Есть еще 22 страницы.

Смотреть все страницы или скачать PDF файл.

Формула / Реферат

1. Способ получения композиции плазмидной ДНК фармацевтической чистоты, при котором берут клеточный экстракт, содержащий плазмидную ДНК, где клетки лизированы посредством щелочного лизиса, и клеточные мембраны и геномная ДНК удалены посредством первоначальной экстракции или фильтрации; а затем осуществляют по меньшей мере две хроматографические стадии, одна из которых представляет собой стадию аффинной хроматографии с образованием тройной спирали, а вторая выбрана из анионообменной хроматографии, гель-фильтрационной хроматографии и гидрофобной хроматографии, где полученная композиция содержит менее чем приблизительно 0,0001% примеси геномной ДНК клетки-хозяина.

2. Способ по п.1, где по меньшей мере две хроматографические стадии включают три стадии, осуществляемые в следующем порядке: анионообменная хроматография, аффинная хроматография с образованием тройной спирали и гидрофобная хроматография.

3. Способ по п.1, где первой осуществляемой хроматографической стадии предшествует фильтрация лизата.

4. Способ по п.1, где первой осуществляемой хроматографической стадии предшествует удаление флокулята.

5. Способ по п.1, где композиция содержит менее чем приблизительно 0,0001% примеси РНК клетки-хозяина.

6. Способ по п.1, где композиция содержит менее чем приблизительно 0,0001% примеси белка клетки-хозяина.

7. Способ по п.5, где композиция содержит менее чем приблизительно 0,0001% примеси белка клетки-хозяина.

8. Способ по п.1, где композиция содержит менее чем приблизительно 0,1 ЭЕ (эндотоксиновых единиц) эндотоксина/мг.

9. Способ по п.7, где композиция содержит менее чем приблизительно 0,1 ЭЕ эндотоксина/мг.

10. Способ по п.1 или 2, где композиция содержит менее или приблизительно 0,1 ЭЕ эндотоксина/мг, менее или приблизительно 0,00008% примеси белка клетки-хозяина, менее или приблизительно 0,00008% примеси РНК клетки-хозяина и менее или приблизительно 0,00008% примеси геномной ДНК клетки-хозяина.

11. Способ по п.2, где композиция содержит менее или приблизительно 0,00005% примеси геномной ДНК клетки-хозяина.

12. Способ по п.2, где композиция содержит менее или приблизительно 0,00008% примеси геномной ДНК клетки-хозяина.

13. Способ по п.1 или 2, где композиция содержит менее или приблизительно 0,1 ЭЕ эндотоксина/мг, и менее или приблизительно 0,00005% примеси белка клетки-хозяина.

14. Способ по п.13, где композиция содержит менее или приблизительно 0,00002% примеси РНК клетки-хозяина и менее или приблизительно 0,00008% примеси геномной ДНК клетки-хозяина.

15. Способ по п.1 или 2, где композиция содержит менее или приблизительно 0,1 ЭЕ эндотоксина/мг, и менее или приблизительно 0,00002% примеси РНК клетки-хозяина.

16. Способ по п.1 или 2, где композиция содержит менее или приблизительно 0,1 ЭЕ эндотоксина/мг и менее или приблизительно 0,00005% примеси белка клетки-хозяина.

17. Способ по п.1 или 2, где композиция содержит не более чем 0,00002% примеси РНК клетки-хозяина и не более чем 0,00005% примеси белка клетки-хозяина.

18. Способ по любому из пп.1-17, который можно масштабировать до крупномасштабного производства.

19. Композиция плазмидной ДНК, полученная способом по любому из пп.1-18.

20. Композиция плазмидной ДНК по п.19, дополнительно содержащая по меньшей мере один полимер для улучшения переноса плазмидной ДНК в клетку.

21. Композиция плазмидной ДНК по п.19, дополнительно содержащая фармацевтически приемлемый носитель или эксципиент.

22. Композиция плазмидной ДНК по п.19, приготовленная в виде препарата для доставки путем инъекции, внутривенной инъекции, внутримышечной инъекции, внутриопухолевой инъекции, бомбардировки малыми частицами или местного нанесения на ткань.

23. Композиция плазмидной ДНК по п.19, где плазмидная ДНК по существу находится в форме суперспирализованной замкнутой кольцевой ДНК.

24. Способ крупномасштабного производства высокоочищенной плазмидной ДНК, при котором содержащие плазмиду клетки-хозяева лизируют посредством щелочного лизиса в непрерывном ламинарном потоке, полученный экстракт нейтрализуют и плазмидную ДНК в экстракте выделяют сначала посредством стадии анионообменной хроматографии, стадии аффинной хроматографии с образованием тройной спирали и затем стадии гидрофобной хроматографии.

25. Способ получения и очистки плазмидной ДНК фармацевтической чистоты, включающий стадии:

а) получения клеток, содержащих плазмидную ДНК,

б) приготовления лизата клеток, содержащих плазмидную ДНК, путем разрушения клеток методом непрерывного щелочного лизиса,

в) концентрирования экстракта лизированных клеток путем осаждения,

г) проведения стадии анионообменной хроматографии,

д) проведения стадии аффинной хроматографии с образованием тройной спирали,

е) проведения стадии гидрофобной хроматографии и

ж) возможного проведения стадии диафильтрации или стадии замены буфера.

26. Способ по п.24 или 25, где очищенная плазмидная ДНК присутствует в растворе с менее или приблизительно 0,1 ЭЕ эндотоксина/мг, менее или приблизительно 0,00005% примеси белка клетки-хозяина, менее или приблизительно 0,00002% примеси РНК клетки-хозяина и менее или приблизительно 0,00008% примеси геномной ДНК клетки-хозяина.

27. Способ по одному из пп.24-26, дополнительно включающий предварительную стадию удаления флокулята путем пропускания раствора через сетчатый фильтр или посредством объемной фильтрации.

28. Способ по любому из пп.24-27, дополнительно включающий стадию диафильтрации после последней хроматографической стадии.

29. Способ по п.28, где стадия диафильтрации обеспечивает солевые, буферные и рН значения, подходящие для конечной композиции, пригодной для изготовления фармацевтической композиции.

30. Способ по любому из пп.1-18, дополнительно включающий стадию стерильной фильтрации, приготовления препарата и заполнения флаконов очищенной плазмидной ДНК.

31. Флакон с очищенной плазмидной ДНК, полученной способом по п.30.

32. Флакон по п.31, где очищенная плазмидная ДНК представляет собой плазмиду, обозначенную как NV1FGF.

33. Способ по любому из пп.1-18, при котором одну или более чем одну хроматографическую стадию осуществляют на твердом носителе, содержащем любой органический, неорганический или композитный материал, пористый, сверхпористый или непористый носитель, пригодный для хроматографических разделений, модифицированный поли(алкиленгликолями), алканами, алкенами, алкинами, аренами или другими молекулами, которые придают этому носителю гидрофобный характер.

34. Способ по любому из пп.1-18 или 24-29, при котором одну или более чем одну хроматографическую стадию осуществляют как вытеснительную хроматографию, хроматографию с симулированным подвижным слоем, хроматографию в непрерывном слое, быструю жидкостную хроматографию белков или высокоэффективную жидкостную хроматографию.

35. Способ по любому из пп.1-18 или 24-29, при котором гидрофобную хроматографию осуществляют в неподвижном слое или вспученном слое.

 

