концентрации глицерина 25%. Пример 3. Идентификация almA Из 2 мл каждой из 11 культур, указанных выше, получали хромосомную ДНК при использовании набора DNAeasy Tissue Kit (Qiagen) в соответствии с протоколом для грамотрицательных бактерий. Хромосомную ДНК расщепляли рестриктазой HindIII и затем снова лигировали после термальной инактивации этой эндонуклеазы. ПЦР на лигатах при использовании олигонуклеотидовKan1(5'GCTCTAGACCGTCAAGTCAGCGTAATGC-3' SEQ ID NO:6) и Tn10:1 (5'-GGATCATATGACAAGATGTG-3' SEQ ID NO:7) в качестве праймеров давала продукты ПЦР для AVM1001H3, AVM1001E6, AVM1003E4, AVM1003F5, AVM1003G6,AVM1004A2 (2 продукта), AVM1004A6, AVM1004C4, AVM1004D5 и AVM1004A7). Продукты ПЦР изолировали после гель-электрофореза на агарозе при использовании набора Qiaquick Gel Extraction Kit (Qiagen). Прямое секвенирование осуществляли на очищенных продуктах ПЦР при использовании олигонуклеотидов Tn10:1AVMS3 и 7 (AVM1001E6 и AVM1004A2) не дали читаемых последовательностей и были анализированы снова как AVMS15 и AVMS16, 17 на новой партии продуктов ПЦР. AVMS1, 6, 8 и 9 (AVM1001H3, AVM1003G6,AVM1004C4, AVM1004D5) оказались идентичными. Полученные последовательности использовали для поиска в базе данных BlastN. Клон AVM1004A7, несущий транспозонное нарушение в предполагаемом гене монооксигеназы(позже названном как almA), потенциально участвующем у Acinetobacter sp. DSM17874 в разложении длинноцепочечных алканов, исследовали в отношении роста на длинноцепочечных алканах в сравнении со сконструированным нокаутным мутантным штаммом MAV1. На основании результатов исходного секвенирования AVM1004A7 можно определить олигонуклеотиды для амплификации хромосомной ДНК вокруг сайта вставки транспозона. На продукте ПЦР, полученном с олигонуклеотидами AVM1004A7-1 (5'-ACCCTGTACAACCCATTACG-3' SEQ ID NO:8) иAVM1004A7-2 (5'-AGTTGTGATCATCGGCAGTG-3' SEQ ID NO:9), секвенирование осуществляли при использовании AVM1004A7-1 и AVM1004A7-2 (AVMS 13-14) в качестве праймеров секвенирования. Результаты расширили известную информацию последовательности almA до приблизительно 600 пар нуклеотидов, достаточных для конструирования нокаутного мутантного штамма (MAV1) при использовании вектора самоуничтожения. Пример 4. Конструирование нокаутного мутантного штамма almA MAV1 Для получения нокаутного мутантного штамма almA надо клонировать достаточно длинную последовательность ДНК almA в вектор, не способный к репликации в Acinetobacter sp. DSM17874 и переносимый из Е. coliS17-1 (A- pir) в Acinetobacter sp. DSM17874 конъюгацией. Вектором, соответствующим этим требованиям, является pSOK804 (Sekurova et al., 2004, J Bacteriol 186(5): 1345-54, фиг. 5 А). При использовании хромосомной ДНК Acinetobacter sp. DSM17874 в качестве матрицы осуществляли ПЦР при использовании олигонуклеотидов AVM1004A7-3 5'-GCTCTAGACTATCCTGGTATTCGTTCAG-3' SEQID NO:10) и AVM1004A7-4 5'-CGGGATCCTAAATACCACGTTGC ATACC-3' SEQ ID NO:I 1) в качестве праймеров. Продукт ПЦР изолировали из агарозного геля при использовании набора Qiaquick Gel Extraction Kit (Qiagen). Продукт ПЦР и вектор pSOK804 расщепляли рестриктазами BamHI и Xbal. Фрагмент вектора и расщепленный продукт ПЦР изолировали гель-электрофорезом и далее экстракцией из геля при использовании набора Qiaquick Gel Extraction Kit (Qiagen). Вектор и продукт ПЦР лигировали с получением плазмиды pLAL50 (фиг. 3 В). Компетентные клетки Е. coli S17-1 ( pir) трансформировали продуктом лигирования. Плазмидную ДНК получали из трансформантов и клонирование фрагмента almA подтверждали рестрикционным