Текст

Смотреть все

010576 Область изобретения Данное изобретение относится к способам очистки нуклеиновых кислот. В частности, изобретение относится к способам получения высокоочищенной плазмидной ДНК (пДНК), в частности к получению и выделению плазмидной ДНК фармацевтической чистоты. Предшествующий уровень техники Разработки в молекулярной биологии с очевидностью позволяют предположить, что терапия, основанная на плазмидах, в частности в области вакцин и генной терапии человека, может обеспечить эффективные способы лечения заболеваний. Однако, значительным препятствием для данной технологии является получение плазмидной ДНК, количественно и качественно соответствующей клиническому применению. Одним из перспективных способов безопасной и эффективной доставки нормального гена в человеческие клетки является доставка посредством плазмидной ДНК. Плазмидная ДНК представляет собой замкнутую, кольцевую форму бактериальной ДНК, в которую может быть встроена интересующая последовательность ДНК. Примеры представляющих интерес последовательностей ДНК, которые могут быть введены в клетки млекопитающих, включают экзогенный функциональный ген или мутантный ген,антисмысловые последовательности, последовательности РНКи (интерферирующей РНК) или днРНКи(двунитевой интерферирующей РНК), рибозимы, например, в лечении вирусных инфекций, рака или заболеваний, связанных с ангиогенезом. Будучи доставленной в человеческую клетку, пДНК начинает реплицироваться и продуцировать копии встроенной последовательности ДНК. Таким образом, ученые рассматривают плазмидную ДНК как перспективный носитель для доставки интересующих последовательностей ДНК в человеческие клетки с целью лечения ряда болезненных состояний. Для исследовательских разработок с целью применения технологии, основанной на плазмидах в терапии, необходимы огромные количества плазмидной ДНК. Поскольку плазмидная ДНК, используемая в генной терапии и других клинических применениях, обычно продуцируется бактериями, такими как Escherichia coli (E. coli), необходимы способы эффективного отделения плазмидной ДНК от геномной ДНК(гДНК) бактериальной клетки, а также от эндотоксина и белков в бактериальной клетке. Таким образом,существует все возрастающая необходимость в простых, надежных и масштабируемых способах очистки, которые можно использовать для выделения больших количеств плазмидной ДНК из бактериальных клеток. Важная стадия любого процесса очистки плазмиды включает лизис бактериальных клеток с целью высвобождения клеточного содержимого, из которого можно выделить плазмидную ДНК. В действительности в первую очередь необходимо достичь трех стадий: ресуспендирования клеток, лизиса клеток,нейтрализации и осаждения примесей, остающихся от хозяина. При ресуспендировании клеток обычно используют ручное перемешивание или магнитную мешалку, а также гомогенизатор или роторный смеситель для ресуспендирования клеток в буфере для ресуспендирования. Клеточный лизис можно осуществить путем ручного вращения или магнитного перемешивания с целью смешивания ресуспендированных клеток с лизирующим раствором (состоящим из разбавленной щелочи (основания) и детергентов); последующего выдерживания смеси при комнатной температуре (20-25 С) или на льду в течение некоторого периода времени, например 5 мин, для завершения лизиса. Как отмечено выше, ручное перемешивание и магнитное перемешивание не являются масштабируемыми. Третьей стадией является нейтрализация и осаждение примесей, остающихся от хозяина. Лизат со второй стадии обычно смешивают с холодным нейтрализующим раствором путем легкого вращения или магнитного перемешивания для подкисления лизата, после чего его помещают на лед на 10-30 мин для облегчения денатурации и осаждения высокомолекулярной хромосомной ДНК, белков хозяина и других молекул хозяина. Как ручное вращение, так и магнитное перемешивание не являются масштабируемыми. В общем случае клеточную стенку гидролизуют путем обработки лизоцимом в течение короткого времени, либо путем обработки щелочью или ацетатом калия (KOAc). Как правило, также добавляют РНКазу для разрушения РНК бактериальной суспензии. Эти химические стадии могут быть эффективны при лизисе клеток в небольшом масштабе. Однако повышение вязкости очень осложняет крупномасштабный процесс. Альтернативный простой и быстрый способ получения плазмид включает обработку бактерий лизоцимом, затем кипячение при приблизительно 100 С в подходящем буфере в течение 20-40 с с образованием нерастворимого сгустка геномной ДНК, белка и дебриса, причем в растворе остается плазмида с РНК в качестве основной примеси. Затем добавляют смешанный раствор NaOH и додецилсульфата натрия (SDS) с целью растворения цитоплазматической мембраны. NaOH частично денатурирует ДНК и частично разрушает РНК, а действие SDS заключается в растворении мембраны и денатурации белков. Затем SDS-белковый комплекс и клеточный дебрис осаждают добавлением 5 н. ацетата калия (рН 4,8). В это время значение рН важно как для нейтрализации NaOH, используемого в указанной обработке, так и для ренатурации плазмиды. Затем применяют центрифугирование для удаления осадков, получая, таким образом, целевые плазмиды в супернатанте. Однако эта методика не подходит для масштабирования до больших объемов бактериальных ферментаций и предназначена для ферментаций объемом менее пяти литров. Также такие серии обработок требуют медленного и устойчивого перемешивания, чтобы избежать разрезания бактериальной хромосомной ДНК на маленькие фрагменты и образования агрегатов,-1 010576 ведущего к загрязнению ими плазмиды, и сложны для применения в крупномасштабном процессе. Один из традиционных альтернативных способов лизиса клеток, известный как щелочной лизис,состоит в перемешивании суспензии бактериальных клеток (раствора 1) с раствором для щелочного лизиса (раствором 2). Раствор 2 состоит из детергента, например додецилсульфата натрия (SDS), для лизиса бактериальных клеток и высвобождения внутриклеточного материала, и щелочи, например гидроксида натрия, для денатурации белков и нуклеиновых кислот клеток (в частности гДНК и РНК). Как только происходит лизис клеток и денатурация ДНК, вязкость раствора резко повышается. После денатурации добавляют кислый раствор, например ацетат калия (раствор 3), для нейтрализации гидроксида натрия,вызывая ренатурацию нуклеиновых кислот. Длинные фрагменты гДНК реассоциируют случайным образом и образуют сети, которые выпадают в осадок в виде хлопьев, захватывая белки, липиды и другие нуклеиновые кислоты. Калийная соль додецилсульфата также выпадает в осадок, унося белки, с которыми она ассоциируется. Две нити пДНК (плазмидной ДНК), переплетенные друг с другом, реассоциируют нормально с восстановлением исходной плазмиды, которая остается в растворе. Эту методику лизиса осуществляют в периодическом процессе, то есть, когда разные растворы смешивают путем последовательного добавления растворов в сосуды или резервуары. Поскольку щелочной лизат является вязкоупругой жидкостью, с которой очень трудно обращаться, одна из трудностей при данном способе возникает во время смешивания разных растворов. Поскольку напряжение сдвига вызывает образование фрагментов гДНК, которые затем становится крайне сложно отделить от пДНК,необходимы способы, избегающие приложения напряжения сдвига к жидкости. Кроме того, пДНК большого размера (то есть более чем 10 килобаз) также чувствительна к срезывающему повреждению в процессе смешивания. После того как раствор, содержащий клеточную суспензию, смешан с лизирующим раствором, вязкоупругий щелочной лизат смешивают с нейтрализующим раствором. Опять же, этот процесс смешивания сложен из-за вязкоупругих свойств раствора. Кроме того, другой трудностью при масштабировании периодического процесса лизиса в промышленном масштабе является эффективность смешивания различных жидкостей при попытке ограничить напряжение сдвига, чтобы избежать фрагментации гДНК. Как отмечено ранее, хроматографическое поведение фрагментированной геномной ДНК очень похоже на поведение пДНК, поэтому становится практически невозможно избавиться от гДНК с помощью стандартных методик очистки. Таким образом,очевидны несколько ограничений использования периодического процесса для лизиса бактериальных клеток, такие как масштабирование, низкое качество выделенной пДНК из-за примеси фрагментированной гДНК и относительно небольшое количество полученной пДНК. В противоположность периодическому способу также предложены несколько способов непрерывного смешивания различных растворов для лизиса клеток с использованием серии статических смесителей. В соответствии с этими способами раствор клеточной суспензии и раствор для лизиса клеток одновременно добавляют в статический смеситель. Затем раствор лизированных клеток, который находится в первом статическом смесителе, и осаждающий раствор одновременно добавляют во второй статический смеситель. Раствор, который находится в этом втором смесителя, содержит осажденный лизат и плазмиды. Другие непрерывные режимы лизиса клеток включают использование проточного теплообменника,где суспендированные клетки нагревают до 70-100 С. После лизиса клеток в теплообменнике исходящий поток подвергается либо непрерывному проточному, либо периодическому центрифугированию, во время которого клеточный дебрис и геномная ДНК осаждаются, оставляя плазмидную ДНК в супернатанте. Крупномасштабное выделение и очистка плазмидной ДНК из крупнообъемных ферментаций микроорганизмов, следовательно, требует разработки улучшенного способа получения плазмид. Несмотря на многочисленные способы, используемые в настоящее время для лизиса бактериальных клеток, ни один из них не решает проблем, вызванных вязкоупругими свойствами жидкостей и напряжениями сдвига, вовлеченными в стадии смешивания. Настоящее изобретение, таким образом, относится к новому способу непрерывного щелочного лизиса бактериальной клеточной суспензии в большом масштабе и обеспечивает главное преимущество в ограничении напряжений сдвига. Другой важной ступенью для любого применения, при котором нуклеиновую кислоту вводят человеку или животному при терапии, является необходимость получения высокоочищенной нуклеиновой кислоты фармацевтической чистоты. Такая очищенная нуклеиновая кислота должна соответствовать стандартам качества безопасности, действенности и эффективности лекарственных средств. Кроме того,желательно иметь крупномасштабный способ, который можно использовать для производства ДНК в многограммовых количествах. Следовательно, желательно иметь способ производства высокоочищенной нуклеиновой кислоты, который не требует использования токсичных химических веществ, мутагенов,органических растворителей или других реагентов, которые подвергали бы риску безопасность или эффективность полученной в результате нуклеиновой кислоты или бы сделали масштабирование трудным или непрактичным. Также желательно получить нуклеиновые кислоты, не содержащие примеси эндотоксинов, которые при введении пациенту могут вызвать токсический ответ. Удаление примеси эндотоксинов особенно важно, когда плазмидную ДНК очищают от грамотрицательных бактериальных источников, которые имеют высокие уровни эндотоксинов как интегральных компонентов наружной клеточной мембраны.-2 010576 Классические методики выделения и очистки плазмидной ДНК из бактериальных ферментаций пригодны для получения плазмидных препаратов в небольшом или лабораторном масштабе. После разрушения бактериальных клеток-хозяев, содержащих плазмиду, а затем нейтрализации ацетатом, вызывающей осаждение геномной ДНК и белков клетки-хозяина, их обычно удаляют с помощью, например,центрифугирования. Жидкая фаза содержит плазмидную ДНК, которую осаждают спиртом, а затем подвергают зонному центрифугированию, используя CsCI в присутствии бромистого этидия, для разделения различных форм плазмидной ДНК, то есть суперспирализованной, с однонитевым разрывом кольца и линеаризованной. Дополнительная экстракция бутанолом необходима для удаления остаточного бромистого этидия с последующим осаждением ДНК с помощью спирта. Затем следуют дополнительные стадии очистки для удаления белков клетки-хозяина. Эти современные способы выделения плазмидной ДНК имеют несколько ограничений. Например,способы очистки, в которые вовлечено использование больших количеств воспламеняющихся органических растворителей (например этанола и изопропанола) и токсичных химических веществ, например бромистого этидия, фенола и хлороформа, как правило, нежелательны для крупномасштабного выделения и очистки плазмидной ДНК. Для очистки плазмидной ДНК можно использовать способы, альтернативные центрифугированию с хлористым цезием, такие как гель-фильтрационная хроматография, хроматография на гидроксиапатите и различные хроматографические способы, основанные на обращенной фазе или анионном обмене. Эти альтернативы могут быть адекватны для получения небольших количеств вещества для исследований в лабораторном масштабе, но, как правило, не являются легко масштабируемыми и неспособны производить большие количества плазмидной ДНК. Также при химическом способе разделения процесс разделения и очистки осложнен, и необходимо использование большого количества органического растворителя, а следовательно, возникает множество проблем обработки загрязненных растворителей и подобного. Кроме химического способа разделения и очистки, существует способ разделения плазмид путем электрофореза. Электрофоретический способ включает электрофорез на бумаге и гель-электрофорез, и в настоящее время общепринятым является гель-электрофорез. Однако электрофоретический способ имеет множество проблем, связанных с длительным временем разделения, трудностями сбора, малой загрузкой образцов и т.д. В современных способах разделения двух форм плазмидной ДНК используется ионообменная хроматография (Duarte et al., Journal of Chromatography A, 606 (1998), 31-45) или гель-фильтрационная хроматография (Prazeres, D. M., Biotechnology Techniques Vol. 1, No. 6, June 1997, p. 417-420), объединенные с использованием добавок, таких как полиэтиленгликоль (ПЭГ), детергенты и другие компоненты, такие как гексамин кобальта, спермидин и поливинилпирролидон (ПВП). Однако современные способы не могут обеспечить эффективное и экономически эффективное разделение суперспирализованной ДНК и ДНК с одноцепочечным разрывом (или релаксированной). Кроме того, недостатком многих из известных способов является использование ПЭГ или других добавок, которые могут быть нежелательными в производстве плазмидной ДНК, поскольку требуют дополнительных способов разделения, утилизации и контроля качества, которые могут быть трудными, требующими больших затрат времени и более дорогостоящими. В альтернативных формах известных способов разделения суперспирализованной и релаксированной формы плазмидной ДНК используют очень дорогостоящие смолы, в процессе обработки которых также используют растворители, такие как ацетонитрил, этанол и другие компоненты, такие как триэтиламин и тетрабутиламмония фосфат. Дополнительные способы разделения суперспирализованной и релаксированной формы ДНК основаны на гель-фильтрационной хроматографии, которая включает разделение двух форм плазмидной ДНК на основе небольшого различия по размеру. Эти колонки обычно бывают относительно длинными, что создает значительные проблемы при масштабировании, делая невозможным их применение в крупномасштабном производстве. Кроме того, в методах гельфильтрационной хроматографии необходимы концентрированные растворы образца, которые невозможно получить из растворов плазмидной ДНК из-за высоковязкой природы ДНК. Также из препаратов плазмидной ДНК, которые производятся из бактериальных препаратов и часто содержат смесь релаксированной и суперспирализованной плазмидной ДНК, часто необходимо удалять эндотоксины, как требует FDA, поскольку известно, что эндотоксины, продуцируемые многими бактериями-хозяевами, вызывают воспалительные реакции, например лихорадку или сепсис, у хозяина, получающего плазмидную ДНК. Эти эндотоксины, как правило, представляют собой липополисахариды или их фрагменты, которые являются компонентами наружной мембраны грамотрицательных бактерий и присутствуют в препарате ДНК из клеток-хозяев и мембран клеток-хозяев или макромолекул. Следовательно, удаление эндотоксинов является критической и необходимой стадией при очистке плазмидной ДНК для терапевтического или профилактического применения. При удалении эндотоксина из растворов плазмидной ДНК ранее использовали отрицательно заряженную структуру эндотоксинов. Однако плазмидная ДНК также является отрицательно заряженной и, следовательно, разделение обычно достигается при помощи анионообменных смол, которые связывают и те, и другие молекулы, и в определенных условиях преимущественно элюируют плазмидную ДНК при связывании эндотоксинов. Такое разделение приводит только к частичному удалению значительных количеств эндотоксинов, элюируемых с плаз-3 010576 мидной ДНК, и/или достигается очень плохое извлечение плазмидной ДНК. Крупномасштабное выделение и очистка плазмидной ДНК из больших объемов ферментаций микроорганизмов, таким образом, требует разработки улучшенного способа получения плазмид. Также необходим способ выделения и очистки большого количества плазмидной ДНК более простым путем и за более короткое время. Для исследований и терапии, основанной на плазмидах, также желательно, чтобы нуклеиновые кислоты можно было разделить и очистить, сохраняя такую же структуру, воспроизводимым способом, и чтобы избежать вредного действия примесей на организм млекопитающего, нуклеиновые кислоты необходимо выделять и очищать до высокой степени чистоты. В указанном традиционном способе, однако, существует проблема, заключающаяся в том, что нуклеиновые кислоты, в частности, плазмидные ДНК, невозможно получить с достаточно высокой чистотой и в достаточно большом количестве. Следовательно, целью настоящего изобретения является предложение способа выделения, в котором используются по меньшей мере две хроматографические стадии и который обеспечивает разделение большого количества плазмидных ДНК за более короткое время и с неожиданно высокой степенью чистоты. Краткое изложение сущности изобретения Изобретение основано на обнаружении способа получения и выделения высокоочищенной плазмидной ДНК. Плазмидная ДНК, полученная и выделенная способом по изобретению, содержит очень низкие уровни примеси хромосомной ДНК, РНК, белка и эндотоксинов. Плазмидная ДНК, полученная согласно изобретению, обладает достаточной чистотой для терапии, основанной на плазмидах. Таким образом, изобретение включает в себя способ получения и выделения высокоочищенной плазмидной ДНК, включающий стадию лизиса клеток, где присутствует (а) устройство для создания турбулентного потока с целью быстрого перемешивания клеточной суспензии с раствором, лизирующим клетки; и (б) устройства для создания ламинарного потока, с целью обеспечить возможность инкубации смеси, образовавшейся на стадии (а), без значительного взбалтывания, где смесь, образовавшаяся на стадии (а), течет из устройства для создания турбулентного потока в устройство для создания ламинарного потока. В следующем воплощении изобретения механизм может дополнительно содержать устройство для добавления второго раствора, нейтрализующего лизирующий раствор, где смесь, инкубируемая на стадии (б), течет из устройств для создания ламинарного потока в устройство для добавления второго раствора. В еще одном воплощении этот механизм можно использовать в способе выделения плазмидной ДНК из клеток, включающем: (а) смешивание клеток со щелочным лизирующим раствором в устройстве для создания турбулентного потока и (б) нейтрализацию щелочного лизирующего раствора путем добавления кислого раствора. Настоящее изобретение также относится к устройству для непрерывного щелочного лизиса, содержащему первый смеситель или инжектор, способный впрыскивать щелочную жидкость в противоположном направлении к клеточной суспензии, первую трубку малого диаметра, чтобы создавать турбулентный поток в смеси, вторую трубку большого диаметра, чтобы создавать ламинарный поток в смеси, второй смеситель или инжектор для впрыскивания нейтрализующего раствора на одном конце и сбора лизата. Кроме того, данное изобретение охватывает способ получения и выделения высокоочищенной плазмидной ДНК, которая является по существу чистой от примесей и, таким образом, представляет собой ДНК фармацевтической чистоты. Другой объект настоящего изобретения относится к способу выделения и очистки нуклеиновых кислот и плазмидной ДНК. Более подробно он относится к способу выделения нуклеиновых кислот и плазмидной ДНК фармацевтической чистоты, которые полезны для исследований и терапии, основанной на плазмидах. Препарат плазмидной ДНК, выделенной в соответствии со способами по изобретению, можно подвергать стадиям очистки, включающим, по меньшей мере, аффинную хроматографию с образованием тройной спирали, а также могут дополнительно включать анионообменную хроматографию и гидрофобную хроматографию. Эти способы, таким образом, включают стадию непрерывного щелочного лизиса, описанную здесь,в комбинации с последующей анионообменной хроматографией и/или аффинной хроматографией с образованием тройной спирали и/или дополнительной гидрофобной хроматографией. Эти способы, таким образом, также включают стадию непрерывного щелочного лизиса, описанную здесь, с последующими стадиями анионообменной хроматографии, аффинной хроматографии с образованием тройной спирали и гидрофобной хроматографии в комбинации. Первой стадии хроматографии может предшествовать фильтрация лизата или другое удаление флокулята. Одной из целей изобретения является максимизация выхода плазмидной ДНК из комбинации клетка хозяина/плазмидная ДНК. Другой целью изобретения является получение препарата плазмидной ДНК, который является по существу чистым от РНК бактерии-хозяина. Другой целью изобретения является получение препарата плазмидной ДНК, который является по-4 010576 существу чистым от белка бактерии-хозяина. Еще одной другой целью изобретения является получение препарата плазмидной ДНК, который является по существу чистым от хромосомной ДНК бактерии-хозяина. Другой целью изобретения является получение препарата плазмидной ДНК, который является по существу чистым от эндотоксинов бактерии-хозяина. Другой целью изобретения является предложение способа получения плазмидной ДНК фармацевтической чистоты, являющейся высокоочищенной для использования в исследованиях и в терапии, основанной на плазмидах, и пригодного для масштабирования до крупномасштабного производства. Изобретение, таким образом, охватывает плазмидную ДНК фармацевтической чистоты, которая является по существу чистой от примесей, высокоочищенной и интактной, где эта ДНК включает векторный каркас, терапевтический ген и ассоциированные регуляторные последовательности. Настоящее изобретение также относится к жидким препаратам плазмидной ДНК, которые стабильны и не разрушаются при комнатной температуре в течение длительного периода времени и, таким образом, пригодны для хранения плазмидной ДНК, которую используют в исследованиях и соответствующей терапии человека. Дополнительные цели и преимущества изобретения будут частично изложены в приведенном ниже описании, а частично будут очевидны из описания или могут быть изучены на практическом воплощении изобретения. Цели и преимущества изобретения будут реализованы и достигнуты посредством элементов и комбинаций, конкретно указанных в прилагаемой формуле изобретения. Следует понимать, что как приведенное выше общее описание, так и последующее подробное описание являются лишь иллюстративными и поясняющими, но не ограничивающими заявленное изобретение. Прилагаемые графические материалы, которые включены в материалы заявки и составляют их часть, иллюстрируют некоторые воплощения изобретения и вместе с описанием служат для пояснения принципов изобретения. Краткое описание графических материалов На фиг. 1 приведена схема аппарата, который можно использовать для непрерывного клеточного лизиса по изобретению. На фиг. 2 - схема смесителя М 1 в аппарате для непрерывного клеточного лизиса. На фиг. 3 - таблица сравнения продуктивности очистки с точки зрения примесей гДНК, РНК, белков, эндотоксинов при использовании только одной стадии анионообменной хроматографии (АЕС), либо двухступенчатого способа со стадией анионообменной хроматографии в комбинации с аффинной хроматографией с образованием тройной спирали (ТНАС) и трехступенчатого способа, включающего в комбинации стадию анионообменной хроматографии, стадию аффинной хроматографии с образованием тройной спирали и стадию гидрофобной хроматографии (HIC), ND означает не определено: низкая чувствительность аналитических способов. На фиг. 4 - таблица