анализом. Конъюгацию между Acinetobacter sp. DSM17874 и Е. coli S17 1 (, pir)/pLAL50 осуществляли таким же способом, какой описан выше для получения транспозонной библиотеки. После селекции по устойчивости против апрамицина (которую обеспечивает интеграцияpLAL50) и хлорамфеникола (Acinetobacter sp. DSM17874 обладает природной устойчивостью к хлорамфениколу), можно детектировать, два конъюганта Клоны MAV1 были подтверждены Southernблоттингом в соответствии с руководством Roche при использовании зонда, специфичного к almA. Пример 5. Характеристика мутантных штаммов almA AVM1004A7 и MAV1 Из содержащих 25%-ный глицерин культур, хранящихся при -80 С, высевали клетки Acinetobacter(1), 50 (мкг/мл канамицина (2) или 50 мкг/мл апрамицина (3). Планшеты инкубировали в течение ночи при 30 С. Отдельную колонию каждого штамма пересевали на содержащие антибиотики LB-планшеты,которые снова инкубировали в течение ночи при 30 С. Затем два селективных LB-планшета для каждого штамма инокулировали пересевами с планшетов после предыдущего пересева и использовали как предварительные культуры после еще одной инкубации в течение ночи с получением достаточной биомассы для инокуляции. Клетки собирали из планшетов в каждые 6 мл среды СВ и использовали для инокуляции после определения OD600. К 100 мл среды СВ, не содержащей антибиотики (1) или содержащей 50 мкг/мл канамицина (2) или 50 мкг/мл апрамицина (3), добавляли по 750 мкл твердых капель алканов С 20, С 24, С 32 и С 36. Среду инокулировали бактериальными клетками трех штаммов до конечной OD600 0,05 (1: 0,064, 2: 0,056, 3: 0,066). Культуры выращивают при 30 С со встряхиванием при 200 об/мин в течение 2 недель. 2-мл пробы культур брали каждый 24 ч и бактериальные клетки из проб осаждали в микроцентрифуге (15000 об/мин, 5 мин, К.Т.). Супернатант отбрасывали и бактериальный осадок перед определением содержания белка хранили при -20 С. После последнего взятия проб все пробы серии оттаивали при К.Т. и бактериальный осадок редиспергировали в 400 мкл dH2O (2-мл реакционная пробирка). Пробу инкубировали в ультразвуковой бане в течение 10 мин и затем кипятили в водяной бане еще 10 мин. 2160 мкл равномерно диспергированной пробы анализировали в микротитровальном планшете в двух параллелях при использовании концентрата для анализа белка Bio-Rad. Разведения, полученные с dH2O, использовали при необходимости. Разведения бычьего сывороточного альбумина (BSA) (80, 70, 50, 30, 10, 8 и 5 мкг/мл в dH2O) использовали в двух параллелях в качестве стандарта на каждом планшете. 40 мкл концентрата добавляли к разбавленным пробам и стандартам. Планшет инкубировали на планшетном шейкере МТ при 900 об/мин в течение 30 мин перед фотометрическим измерением при длине волны 595 нм. Концентрации белка в пробах определяли по стандартной кривой BSA и фактору разведения. Концентрации белка откладывали против времени с получением кривых роста при использовании SigmaPlot 9 (фиг. 4). Все три штамма показали сравнимый рост на алканах С 20 и С 24, начиная немедленно после инокуляции. На алканах С 32 и С 36 штамм Acinetobacter sp. DSM17874 рос хорошо (сравнимо с алканами С 20 и С 24 ), в то время как AVM1004A7 сначала показывал отсутствие роста и начинал расти после приблизительно 100 ч инкубации. MAV1 сначала показывал отсутствие роста до приблизительно 250 ч, прежде чем можно было детектировать рост культуры. Эти результаты показывают, что присутствие функционального гена almA является необходимым для роста Acinetobacter sp. DSM17874 на длинноцепочечных алканах, таких как С 32 и С 36, и из