сравнения различных способов выделения и очистки плазмидной ДНК, таких как анионообменная хроматография (АЕС), хроматография на гидроксиапатите (НАС), гидрофобная хроматография (HIC), хроматография на обращенной фазе (RPC), гель-фильтрационная хроматография(SEC), аффинная хроматография с образованием тройной спирали (ТНАС) отдельно или в сочетании, и способа согласно настоящему изобретению. Приведены результаты с точки зрения качества очищенной плазмидной ДНК. ND - не определено (низкая чувствительность аналитических способов). На фиг. 5 А и 5 Б - графики, показывающие скорости депуринизации и образования однонитевых разрывов (образования открыто-кольцевой формы плазмиды) в плазмидной ДНК, хранившейся при+25 С и при +5 С в течение времени вплоть до 90 суток. Определения Кислый означает относящийся к кислоте или содержащему кислоту, имеющему рН меньше чем 7. Щелочной означает относящийся к щелочи или основанию или содержащий щелочь или основание,имеющий рН больше чем 7. Непрерывный означает непрерывающийся, не имеющий перерывов. Геномная ДНК означает ДНК, которая происходит из хромосомы или существует в хромосоме. Ламинарный поток означает тип движения в потоке водного раствора, при котором каждая частица движется в направлении, параллельном каждой другой частице. Лизат означает материал, полученный посредством процесса клеточного лизиса. Термин "лизирование" относится к разрыву клеточной стенки и/или клеточной мембраны клетки, которая находится в буферном растворе (то есть клеточной суспензии) посредством химической обработки с использованием раствора, содержащего лизирующий агент. Лизирующие агенты включают, например, щелочи, детергенты, органические растворители и ферменты. В предпочтительном воплощении лизис клеток осуществляют для высвобождения интактных плазмид из клеток-хозяев. Нейтрализовать означает сделать (раствор) нейтральным или подвергнуть (кислоту или основание/щелочь) нейтрализации. Под этим термином авторы изобретения подразумевают, что некое вещество, которое нейтрализует раствор, приводит рН этого раствора к значению рН между 5 и 7, и предпочти-5 010576 тельно около 7, или более предпочтительно ближе к 7, чем ранее. Ньютоновская текучая среда означает текучую среду, в которой напряжение сдвига пропорционально градиенту скорости и перпендикулярно плоскости сдвига. Константа пропорциональности известна как вязкость. Примеры ньютоновских текучих сред включают жидкости и газы. Неньютоновская текучая среда представляет собой текучую среду, в которой напряжение сдвига не является пропорциональным только градиенту скорости и перпендикулярным плоскости среза. Неньютоновские текучие среды могут не иметь хорошо определяемой вязкости. Неньютоновские текучие среды включают пластичные твердые вещества, жидкости, подчиняющиеся степенному закону, вязкоупругие жидкости (имеющие как вязкие, так и упругие свойства) и жидкости с вязкостью, меняющейся во времени. Плазмидная ДНК означает небольшое клеточное включение, состоящее из кольца ДНК, не являющегося хромосомой, которое может обладать способностью иметь встроенный в него неэндогенный фрагмент ДНК. При использовании здесь, плазмидная ДНК может также представлять собой любую форму плазмидной ДНК, такую как разорванная, обработанная или другая подвергнутая манипуляциям форма нехромосомной ДНК, включая, например, любую из приведенных ниже или любую комбинацию из приведенных ниже: плазмидную ДНК с однонитевым разрывом кольца, релаксированную кольцевую плазмидную ДНК, суперспирализованную плазмидную ДНК, разорванную плазмидную ДНК, линеаризованную или линейную плазмидную ДНК и однонитевую плазмидную ДНК. Методики конструирования плазмид включают методики, описанные в Maniatis et al., Molecular Cloning, A Laboratory Manual, 2d,Cold Spring Harbor Laboratory Press (1989). Протокол мини-получения плазмидной ДНК, хорошо известный в данной области техники (Birnboim and Doly, Nucleic Acids Research 7: 1513 (1979, можно использовать для первоначального выделения плазмидной ДНК с целью дальнейшей обработки посредством некоторых аспектов изобретения, и его можно сравнивать с высокоочищенными образцами, полученными способами по изобретению. Предпочтительно форма плазмидной ДНК представляет собой, или по меньшей мере представляет собой после получения способом очистки по изобретению, по существу замкнутую кольцевую форму плазмидной ДНК или приблизительно 80, 85, 90, 95% или более чем приблизительно 99% замкнутой кольцевой формы плазмидной ДНК. Альтернативно суперспирализованная ковалентно замкнутая форма пДНК (ссс) может быть предпочтительной в некоторых терапевтических способах, где она может быть более эффективной, чем открыто-кольцевые, линейные или многомерные формы. Следовательно, плазмидная ДНК фармацевтической чистоты может быть выделена из одной или более форм плазмид или отделена от нее, и по существу содержит одну или более чем одну нужную форму. Для целей настоящего изобретения термин "течение" относится к прохождению жидкости с конкретной скоростью потока (например литры в минуту) через смеситель, обычно под действием насоса. Следует отметить, что скорость потока через смеситель, как считается, влияет на эффективность лизиса,осаждения и перемешивания. Термины "с разрывом одной нити" и "релаксированная" ДНК означают ДНК, которая не является суперспирализованной. "Суперспирализованная" ДНК это термин, хорошо понятный в данной области техники в описании конкретной изолированной формы плазмидной ДНК. Другие формы плазмидной ДНК также известны в данной области техники."Загрязняющая примесь" представляет собой любое вещество, от которого желательно отделить или изолировать ДНК. Загрязняющие примеси включают, без ограничения ими, белки клетки-хозяина,эндотоксин, ДНК клетки-хозяина, такую как хромосомная ДНК или геномная ДНК, и/или РНК клеткихозяина. Понятно, что то, что считается или может считаться загрязняющей примесью, может зависеть от ситуации, в которой практически осуществляются способы по изобретению. "Загрязняющая примесь" может происходить или не происходить от клетки-хозяина, то есть она может представлять собой или не представлять собой примесь от клетки-хозяина."Выделение" или "очистка" первого компонента (такого как ДНК) означает обогащение этого первого компонента от других компонентов, с которыми первый компонент первоначально обнаружен. Степени нужной и/или возможной очистки приведены в данном описании. Термины "по существу чистый" и "высокоочищенный" определены как приблизительно на 95%, и предпочтительно более чем на 98,99% чистый или чистый от примесей, или имеющий менее 5%, и предпочтительно менее 1-2% примесей. ДНК фармацевтической чистоты здесь определяется как препарат ДНК, который содержит не более чем приблизительно 5% и предпочтительно не более чем приблизительно 1-2% клеточных компонентов,таких как клеточные мембраны. Кроме того, изобретение охватывает способ получения и выделения высокоочищенной плазмидной ДНК, которая является, по существу, чистой от примесей и, следовательно, представляет собой ДНК фармацевтической чистоты. Плазмидная ДНК, полученная и выделенная способом по изобретению, содержит очень низкие уровни, то есть миллионные доли (млн-1) примесей хромосомной ДНК, РНК, белка и эндотоксинов, и содержит главным образом замкнутую кольцевую форму плазмидной ДНК. Плазмидная ДНК, полученная согласно изобретению, имеет достаточную чистоту для применения в исследова-6 010576 ниях и в терапии, основанной на плазмидах, и, возможно, для материала для клинических испытаний на человеке и экспериментов с генной терапией человека."Композиция плазмидной ДНК фармацевтической чистоты" по изобретению представляет собой композицию, которая получена способом по изобретению, и/или композицию, имеющую по меньшей мере один из уровней чистоты, определенный ниже как "плазмидная ДНК фармацевтической чистоты". Предпочтительно уровень чистоты "композиции плазмидной ДНК фармацевтической чистоты" по изобретению имеет уровень чистоты, определенный по меньшей мере двумя из указанных ниже как "плазмидная ДНК фармацевтической чистоты", например, менее чем приблизительно 0,00008% хромосомной или геномной ДНК и менее чем приблизительно 0,00005% белковой примеси или, например, менее чем приблизительно 0,00008% хромосомной или геномной ДНК и менее чем приблизительно 0,1 ЭЕ (эндотоксиновых единиц) эндотоксинов/мкг. Другие сочетания уровней чистоты включены в это определение. Конечно, композиция плазмидной ДНК фармацевтической чистоты может дополнительно включать или содержать добавленные компоненты, нужные для любого конкретного применения, включая применение в комбинированном лечении, композициях и терапиях. Уровни хромосомной или геномной ДНК, РНК, эндотоксинов или белка относятся к примесям, появляющимся вследствие производства плазмиды на клеточной основе или к другой(им) примеси(ям) в процессе очистки. Как указано, "плазмидная ДНК фармацевтической чистоты" определена здесь как препарат ДНК,который содержит на уровне одной миллионной доли или млн-1 (0,0001%, то есть 0,0001 мг на 100 мг плазмидной ДНК) или менее геномной ДНК, РНК и/или белковых примесей. Также или точнее, "плазмидная ДНК фармацевтической чистоты" в данном описании может означать препарат ДНК, который содержит менее чем приблизительно 0,01%, или менее 0,001%, и предпочтительно менее 0,0001%, или предпочтительно менее 0,00008% (0,00008%, то есть 0,00008 мг на 100 мг плазмидной ДНК) хромосомной ДНК или геномной ДНК."Плазмидная ДНК фармацевтической чистоты" может также означать препарат ДНК, который содержит менее чем приблизительно 0,01%, или менее 0,001%, и предпочтительно менее 0,0001%, или предпочтительно менее 0,00002% (0,00002%, то есть 0,00002 мг на 100 мг плазмидной ДНК) примесей РНК."Плазмидная ДНК фармацевтической чистоты" может также означать препарат ДНК, который содержит менее чем приблизительно 0,0001, и наиболее предпочтительно менее 0,00005% (0,00005%, то есть 0,00005 мг на 100 мг плазмидной ДНК) белковых примесей."Плазмидная ДНК фармацевтической чистоты" может также означать препарат ДНК, который содержит менее 0,1 ЭЕ эндотоксина/мг."Плазмидная ДНК фармацевтической чистоты" здесь означает препарат ДНК, который предпочтительно является преимущественно кольцевым по форме, и точнее ДНК, которая содержит более чем 80,85, 90, 95% или более чем 99% замкнутой кольцевой формы плазмидной ДНК. Трубка Т относится к Т-образной конфигурации трубок, где Т-форма образована одним участком трубки, образованным в данной конфигурации, или более чем одним участками трубки, объединенными для создания данной конфигурации. Трубка Т имеет три плеча и центральную область, где эти плечи соединяются. Трубку Т можно использовать для смешивания ингредиентов, поскольку каждая из двух жидкостей может течь в одно из плеч трубки Т, соединенных в центральной области, и вытекать из третьего плеча. Смешивание происходит, когда жидкости соединяются. Турбулентный поток означает нерегулярное случайное движение частиц жидкости в направлениях,противоположных направлению основного потока, в котором скорость в данной точке неустойчиво варьируется по величине и направлению."Вязкоупругий" относится к жидкостям, имеющим как вязкие, так и упругие свойства. Подробное описание изобретения Данное изобретение основано на обнаружении масштабируемого способа получения высокого выхода плазмидной ДНК фармацевтической чистоты. В частности, изобретение основано на обнаружении способа получения и выделения высокоочищенной плазмидной ДНК с использованием непрерывного щелочного лизиса клеток-хозяев. На первой стадии клетки-хозяева инокулируют, то есть трансформируют плазмидной ДНК в экспоненциальной фазе роста клеток и делают посев штрихом на чашки, содержащие среду LB (ЛурияБертани), содержащую антибиотик, такой как тетрациклин. Затем каждую отдельную колонию с этой чашки инокулируют в 20 мл среды LB с добавлением соответствующего антибиотика тетрациклина в отдельных стерильных пластмассовых колбах Эрленмейера, и выращивают в течение 12-16 ч при 37 С в качающемся инкубаторе. Затем одну из этих культур используют для инокуляции 200 мл стерильной среды LB, содержащейся в 2 л колбах Эрленмейера. Эту культуру выращивают при 37 С и 200 об./мин в качающемся инкубаторе и используют для инокуляции двух 5 л колб Эрленмейера, а затем выращивают при 30 С и 200 об./мин в качающемся инкубаторе и используют для инокуляции ферментера в середине экспоненциальной фазы через 5 ч и при OD 600 нм (оптической плотности при 600 нм), равной 2 едини-7 010576 цам. Культуры клеток-хозяев и инокуляция хорошо известны в данной области техники. Как правило,клетки-хозяева выращивают до тех пор, пока они не достигнут большой биомассы, и клетки находятся в экспоненциальной фазе роста с целью получения большого количества плазмидной ДНК. Можно использовать два разных способа, то есть периодическую ферментацию и подпитываемую ферментацию. Периодическая ферментация дает возможность регулировать скорость роста посредством манипуляции с температурой роста и используемым источником углерода. При использовании здесь термин"периодическая ферментация" представляет собой процесс культивирования клеток, при котором все питательные вещества, необходимые для роста клеток и для продуцирования плазмиды, содержащейся в культивируемых клетках, находятся в сосуде в большом избытке (например в 10-кратном избытке по сравнению с концентрациями питательных веществ из предшествующего уровня техники) в момент инокуляции, что позволяет, таким образом, избежать необходимости делать добавки в стерильный сосуд после постстерилизационных добавлений и необходимости в моделях и стратегиях комплексной подпитки. Другим типом ферментации, полезным в соответствии с изобретением, является подпитываемая ферментация, при которой скорость роста клеток регулируют путем добавления питательных веществ в культуру в процессе роста клеток. При использовании здесь, "подпитываемая ферментация" относится к процессу культивирования клеток, при котором скорость роста регулируется путем тщательно отслеживаемых добавлений метаболитов в культуру в процессе ферментации. Подпитываемая ферментация согласно изобретению дает возможность клеточной культуре достичь более высокой биомассы, чем периодическая ферментация. Примеры процесса ферментации и примерные скорости добавления питательных веществ описаны ниже для препарата объемом 50 л. Однако другие объемы, например, 10, 50 л или выше, такие как 500 л,также можно обрабатывать, используя приведенные в качестве примеров скорости подпитки, описанные ниже, в зависимости от масштаба оборудования. Высокообогащенная среда для периодической и подпитываемой ферментаций пригодна для получения клеточной культуры высокой плотности, чтобы максимально увеличить удельный выход плазмиды и обеспечить возможность сбора большой биомассы, находящейся все еще в экспоненциальной фазе роста. При подпитываемой ферментации используют глюкозу или глицерин в качестве источника углерода. Ферментацию проводят в периодическом режиме до тех пор, пока источник углерода (глюкоза) не истощается. Этот момент отмечают по внезапному быстрому увеличению DO и подтверждают анализом глюкозы в образце, взятом немедленно после этого события. Затем запускают насос предварительно залитой питательной среды. Скорость нагнетания определяют посредством модели, полученной из работыCurless et al. (Bioeng. 38: 1082-1090, 1991), полный объем которой включен в данное описание изобретения посредством ссылки. Эта модель разработана для облегчения регуляции фазы подпитки процесса подпитываемой ферментации. В первоначальном периодическом процессе неингибирующая концентрация субстрата потребляется клетками, растущими с максимальной для них удельной скоростью роста,обеспечивающей быстрый прирост уровней биомассы после инокуляции. Культура не может расти при данной скорости бесконечно из-за накопления токсичных метаболитов (Fieschio et al., "FermentationVCH Verlagsgesellschaft mbH 7b: 117-140, 1989). Чтобы обеспечить непрерывный логарифмический рост,в этой модели рассчитывают во времени скорость подпитки ограничивающего рост углеродного субстрата без необходимости регуляции по типу обратной связи для получения подпитываемой фазы роста, установленной оператором. Ее выбирают на уровне, который не вызывает накопления ингибирующих катаболитов и является достаточным для получения большой биомассы. Как правило, при периодической ферментации используются высокие уровни (например в 4 раза выше, чем концентрации из предшествующего уровня техники) предшественников, присутствующих в обогащенной среде периодической ферментации. В частности, количества дрожжевого экстракта в обогащенной форме среды для периодической ферментации составляют от 5 г/л (как в среде LB) до 20 г/л,обеспечивая, таким образом, огромные количества ростовых факторов и предшественников нуклеиновых кислот. В эту среду также добавляют сульфат аммония (5 г/л), который действует как источник органического азота. Добавления предшественников (органического азота в форме сульфата аммония) в процессе подпитки при подпитываемой ферментации предназначены для предотвращения неблагоприятных воздействий на качество плазмиды. Одним из важных аспектов способа согласно настоящему изобретению является клеточный лизис. Таким образом, настоящее изобретение охватывает способ получения и выделения высокоочищенной плазмидной ДНК, который включает стадию клеточного лизиса, на которой имеются (а) устройства для создания турбулентного потока для быстрого перемешивания клеточной суспензии (раствор 1 на фиг. 1) с раствором, который лизирует клетки (раствор 2 на фиг. 1); и (б) устройства для создания ламинарного потока, чтобы обеспечить возможность инкубации смеси, образовавшейся на стадии (а) без существенного взбалтывания, где смесь, образовавшаяся на стадии (а), течет из устройства для создания турбу-8 010576 лентного потока в устройство для создания ламинарного потока. Согласно одному воплощению изобретения этот механизм может дополнительно содержать устройство для добавления второго раствора, который нейтрализует лизирующий раствор (раствор 3 на фиг. 1), где смесь, инкубируемая на стадии (б), течет из устройства для создания ламинарного потока в устройство для добавления второго раствора. Еще в одном воплощении этот механизм можно использовать в способе выделения плазмидной ДНК из клеток, при котором: (а) смешивают клетки со щелочным лизирующим раствором в устройстве для создания турбулентного потока и (б) нейтрализуют щелочной лизирующий раствор путем добавления кислого раствора. Несмотря на многочисленные способы, используемые в настоящее время для лизиса бактериальных клеток, ни один из них не решает проблем, вызванных вязкоупругими свойствами жидкостей и напряжениями сдвига, вовлеченными в стадии смешивания. Одним из объектов настоящего изобретения является способ использования Т-трубок для однородного и очень быстрого смешивания клеточной суспензии(раствор 1) и щелочного раствора (раствор 2) до возникновения вязкоупругой жидкости. Этот непрерывный лизис согласно настоящему изобретению обеспечивает основное преимущество, ограничивая напряжения сдвига. Т-трубки имеют, как правило, небольшой диаметр трубок, обычно диаметр менее 1 см,предпочтительно приблизительно 2 и 8 мм, и более предпочтительно приблизительно 6 мм, с целью увеличения времени контакта смешиваемых жидкостей, но при этом способе не используют смешивание,вызванное прохождением через трубку. В приведенной здесь ниже табл. 1 показано варьирование параметров В 1 а, В 1 б, В 2 устройства для создания турбулентного потока, ламинарного потока и турбулентного потока соответственно, и соответствующие им скорости потока S1, S2 и S3, как изображено на фиг. 1. Таблица 1 Другим объектом настоящего изобретения является смеситель или инжектор с трубками вместо Т,который обеспечивает возможность дисперсии клеток в лизирующем растворе. Соответственно, механическая нагрузка на жидкости, которые проходят через эти трубки, значительно снижена по сравнению со случаем, когда жидкости перемешивают, например, с помощью лопастей в резервуарах. Первоначальная эффективность смешивания приводит даже к большей эффективности в секундах, чем последующая,поскольку эта жидкость еще не обладает вязкоупругими свойствами, и смешивание, осуществляемое в трубках небольшого диаметра, является очень эффективным. Напротив, когда Т-трубку используют для смешивания, первоначальное смешивание является очень умеренным, поскольку жидкость быстро становится вязкоупругой, что приводит к значительным проблемам при протекании по трубке. Это частичное смешивание приводит к лизису только части клеток и, следовательно, может высвобождать только часть плазмид до нейтрализации. В соответствии с настоящим изобретением авторы изобретения идентифицировали две фазы в процессе лизиса, названные фаза I и фаза II. Эти две фазы соответствуют I) лизису клеток и II) денатурации нуклеиновых кислот, вызывающей основное изменение в реологическом поведении, которое приводит в результате к вязкоупругой жидкости. Регуляция диаметров трубок дает возможность удовлетворять потребности этих двух фаз. Внутри трубки небольшого диаметра (В 1 а) смешивание усиливается. Эта конфигурация используется для фазы I. Внутри трубки большого диаметра (В 1 б) смешивание (а, следовательно, напряжение сдвига) уменьшается. Эта конфигурация используется для фазы II. Соответственно, авторы изобретения используют смеситель, обозначенный как М 1, который изображен на фиг. 2. Любое Т-образное устройство также можно использовать для получения дисперсии клеточной суспензии в соответствии с настоящим изобретением. С помощью данного смесителя раствор 1 легко впрыскивают в противоположном направлении в раствор для щелочного лизиса через одно или более чем одно отверстие небольшого диаметра с целью получения эффективной дисперсии. Диаметры этих отверстий составляют приблизительно от 0,5 до 2 мм, и предпочтительно приблизительно 1 мм в изображенной конфигурации. Смесь выходит из смесителя М 1 для прохождения через трубку небольшого диаметра (фиг. 1) за короткий период времени (приблизительно 2,5 с). Сочетание диаметра и времени протекания можно легко рассчитать для поддержания турбулентного потока. Примеры вариаций этих параметров представлены в табл. 1. Все указания диаметра трубки представляют собой внутренний диаметр этой трубки, а не наружный диаметр, который включает толщину самих стенок трубки. Такое короткое время нахождения в трубке обеспечивает очень быструю гомогенизацию растворов 1 и 2. С учетом того, что раствор 1 и раствор 2 все еще представляют собой ньютоновские текучие среды во время фазы I, во время фазы го-9 010576 могенизации режим потока является турбулентным. При выходе из этой трубки растворы 1 и 2 гомогенизированы, и начинается лизис клеток в суспензии. Затем эта гомогенизированная смесь проходит через вторую трубку (В 1 б) намного большего диаметра (фиг. 1), в которой происходит лизис клеток и образование вязкоупругой жидкости. Во время этой фазы смешивание может быть минимизировано, и раствору можно дать возможность "отстояться", чтобы насколько возможно ограничить турбулентность с целью минимизации какого-либо напряжения сдвига,которое иначе фрагментировало бы геномную ДНК. В одном воплощении настоящего изобретения время контакта приблизительно 1-3 мин, приблизительно 2 мин и предпочтительно 1 мин 20 с является достаточным для полного завершения клеточного лизиса и денатурации нуклеиновых кислот. Во время фазы денатурации режим потока жидкости является ламинарным, что способствует медленной диффузии SDS и гидроксида натрия в направлении компонентов клетки. Затем лизат, полученный таким образом, и раствор для нейтрализации 3, смешивают в Y-смесителе,обозначенном как М 2. В одном воплощении настоящего изобретения внутренний диаметр смесителя Y составляет приблизительно 4-15 мм, или приблизительно 6-10 мм, и может составлять приблизительно 6 мм или приблизительно 10 мм. Трубку малого диаметра ("например трубку диаметром приблизительно 6 мм) располагают на выходе из Y-смесителя, что обеспечивает быстрое (1 с) и эффективное смешивание лизата с раствором 3. Затем нейтрализованный раствор собирают в сборник. В процессе нейтрализации быстрое снижение рН индуцирует образование флокулята (то есть образование комков или масс). С другой стороны, частично денатурированная плазмида очень быстро ренатурирует и остается в растворе. Хлопья постепенно выпадают в осадок в сборнике, захватывая массу примесей. Схематичное изображение на фиг. 1 иллюстрирует одно воплощение системы непрерывного лизиса(CL). Непрерывный лизис можно использовать сам по себе или с дополнительными процессами. Способ по настоящему изобретению можно использовать для лизиса