них следует центральная роль almA в утилизации этих н-алканов. Тот факт, что оба, AVM1004A7 и MAV1, на- 20020184 чинали расти в пределах времени эксперимента по росту, может быть результатом разложения антибиотиков канамицина и апрамицина. Отсутствие антибиотиков должно ослаблять селективное давление на поддержание интегрированного транспозона или вектора и может сделать возможной реверсию к дикому генотипу и фенотипу с функциональным almA гомологичной рекомбинацией или эксцизией транспозона. Пример 6. Определения полной последовательности для гена almA Хромосомную ДНК AVM1004A7 изолировали и расщепляли рестриктазой Pvul. Расщепленные фрагменты снова лигировали и использовали в качестве матрицы в последующих ПЦР. ПЦР при использовании олигонуклеотидов Tn10:1 и Kan2 в качестве праймеров давала продукт ПЦР размером приблизительно 4,1 нп. Прямое секвенирование осуществляли на этом продукте ПЦР при использовании олигонуклеотидов Tn10:1 и Kan2 в качестве праймеров. Последовательности (AW1, AW2) выявили последовательность ДНК перед геном almA (30S-рибосомальный белок S11). Три ПЦР осуществляли для амплификации области almA в двух фрагментах. Первая ПЦР (1) при использовании AVM1004A7-4 и AVMext2 (5'-CAAGGTAATGCATTGGCTTGGGCTACCTCAG-3' SEQ IDNO:12) в качестве праймеров привела к продукту размером приблизительно 4,1 т.п.о. (5'-часть); вторая ПЦР (2) при использовании AVM1004A7-2 и AVMext1 (5'-TTCTATGAAAAAGAAGTTGTTCCAAATATTG-3' SEQ ID NO:13) в качестве праймеров привела к продукту размером приблизительно 2,6 т.п.о. (3'-часть); третья ПЦР (3) при использовании AVM1004A7-3 и AVMext1 в качестве праймеров дала продукт размером приблизительно 3,2 т.п.о. (3'-часть, удлиненная). При использовании продуктов ПЦР (1) и (2) в качестве матриц прямое секвенирование осуществляли при использовании олигонуклеотидов AVM1004 А 7-1 (1: AW5) и AVM1004 А 7-2 (2: AW6). Эти результаты секвенирования(AW5, AW6) сделали возможным определение олигонуклеотидов для дополнительного секвенирования(AW6) и дали информацию о последовательностях, в том числе промоторного участка almA и старткодона ATG (AW5). Продукт ПЦР (3) клонировали в плазмиду pMOSBlue при использовании набора для клонированияpMOSBlue Blunt-ended PCR (Amersham). Секвенирование плазмидной ДНК, полученной из трех индивидуальных клонов (М 3: AW15-17; М 5: AW19-21; М 6: AW23-25), осуществляли при использованииAW5 и AW15-17, AW19-21 и AW23-25 объединяли с получением одного контига, включающего в себя полный ген almА, включая промоторную область и информацию о последовательности для области позади almA. Пример 7. Определение полной последовательности гена orf1 (almB) Из последовательностей AW17, AW21 и AW25 после интергенной области в 124 нп можно идентифицировать старт-кодон для другой открытой рамки считывания. Для расширения информации о последовательности этого предполагаемого гена осуществляли дополнительное секвенирование при использовании вышеуказанных плазмидных клонов М 3 (AW27, AW30), М 5 (AW28, AW31) и М 6 (AW29, AW32) в качестве матриц и олигонуклеотидов AVMext3 (5'-GAAATATCGCGTATATTGAGCACATTAG-5' SEQID NO:15, AW27-29) и AVMext4 (5'-ATTGTCGATATATGCGCGTGC-3' SEQ ID NO:16, AW30-32) в качестве праймеров в ПЦР для секвенирования. Эти две стадии "блуждания праймера" выявили полную последовательность новой открытой рамки считывания, далее называемой здесь almB, и закрыли пробел до 3'-конца следующего позади гена fadE(ацил-КоА-дегидрогеназа), ранее идентифицированного в качестве гена с противоположной ориентацией позади almA. Относительные положения