любого типа клеток (то есть прокариотических или эукариотических) для любой цели, относящейся к лизису, как, например, высвобождение нужной плазмидной ДНК из клеток-мишеней для дальнейшей очистки. В предпочтительном воплощении способ по настоящему изобретению используют для лизиса клеток-хозяев, содержащих плазмиды, для высвобождения этих плазмид. Процесс стадии непрерывного щелочного лизиса согласно настоящему изобретению можно осуществлять на клетках, собранных из ферментаций, которые выращивали до биомассы клеток, еще не достигших стационарной фазы и находящихся, таким образом, в фазе экспоненциального роста (2-10 г сухой массы/литр). Стадию непрерывного щелочного лизиса можно также осуществлять на клетках, собранных из ферментаций, которые выращивали до высокой биомассы клеток и которые более не находятся в экспоненциальной фазе роста, а достигли стационарной фазы, с концентрацией клеток приблизительно 10-200 г сухой массы на литр, и предпочтительно 12-60 г сухой массы на литр. Другим важным аспектом изобретения являются композиции высокоочищенной плазмидной ДНК и композиции плазмидной ДНК фармацевтической чистоты, полученные посредством комбинации хроматографических стадий, которые можно комбинировать или не комбинировать с вышеупомянутым аспектом клеточного лизиса. Таким образом, изобретение также охватывает или дополнительно включает способ получения и выделения высокоочищенной плазмидной ДНК, которая является по существу чистой от примесей и, следовательно, представляет собой ДНК фармацевтической чистоты. Плазмидная ДНК,полученная и выделенная способом по изобретению, содержит очень низкие уровни, то есть миллионные доли (млн-1) примесей хромосомной ДНК, РНК, белка и эндотоксинов и содержит, главным образом,замкнутую кольцевую форму плазмидной ДНК. Плазмидная ДНК, полученная в соответствии с изобретением, является достаточно чистой для применения в исследованиях и в терапии, основанной на плазмидах. Как отмечено выше, композиция плазмидной ДНК фармацевтической чистоты по изобретению может в одном аспекте быть описана уровнем чистоты в отношении одной или более типичных примесей, таких как примеси от клетки-хозяина. Соответственно, композиция плазмидной ДНК фармацевтической чистоты по изобретению может представлять собой композицию, которая содержит примеси геномной ДНК, РНК и/или белков в количестве одной миллионной доли или млн-1 ( 0,0001%, то есть 0,0001 мг на 100 мг плазмидной ДНК) или менее. Точнее, композиция плазмидной ДНК фармацевтической чистоты может содержать препарат плазмидной ДНК, который содержит менее чем приблизительно 0,01%, или менее 0,001%, и предпочтительно менее 0,0001%, или предпочтительно менее 0,00008%(0,00008%, то есть 0,00008 мг на 100 мг плазмидной ДНК) хромосомной ДНК или геномной ДНК клетки-хозяина. Композиция плазмидной ДНК фармацевтической чистоты может также содержать препарат плазмидной ДНК, который содержит менее чем приблизительно 0,01%, или менее 0,001%, и предпочтительно менее 0,0001%, или предпочтительно менее 0,00002% (0,00002%, то есть 0,00002 мг на 100 мг плазмидной ДНК) примеси РНК клетки-хозяина. Композиция плазмидной ДНК фармацевтической чистоты может содержать препарат плазмидной ДНК, который содержит менее чем приблизительно 0,0001%, и наиболее предпочтительно менее 0,00005% (0,00005%, то есть 0,00005 мг на 100 мг плазмидной ДНК) примесей белков клетки-хозяина. Композиция плазмидной ДНК фармацевтической чистоты может также содержать препарат плазмидной ДНК, который содержит менее 0,1 ЭЕ эндотоксина/мг.- 10010576 В частности, любая комбинация по меньшей мере двух, либо по меньшей мере трех, либо четырех из этих уровней чистоты также включена в данное изобретение. Таким образом, композиция, имеющая детектируемый уровень геномной ДНК хозяина менее чем приблизительно 0,01% и менее чем приблизительно 0,001% РНК клетки-хозяина, может быть включена в данное изобретение. Наиболее предпочтительно композиция плазмидной ДНК фармацевтической чистоты может иметь менее чем приблизительно 0,00008% геномной ДНК клетки-хозяина, и менее чем приблизительно 0,00002% РНК клетки-хозяина,и менее чем приблизительно 0,00005% белка клетки-хозяина. В действительности, любую комбинацию уровней чистоты, указанных выше, можно использовать для любой конкретной композиции плазмидной ДНК фармацевтической чистоты по изобретению. Эти композиции могут также содержать другие фармацевтически приемлемые компоненты, буферы, стабилизаторы или соединения для улучшения переноса генов, и, в частности, переноса плазмидной ДНК в клетку или организм. В другом аспекте способы по изобретению включают использование аффинной хроматографии с образованием тройной спирали, которой предшествует или за которой следует по меньшей мере одна дополнительная хроматографическая методика, возможно или обычно в качестве конечных стадий очистки или, по меньшей мере, в конце или близко к концу схемы очистки плазмиды. В сочетании с аффинной хроматографией с образованием тройной спирали используется предпочтительно одна или более чем одна из ионообменной хроматографии, гидрофобной хроматографии или гель-проникающей или гельвытесняющей хроматографии. Другие методики включают хроматографию на гидроксиапатите (типа I иII), на обращенной фазе и аффинную хроматографию. Любой имеющийся протокол аффинной хроматографии, включающий выделение нуклеиновой кислоты, можно адаптировать для использования. В анионообменной хроматографии, или в одной, или более чем одной из других используемых хроматографических стадий или методик можно использовать стационарные фазы, способы вытеснительной хроматографии, технологию симулированного подвижного слоя и/или колонки или системы с непрерывным слоем. Кроме того, в одной или более чем одной из стадий или методик можно использовать методики или системы хроматографии высокого разрешения. Таким образом, способ по изобретению включает стадии очистки, включающие аффинную хроматографию с образованием тройной спирали с дополнительной стадией ионообменной хроматографии, а также может дополнительно включать гидрофобную хроматографию или гель-проникающую хроматографию. Стадия ионообменной хроматографии может представлять собой как ионообменную хроматографию в псевдоожиженном слое, так и осевую и/или радиальную анионообменную хроматографию высокого разрешения. Способ, таким образом, включает стадию щелочного лизиса, описанную здесь, в сочетании с последующими стадиями ионообменной хроматографии, аффинной хроматографии с образованием тройной спирали и гидрофобной хроматографии, которые проводят в данном порядке. Фильтрация лизата или другое удаление флокулята может предшествовать первой стадии хроматографии. Способы по изобретению, описанные здесь для очистки плазмидной ДНК, являются масштабируемыми и следовательно, их можно масштабировать до крупномасштабного производства. В некоторых воплощениях изобретения непрерывный лизис можно комбинировать с дополнительными стадиями очистки с получением в результате высокоочищенного продукта, содержащего пДНК. Его можно, например, объединять по меньшей мере с одним из удаления флокулята (такого как фильтрация лизата, осаждение или центрифугирование), ионообменной хроматографии (такой как катионо- или анионообменная), триплексной аффинной хроматографии и гидрофобной хроматографии. В одном воплощении за непрерывным лизисом следует анионообменная хроматография, триплексная аффинная хроматография и гидрофобная хроматография в указанном порядке. В другом воплощении за непрерывным лизисом следует фильтрация лизата, анионообменная хроматография, триплексная аффинная хроматография и гидрофобная хроматография в указанном порядке. Эти три стадии обеспечивают действительно масштабируемый процесс получения плазмид, который позволяет производить большие количества пДНК беспрецедентной чистоты. Как ДНК, так и РНК хозяина, а также белки присутствуют в количестве менее миллионных долей. В способе по настоящему изобретению также можно использовать дополнительные стадии гельфильтрационной хроматографии (SEC), хроматографии на обращенной фазе, хроматографии на гидроксиапатите и/или другие доступные хроматографические методики, способы или системы в комбинации со стадиями, описанными здесь, в соответствии с настоящей заявкой. Удаление флокулята можно использовать для обеспечения более высокой чистоты полученного в результате продукта пДНК. Эту стадию можно использовать для удаления всего объема осажденного материала (флокулята). Одним из механизмов осуществления удаления флокулята является стадия фильтрации лизата, такой как фильтрация через фильтр с сеткой 1-5 мм и предпочтительно 3,5 мм с последующей объемной фильтрацией в качестве стадии отделочной фильтрации. Другими способами осуществления удаления флокулята являются центрифугирование или осаждение. Ионообменную хроматографию можно проводить для обеспечения более высокой чистоты получаемого продукта пДНК. Анионный обмен может быть выбран в зависимости от свойств примесей и рН раствора.- 11010576 Анионообменную хроматографию можно проводить для обеспечения более высокой чистоты полученного в результате продукта пДНК. Анионообменная хроматография действует посредством связывания отрицательно заряженных (или кислых) молекул с носителем, который является положительно заряженным. Таким образом, использование ионообменной хроматографии позволяет разделить молекулы на основе их заряда. Семейства молекул (кислые, основные и нейтральные) можно легко разделить с помощью этой методики. Можно использовать схемы ступенчатого элюирования, где многие примеси элюируются в более ранних фракциях, а пДНК элюируется в более поздних фракциях. Анионообмен очень эффективен для удаления белка и эндотоксина из препарата ДНК. Набивочный материал для ионообменной хроматографии и способ получения такого материала, а также процесс изготовления, полимеризации и функционализации анионообменной хроматографии, а также элюирования и выделения плазмидной ДНК посредством этого хорошо известны в данной области техники. Соединения, которые следует использовать для синтеза материалов основы, используемых для набивочного материала при анионообменной хроматографии, могут представлять собой любые соединения, если различные функциональные группы, которые проявляют гидрофобность, или различные ионообменные группы можно ввести путем последующего взаимодействия после того, как материалы основы синтезированы. Примеры монофункциональных мономеров включают стирол, орто-галогенометилстирол, метагалогенометилстирол, пара-галогенометилстирол, орто-галогеноалкилстирол, мета-галогеноалкилстирол, пара-галогеноалкилстирол,-метилстирол,-метил-орто-галогенометилстирол,-метил-метагалогенометилстирол, -метил-пара-галогенометилстирол, -метил-орто-галогеноалкилстирол, -метил-метагалогеноалкилстирол,-метил-пара-галогеноалкилстирол,орто-гидроксиметилстирол,метагидроксиметилстирол, пара-гидроксиметилстирол, орто-гидроксиалкилстирол, мета-гидроксиалкилстирол,пара-гидроксиалкилстирол, -метил-орто-гидроксиметилстирол, -метил-мета-гидроксиметилстирол, метил-пара-гидроксиметилстирол, -метил-орто-гидроксиалкилстирол, -метил-мета-гидроксиалкилстирол,-метил-пара-гидроксиалкилстирол, глицидилметакрилат, глицидилакрилат, гидроксиэтилакрилат, гидроксиметакрилат и винилацетат. Наиболее предпочтительными соединениями являются галогеналкильные группы, замещенные на ароматическом кольце, галогены, такие как Cl, Br, I и F, и прямоцепочечные и/или разветвленные углеводороды с числом атомов углерода от 2 до 15. Примеры полифункциональных мономеров включают дивинилбензол, тривинилбензол, дивинилтолуол, тривинилтолуол, дивинилнафталин, тривинилнафталин, этиленгликольдиметакрилат, этиленгликольдиакрилат, диэтиленгликольдиметакрилат, диэтиленгликольдиакрилат, метиленбисметкариламид и метиленбисакриламид. Различные ионообменные группы можно вводить путем последующего взаимодействия. Изготовление материала основы включает первую стадию, на которой монофункциональный мономер и полифункциональный мономер взвешивают в соответствующем соотношении и добавляют точно взвешенный разбавитель или растворитель, который используют с целью регуляции пор в образующихся частицах, и аналогично точно взвешенный инициатор полимеризации, после чего все хорошо перемешивают. Затем эту смесь подвергают полимеризации в суспензии типа масло в воде, где смесь добавляют в растворенную в водном растворе суспензию стабилизатора, предварительно точно взвешенного, и капли масла целевого размера образуются посредством перемешивания мешалкой, и полимеризацию проводят путем постепенного нагревания смешанного раствора. Отношение монофункционального мономера к полифункциональному мономеру обычно составляет приблизительно 1 моль монофункционального мономера и приблизительно 0,01-0,2 моль полифункционального мономера так, чтобы получить мягкие частицы материала основы. Инициатор полимеризации также не ограничен конкретно, и обычно используют инициаторы азобис-типа и/или перекисного типа. Стабилизаторы суспензии, такие как ионные поверхностно-активные вещества, неионные поверхностно-активные вещества и полимеры с амфипатическим свойством или их смеси также можно использовать для предотвращения агрегации между самими каплями масла. Набивочный материал, используемый для ионообменной хроматографии с целью очистки плазмидных ДНК, предпочтительно должен иметь относительно большой диаметр пор, в частности в интервале от 1500до 4000 . Поверхностная модификация для введения ионообменных групп в материалы основы хорошо известна в данной области техники. Для ионообменной хроматографии можно использовать два типа элюентов. Можно использовать первый элюент, содержащий низкую концентрацию соли, и второй элюент, содержащий высокую концентрацию соли. Метод элюирования состоит в ступенчатом переключении с первого элюента на второй элюент и в методе градиентного элюирования, при котором состав постепенно меняется с первого элюента на второй элюент. Можно использовать буферы и соли, которые обычно используют в подобных элюентах для ионообменной хроматографии. Для первого элюента, содержащего низкую концентрацию соли, особенно предпочтительным является водный раствор с концентрацией буфера от 10 до 50 мМ и значением рН 6-9. Для второго элюента, содержащего высокую концентрацию соли, особенно предпочтителен водный раствор 0,1-2 М натриевой соли, добавленной в элюент С. В качестве натриевых солей можно использовать хлорид натрия и сульфат натрия.- 12010576 Кроме того, можно использовать хелатирующий агент для двухвалентного иона металла, такой как,например, этилендиаминтетрауксусная кислота, для ингибирования разрушения плазмид за счет ферментов, разрушающих ДНК, в лизате Escherichia coli. Концентрация хелатирующего агента для двухвалентных ионов металлов предпочтительно составляет от 0,1 до 100 мМ. Для использования в настоящем изобретении пригодно широкое множество имеющихся в продаже анионообменных матриц, включая, без ограничения ими, доступные от POROS Anion Exchange Resins,Qiagen, Toso Haas, Sterogene, Spherodex, Nucleopac и Pharmacia. Например, колонку (Poros II PI/M, 4,5 мм 100) сначала уравновешивают 20 мМ Бис/Трис-пропаном при рН 7,5 и 0,7 М NaCl. Образец загружают и промывают тем же первоначальным буфером. Затем применяют градиент элюирования от 0,5 М до 0,85 М NaCl приблизительно в 25 объемах колонки, и фракции собирают. Предпочтительная анионообменная хроматография включает Fractogel TMAE HiCap. Согласно предпочтительному воплощению способа выделения и очистки плазмидной ДНК, настоящее изобретение относится к способу выделения и очистки нуклеиновых кислот и/или плазмидной ДНК с помощью комбинации ионообменной хроматографии и хроматографии с образованием тройной спирали для эффективного получения нуклеиновых кислот с высокой чистотой в большом количестве. Аффинная хроматография с образованием тройной спирали описана среди прочего в патентах США 6319672, 6287762, а также в международной патентной заявке данного заявителя, опубликованной под номером WO02/77274. Аффинная хроматография с образованием тройной спирали основана на специфической гибридизации олигонуклеотидов и последовательности-мишени в пределах двунитевой ДНК. Эти олигонуклеотиды могут содержать следующие основания: тимидин (Т), который способен образовывать триплеты с дублетами А.Т двунитевой ДНК (Rajagopal et al, Biochem 28 (1989) 7859); аденин (А), который способен образовывать триплеты с дублетами А.Т двунитевой ДНК; гуанин (G), который способен образовывать триплеты с дублетами G.C двунитевой ДНК; протонированный цитозин (С+), который способен образовывать триплеты с дублетами G.C двунитевой ДНК (Rajagopal et al., цитируется здесь); урацил (U), который способен образовывать триплеты с парами оснований A.U или А.Т. Предпочтительно используемый олигонуклеотид содержит богатую цитозином гомопиримидиновую последовательность, и специфическая последовательность, присутствующая в ДНК, представляет собой последовательность гомопурин-гомопиримидин. Присутствие цитозинов обеспечивает возможность получения тройной спирали, которая стабильна при кислом рН, когда цитозины протонированы, и дестабилизируется при щелочном рН, когда цитозины нейтрализованы. Олигонуклеотид и специфическая последовательность, присутствующая в ДНК, предпочтительно комплементарны, что позволяет образовать тройную спираль. Лучшие выходы и лучшую избирательность можно получить, используя олигонуклеотид и специфическую последовательность, которые являются полностью комплементарными. Например, олигонуклеотид поли(СТТ) и специфическая последовательность поли(GAA). Предпочтительные олигонуклеотиды имеют последовательность 5'GAGGCTTCTTCTTCTT СТТСТТСТТ-3' (GAGG(CTT)7 (SEQ ID NO: 1), где основания GAGG не образуют тройную спираль, но обеспечивают отделение в пространстве олигонуклеотида от связывающего плеча; последовательность (СТТ)7. Эти олигонуклеотиды способны образовывать тройную спираль со специфической последовательностью, содержащей комплементарные единицы (GAA). Интересующей последовательностью может, в частности, являться участок, содержащий 7,14 или 17 GAA единиц, как описано в примерах. Другой последовательностью, представляющей особый интерес, является последовательность 5'AAGGGAGGGAGGA GAGGAA-3' (SEQ ID NO: 2). Эта последовательность образует тройную спираль с олигонуклеотидами 5'-AAGGAGAGGAGGGAGGGAA-3'NO: 3) или 5'TTGGTGTGGTGGGTGGGTT-3' (SEQ ID NO: 4). В данном случае олигонуклеотид связывается в антипараллельной ориентации с полипуриновой нитью. Эти тройные спирали стабильны только в присутствииMg2+ (Vasquez et al., Biochemistry, 1995, 34, 7243-7251; Beal and Dervah, Science, 1991, 251,1360-1363). Как указано выше, специфическая последовательность может представлять собой последовательность, естественно присутствующую в двунитевой ДНК, или синтетическую последовательность, искусственно введенную в последнюю. Особенно предпочтительно использовать олигонуклеотид, способный образовывать тройную спираль с последовательностью, естественно присутствующей в двунитевой ДНК, например в точке начала репликации плазмиды или в маркерном гене. В связи с этим, на основании анализа последовательностей известно, что некоторые участки этих ДНК, в частности точка начала репликации, могут иметь гомопуриновые-гомопиримидиновые участки. Синтез олигонуклеотидов, способных образовывать тройные спирали с этими природными гомопуриновыми-гомопиримидиновыми участками, предпочтительно обеспечивает применение способа по изобретению к немодифицированным плазмидам, в частности, к имеющимся в продаже плазмидам pUC, pBR322, pSV и подобного типа. Среди гомопуриновых-гомопиримидиновых последовательностей, естественно присутствующих в двунитевой ДНК, можно упомянуть последовательность, содержащую полностью или частично последовательность- 13010576 5'-CTTCCCGAAGGGAGGG-3' (SEQ ID NO: 5), присутствующую в точке начала репликации плазмидыColEI E. coli. В этом случае олигонуклеотид, образующий тройную спираль, имеет последовательность: 5'-GAAGGGCTTCCCTCTTTCC-3' (SEQ ED NO: 6), и попеременно связывается с двумя нитями двойной спирали, как описано Beal and Dervah (J. Am. Chem. Soc. 1992, 114, 4976-4982) и Jayasena and Johnston(Nucleic Acids Res. 1992, 20, 5279-5288). Можно также упомянуть последовательность 5'GAAGGAAGAG-3' (SEQ ID NO: 7) гена bbb-лактамазы плазмиды pBR322 (Duval-Valentin et al, Proc.Natl. Acad. Sci. USA, 1992, 89, 504-508). Подходящие последовательности-мишени, которые могут образовывать триплексные структуры с конкретными олигонуклеотидами, идентифицированы в точках начала репликации плазмид Co1EI, а также плазмид pCOR. Плазмиды pCOR представляют собой плазмиды со стандартной точкой начала репликации и описаны среди прочего в US 2004/142452 и US 2003/161844. ColEI-производные плазмиды содержат 12-мерную гомопуриновую последовательность (5,-AGAGGA-3,) (SEQ ID NO: 8), картированную вверх по направлению считывания от транскрипта РНК-II, вовлеченного в репликацию плазмиды(Lacatena et al., 1981, Nature, 294, 623). Эта последовательность образует стабильную триплексную структуру с 12-мерным комплементарным олигонуклеотидом 5'-ТСТТТТТТТССТ-3' (SEQ ID NO: 9). КаркасpCOR содержит гомопуриновый участок из 14 неповторяющихся оснований (5'-AAGAAGAA-3') (SEQID NO: 10), локализованный в А+Т-богатом сегментеточки начала репликации pCOR (Levchenko et al.,1996, Nucleic Acids Res., 24, 1936). Эта последовательность образует стабильную триплексную структуру с 14-мерным комплементарным олигонуклеотидом 5'-ТТСТТТТТТТТСТТ-3' (SEQ ID NO: 11). Соответствующие олигонуклеотиды 5'-ТСТТТТТТТССТ-3' (SEQ ID NO: 8) и 5'-ТТСТТТТТТТТСТТ-3' (SEQ IDNO: 11) эффективно и специфично распознают их соответствующие комплементарные последовательности, локализованные в точке начала репликации либо ColEI ori, либо pCOR (ori). В действительности,единственная неканоническая триада (TGC или САТ) может привести к полной дестабилизации триплексной структуры. Использование олигонуклеотида, способного образовывать тройную спираль с последовательностью, присутствующей в точке начала репликации или в маркерном гене, обладает особым преимуществом, поскольку оно дает возможность с помощью одного и того же олигонуклеотида очистить любую ДНК, содержащую указанную точку начала репликации или указанный маркерный ген. Следовательно,нет необходимости модифицировать плазмиду или двунитевую ДНК, чтобы включить в нее искусственную специфическую последовательность. Хотя предпочтительными являются полностью комплементарные последовательности, однако, очевидно, что можно допустить некоторые ошибочные спаривания между последовательностью олигонуклеотида и последовательностью, присутствующей в ДНК, при условии, что они не ведут к слишком большой потере аффинности. Можно упомянуть последовательность 5'-GGGAATAAGGG-3' (SEQ IDNO: 12), присутствующую в гене -лактамазы Е. coli. В этом случае тимин, прерывающий полипуриновую последовательность, может распознаваться гуанином третьей нити, с образованием, таким образом,триплета GTA, который является стабильным, когда он фланкирован двумя триплетами ТАТ (Kiesslinget al., Biochemistry, 1992,31,2829-2834). Согласно конкретному воплощению олигонуклеотиды по изобретению содержат последовательность (ССТ)n, последовательность (СТ)n или последовательность (СTТ)n, где n представляет собой целое число от 1 до 15 включительно. Особенно предпочтительно использовать последовательности типа (СТ)n или СTТ)n. Автор изобретения фактически показал, что на степень очистки влияет количество С в олигонуклеотиде. В частности, как показано в примере 7, степень очистки увеличивается, когда олигонуклеотид содержит меньше цитозинов. Очевидно, что в олигонуклеотидах по изобретению могут также объединяться элементы (ССТ), (СТ) или (СТТ). Используемый олигонуклеотид может быть природным (состоять из не модифицированных природных оснований) или химически модифицированным. В частности, олигонуклеотид предпочтительно может иметь некоторые химические модификации, обеспечивающие его устойчивость к нуклеазам или защиту от нуклеаз, либо повышающими его аффинность к конкретной последовательности. Под олигонуклеотидом также понимают любую сшитую последовательность нуклеозидов, которая претерпела модификацию каркаса с целью сделать его более устойчивым к нуклеазам. Среди возможных модификаций можно упомянуть олигонуклеотидфосфоротиоаты, которые способны образовывать тройные спирали с ДНК (Xodo et al., Nucleic Acids Res., 1994, 22, 3322-3330), а также олигонуклеотиды, обладающие формацеталевыми или метилфосфонатными каркасами (Matteucci et al., J. Am. Chem. Soc, 1991, 113. 