всех идентифицированных генов показаны в фиг. 7. Последовательности, полученные выше, были затем подтверждены следующим образом. Для амплификации нуклеотидной последовательности almAB осуществляли четыре индивидуальных ПЦР при использовании хромосомной ДНК Acinetobacter sp. DSM17874 в качестве матрицы и праймеров: almAprom-up (GACATGTGTATTGTCAAATTTGTGC SEQ ID NO:17) и almB-end-lo/orf1-end-lo (CCAATGAGATCATGGAAGAAC SEQ ID NO:18). Для минимизации возможных ошибок использовали смесь Expand High Fidelity Mix (Roche), содержащую полимеразу с редактирующей активностью; предполагаемый продукт ПЦР размером 2272 нп получали во всех 4 ПЦР. Продукт прогоняли на 0,8%-ном агарозном геле и четыре продукта ПЦР вырезали и подвергали индивидуально экстракции с геля при использовании набора Qiaquick Gel Extraction Kit (Qiagen). Продукты ПЦР лигировали параллельно в вектор pMOSBlue из набора pMOS Blue Blunt-ended PCRCloning Kit (Amersham) при последующей трансформации в соответствии с руководством от изготовителей. Шесть клонов каждого клонирования, показавших белые колонии, подвергли скринингу в ПЦР при использовании праймеров AVMext3 (GAAATATCGCGTATATTGAGCACATTAG SEQ ID NO:15) иalmB-end-lo. Клоны, показавшие предполагаемый продукт ПЦР, идентифицировали для клонирований 1,2 и 3. Из этих клонов получили мини-плазмиды при использовании системы Wizard Plus Minipreps DNAPurification System (Promega). Рестрикционный анализ плазмидной ДНК при использовании EcoRI выявил клоны АВ 1.1 (клонирование 1, клон 1), АВ 2.6 (клонирование 2, клон 6) и АВ 3.5 (клонирование 3,- 21020184 клон 5), показавшие ожидаемые полосы в анализе гель-электрофорезом. Эти три плазмидных клона использовали для определения последовательность области almAB. Секвенирование осуществляли при использовании нижеследующих праймеров в секвенирующих ПЦР от AW109 до AW141. Нижеследующие последовательности можно соединить с получением одного контига области almAB (almA-orf1): AW109-141 за исключением AW115, AW116, AW121, AW122, AW123, AW135,AW137 и AW138. Результаты представлены на фиг. 6-10. Полученную консенсусную последовательность кодирующих областей almA и almB (фиг. 6 и 8),предполагаемые пептидные последовательности AlmA и AlmB, выведенные из генных последовательностей (фиг. 7 и 9), и последовательность полной области almAB (almA-orf1) (фиг. 10) показаны на основании прямых и обратных последовательностей трех независимых клонов. Кодирующая область almA состоит из 1494 пар нуклеотидов, кодирующих белок из 498 аминокислот. Последовательности как для ДНК кодирующей области, так и для выведенного пептида представлены на фиг. 6 и 7. Пептидная последовательность AlmA показывает 76,0%-ную гомологию с белком из полностью секвенированного штамма Acinetobacter sp. ADP1 (A. baylyi ADP1) в простом поиске в BlastP. Предсказано, что белок ACIAD3192 является предполагаемой флавин-содержащей монооксигеназой без конкретной функциональной привязки. Идентичность гена, кодирующего монооксигеназу ADP1, последовательности almA определена на основе нуклеотидов при использовании BlastN в 74,6%. Из предсказаний вторичной структуры (TMpred) следует, что AlmB представляет собой предполагаемый мембранный белок внутренней бактериальной мембраны с тремя трансмембранными -спиралями. Также найдено, что A. baylyi ADP1 и Acinetobacter sp. RAG-1 и М-1 растут при использовании С 32 и С 36 соответственно, в качестве единственного источника углерода (результаты не показаны, а такжеSakai, Y et al., 1994, Biosci Biotechnol Biochem 58:2128-2130). Гены, гомологичные almA и almB, также идентифицированы в Acinetobacter sp. RAG-1 и Acinetobacter sp. М-1 при использовании ПЦР с праймерами AlmA prom-up (GACATGTGTATTGTCAAATTTGTGC SEQ ID NO:17) и almB-end-lo и almB-end-lo(CCAATGAGATCATGGAAGAAC SEQ ID NO:18) с последующим блужданием праймеров. Последовательность вышеуказанного гена ACIAD3192 Acinetobacter baylyi ADP1 получена из GenBank,доступаNC005966 (2). Гомолог almB (orf1) не присутствует в Acinetobacter sp. ADP1. Гены almA и almB (orf1) имеют одну и ту же ориентацию и могут потенциально образовывать оперон. Ген almB (orf1) предположительно кодирует белок из 166 аминокислот, содержащий N-концевую сигнальную последовательность для секреции предсказанного белка. Функция almB (orf1) в настоящее время неизвестна. Поиски в базах данных не выявили значительных гомологии с другими известными белками. Тем не менее, близкая ассоциация сAlmA может указывать на ассоциацию almB со способностью Acinetobacter sp. DSM17874 разлагать длинноцепочечные н-алканы. Пример 8. Комплементация активности almA в ущербном по almA мутанте MAV1 Acinetobacter sp. Введение гена almA на плазмиде в ущербный по almA штамм MAV1 восстанавливало способность штамма расти с алканами С 32 и С 36 в качестве единственного источника углерода почти до уровня дикого типа (фиг. 13). Плазмиду получали нижеследующим образом: ген almA Acinetobacter sp. DSM 17874 амплифицировали в ПЦР при использовании хромосомной ДНК из Acinetobacter sp. DSM 17874 в качестве матрицы. Продукт ПЦР расщепляли рестриктазами Sphl и Narl и лигировали в аналогичным образом расщепленный вектор pDLM02.1 с получением плазмиды pALMAL. Это результат подтвердил, что ущербность по разложению длинноцепочечных алканов у MAV1 не вызвана полярным эффектом в генах позади almA, и что ущербность по almA не является ответственной за неспособность мутанта MAV1 использовать длинноцепочечные алканы. Ген ACIAD3192 из A. baylyi ADP1 является ближайшим гомологом гена almA, найденным в базах данных. Поэтому этот ген был выбран для гетерологичной функциональной комплементации ущербного по almA мутанта MAV1 Acinetobacter sp. Плазмиду получали нижеследующим образом: ген ACIAD3192 из A. baylyi ADP1 амплифицировали в ПЦР при использовании хромосомной ДНК из A. baylyi ADP1 в качестве матрицы. Продукт ПЦР расщепляли рестриктазами Sphl и Narl и лигировали аналогичным образом расщепленный вектор pDLM02.1 с получением плазмиды pACIAD1.MAV1, несущий ген ACIAD3192 на плазмиде, показал рост с алканами С 32 и С 36 (фиг. 13), что ясно показывает, что продукт этого гена представляет собой функциональный гомолог AlmB в пути утилизации длинноцепочечных алканов.

МПК / Метки

МПК: C12N 15/53, C12N 1/21, C12N 9/02, C10G 32/00

Метки: разложения, микроорганизм, кодирующая, разложении, указанного, н-алкан, способ, вектор, ген, функциональный, фрагмент, белок, н-алкана, нуклеиновой, указанную, молекулу, содержащие, химерный, кислоты, представляющего, молекула, участвующий, собой, субстрата

Код ссылки

<a href="http://easpatents.com/30-20184-belok-uchastvuyushhijj-v-razlozhenii-substrata-predstavlyayushhego-sobojj-n-alkan-ili-ego-funkcionalnyjj-fragment-kodiruyushhaya-ih-molekula-nukleinovojj-kisloty-himernyjj-gen-vekt.html" rel="bookmark" title="База патентов Евразийского Союза">Белок, участвующий в разложении субстрата, представляющего собой н-алкан, или его функциональный фрагмент, кодирующая их молекула нуклеиновой кислоты, химерный ген, вектор и микроорганизм, содержащие указанную молекулу, и способ разложения указанного н-алкана</a>

Похожие патенты