77677768). Также можно использовать олигонуклеотиды, синтезированные с -аномерами нуклеотидов, которые также образуют тройные спирали с ДНК (Le Doan et al., Nucleic Acids Res., 1987,15, 7749-7760). Другой модификацией каркаса является фосфороамидатная связь. Например, можно упомянуть межнуклеотидную фосфороамидатная связь N3-P5, описанную Gryaznov и Chen, которая позволяет олигонуклеотидам образовывать особенно стабильные тройные спирали с ДНК (J. Am. Chem. Soc, 1994, 116. 31433144). Среди других модификаций каркаса можно также упомянуть использование рибонуклеотидов, 2'O-метилрибозы, фосфодиэфира и т.д. (Sun and Helene, Curr. Opinion Struct. Biol., 116, 3143-3144). Нако- 14010576 нец, каркас на основе фосфора может быть заменен полиамидным каркасом, таким как в PNA (пептидных нуклеиновых кислотах), которые также могут образовывать тройные спирали (Nielsen et al., Science,1991, 254, 1497-1500; Kim et al., J. Am. Chem. Soc, 1993, 115, 6477-6481), либо каркасом на гуанидиновой основе, таким как в DNG (дезоксирибонуклеиновом гуанидине, Proc. Natl. Acad. Sci. USA, 1995, 92, 60976101), либо поликатионными аналогами ДНК, которые также образуют тройные спирали. Тимин третьей нити может быть также заменен 5-бромурацилом, который повышает аффинность олигонуклеотида к ДНК (Povsic and Dervan, J. Am. Chem. Soc, 1989, 111. 3059-3061). Третья нить может также содержать неприродные основания, среди которых можно упомянуть 7-деаза-2'-дезоксиантозин(Milligan et al., Nucleic Acids Res., 1993, 21, 327-333), 1-(2-дезокси-(3rD-рибофуранозил)-3-метил-5 амино-1 Н-пиразоло[4,3-d]пиримидин-7-он (Koh and Dervan, J. Am. Chem. Soc, 1992, 114, 1470-1478), 8 оксоаденин, 2-аминопурин, 2'-O-метилпсевдоизоцитидин или любую другую модификацию, известную специалистам в данной области техники (обзор см. в Sun and Helene, Curr. Opinion Struct. Biol., 1993, 3,345-356). Другой тип модификации олигонуклеотида имеет цель, более конкретно, улучшения взаимодействия и/или аффинности между олигонуклеотидом и специфической последовательностью. В частности,наиболее предпочтительная модификация согласно изобретению состоит в метилировании цитозинов олигонуклеотида. Олигонуклеотид, метилированный таким образом, проявляет примечательное свойство образования стабильной тройной спирали со специфической последовательностью в интервалах рН,близких к нейтральности (5). Это, следовательно, дает возможность работать при более высоких значениях рН, чем с олигонуклеотидами из предшествующего уровня техники, то есть при значениях рН, когда риск разрушения плазмидной ДНК намного меньше. Длина олигонуклеотида, используемого в способе по изобретению, составляет между 5 и 30. Предпочтительно используют олигонуклеотид длиной более 10 пар оснований. Длина может быть адаптирована специалистом в данной области техники для каждого индивидуального случая, чтобы соответствовать нужной избирательности и стабильности взаимодействия. Олигонуклеотиды согласно изобретению можно синтезировать с помощью любой известной методики. В частности, они могут быть получены с помощью синтезаторов нуклеиновых кислот. Совершенно очевидно, что можно использовать любой другой способ, известный специалистам в данной области техники. Чтобы обеспечить возможность ковалентного связывания с носителем, олигонуклеотид, как правило, функционализируют. Так, его можно модифицировать посредством концевой группы тиол, амин или карбоксил в 5'-или 3'-положении. В частности, добавление тиоловой, аминной или карбоксильной группы обеспечивает возможность, например, сочетания олигонуклеотида с носителем, несущим функциональные группы дисульфид, малеимид, амин, карбоксил, эфир, эпоксид, бромциан или альдегид. Эти сочетания образуются путем образования дисульфидных, тиоэфирных, эфирных, амидных или аминных связей между олигонуклеотидом и носителем. Можно использовать любой другой способ, известный специалистам в данной области техники, такой как, например, бифункциональные реагенты сочетания. Кроме того, для улучшения гибридизации со связанным олигонуклеотидом может быть предпочтительно, чтобы олигонуклеотид содержал последовательность оснований "плеча" и "спейсера". Использование "плеча" обеспечивает возможность фактически связывать нуклеотид на выбранном расстоянии от носителя, что обеспечивает улучшение условий его взаимодействия с ДНК. Плечо преимущественно состоит из линейной углеродной цепи, содержащей от 1 до 18, и предпочтительно 6 или 12 (CH2) групп, и амина, который обеспечивает связывание с колонкой. Плечо сшито с фосфатом олигонуклеотида или"спейсера", состоящего из оснований, которые не препятствуют гибридизации. Так, "спейсер" может содержать пуриновые основания. В качестве примера "спейсер" может содержать последовательностьGAGG. Плечо преимущественно состоит из нормальной углеродной цепи, содержащей 6 или 12 атомов углерода. Триплексная аффинная хроматография очень эффективна для удаления РНК и геномной ДНК. Это могут быть функционализированные хроматографические носители, в массе или предварительно набитые в колонку, функционализированные пластмассовые поверхности или функционализированные латексные гранулы, ферромагнетики или другие. Предпочтительно используют хроматографические носители. В качестве примера, хроматографическими носителями, пригодными для использования, являются агароза, акриламид или декстран, а также их производные (такие как Сефадекс, Сефароза, Супероза и т.д.), полимеры, такие как поли(стирол/дивинилбензол), или, например, привитой или непривитой кремнезем. Хроматографические колонки могут работать в режиме диффузии или перфузии. Для получения лучших степеней очистки особым преимуществом обладает использование на плазмиде последовательности, содержащей несколько положений гибридизации с олигонуклеотидом. Присутствие нескольких положений гибридизации способствует, фактически, взаимодействиям между указанной последовательностью и олигонуклеотидом, что приводит к улучшению степеней очистки. Таким образом, для олигонуклеотида, содержащего п повторов мотивы (ССТ), (СТ) или (СТТ), предпочтительно использовать последовательность ДНК, содержащую по меньшей мере п комплементарных мотивов,- 15010576 и предпочтительно n+1 комплементарный мотив. Последовательность, несущая n+1 комплементарный мотив, следовательно, представляет два положения гибридизации с олигонуклеотидом. Преимущественно последовательность ДНК содержит вплоть до 11 положений гибридизации, то есть n+10 комплементарных мотивов. Способ согласно настоящему изобретению можно использовать для очистки любого типа двунитевой ДНК. Примером последней является кольцевая ДНК, например плазмида, как правило, несущая один или более чем один ген терапевтического значения. Эта плазмида может также нести точку начала репликации, маркерный ген и подобное. Способ по изобретению можно применять непосредственно к клеточному лизату. В этом воплощении плазмиду, амплифицированную путем трансформации с последующим культивированием клеток, очищают непосредственно после лизиса клеток. Способ по изобретению можно также применять к осветленному лизату, то есть к надосадочной жидкости, полученной в результате нейтрализации и центрифугирования клеточного лизата. Совершенно очевидно, что его можно применять к раствору, предварительно очищенному другими способами. Этот способ также обеспечивает очистку линейной или кольцевой ДНК, несущей важную последовательность, из смеси, содержащей ДНК с различными последовательностями. Способ согласно изобретению также можно применять для очистки двунитевой ДНК. Клеточный лизат может представлять собой лизат прокариотических или эукариотических клеток. Что касается прокариотических клеток, в качестве примеров можно упомянуть бактерии Е. coli. В,subtilis. S. typhimurium или Streptomvces. Что касается эукариотических клеток, в качестве примеров можно упомянуть клетки животных, дрожжи, грибы и тому подобное, и более конкретно дрожжи Kluyveromvces или Saccharomvces или клетки COS (африканской зеленой мартышки), СНО(яичников китайских хомячков), С 127, NIH3T3 и подобные. Способ по настоящему изобретению, который включает по меньшей мере стадию триплексной аффинной хроматографии, можно использовать для обеспечения более высокой чистоты полученного продукта - пДНК. При триплексной аффинной хроматографии олигонуклеотид связывают с носителем, таким как хроматографическая смола или другая матрица. Затем образец, подлежащий очистке, смешивают со связанным олигонуклеотидом, например, путем нанесения образца на хроматографическую колонку, содержащую олигонуклеотид, связанный с хроматографической смолой. Нужная плазмида в образце будет связываться с олигонуклеотидом, образуя триплекс. Связи между олигонуклеотидом и плазмидой могут представлять собой хугстиновские связи. Эта стадия может осуществляться при рН 5, при высокой концентрации соли в течение времени контакта 20 мин или более. Можно использовать стадию отмывки. Наконец, депротонирование цитозина происходит в нейтральном буфере, с элюированием плазмиды со смолы, связанной с олигонуклеотидом. Согласно наиболее предпочтительному воплощению способ выделения и очистки нуклеиновых кислот и/или плазмидных ДНК включает стадии ионообменной хроматографии, аффинной хроматографии с образованием тройной спирали и гидрофобной хроматографии в комбинации друг с другом. При гидрофобной хроматографии используют гидрофобные группировки на субстрате для привлечения гидрофобных участков молекул в образце для очистки. Следует отметить, что эти HIC-носители действуют посредством эффекта "образования кластеров"; когда эти молекулы ассоциируют, не образуются ни ковалентные, ни ионные связи. Преимущество гидрофобной хроматографии состоит в том, что она очень эффективно удаляет открыто-кольцевые формы плазмиды и другие примеси, такие как гДНК,РНК и эндотоксин. Синтез материалов основы для гидрофобной хроматографии, а также способ изготовления, полимеризации и функционализации гидрофобной хроматографии и, посредством этого, элюирования и выделения плазмидной ДНК хорошо известны в данной области техники, и среди прочего описаны в патенте США 6441160, который включен в данное описание изобретения посредством ссылки. Соединения, которые можно использовать для синтеза материалов основы, применяемых в качестве набивочного материала для гидрофобной хроматографии, могут представлять собой любые соединения, если различные функциональные группы, которые обладают гидрофобностью, или различные ионообменные группы могут быть введены путем последующего взаимодействия после того, как материалы основы синтезированы. Примеры монофункциональных мономеров включают стирол, орто-галогенометилстирол, метагалогенометил стирол, пара-галогенометилстирол, орто-галогеноалкилстирол, мета-галогеноалкилстирол,пара-галогеноалкилстирол,-метилстирол,-метил-орто-галогенометилстирол,-метил-метагалогенометилстирол, -метил-пара-галогенометилстирол, -метил-орто-галогеноалкилстирол, -метил-метагалогеноалкилстирол,-метил-пара-галогеноалкилстирол,орто-гидроксиметилстирол,метагидроксиметилстирол, пара-гидроксиметилстирол, орто-гидроксиалкилстирол, мета-гидроксиалкилстирол,пара-гидроксиалкилстирол, -метил-орто-гидроксиметилстирол, -метил-мета-гидроксиметилстирол, метил-пара-гидроксиметилстирол, -метил-орто-гидроксиалкилстирол, -метил-мета-гидроксиалкилстирол,-метил-пара-гидроксиалкилстирол, глицидилметакрилат, глицидилакрилат, гидроксиэтилакрилат, гидроксиметакрилат и винилацетат. Наиболее предпочтительными соединениями являются галогеноалкильные группы, являющиеся заместителями ароматического кольца, галогены, такие как Cl, Br, I и F, и прямоце- 16010576 почечные и/или разветвленные углеводороды с числом атомов углерода от 2 до 15. Примеры полифункциональных мономеров включают дивинилбензол, тривинилбензол, дивинилтолуол, тривинилтолуол, дивинилнафталин, тривинилнафталин, этиленгликольдиметакрилат, этиленгликольдиакрилат, диэтиленгликольдиметакрилат, диэтиленгликольдиакрилат, метиленбисметкариламид и метиленбисакриламид. Различные гидрофобные функциональные группы или различные ионообменные группы можно вводить путем последующего взаимодействия. Чтобы минимизировать влияние на целевые продукты,которые желательно выделить, вследствие гидрофобности, проявляемой самим материалом основы, или набухания, или сжатия самого материала основы из-за изменения концентрации соли и изменения значения рН, материал основы предпочтительно готовят, используя относительно гидрофильные мономеры,такие как глицидилметакрилат, глицидилакрилат, гидроксиэтилакрилат, гидроксиметакрилат и винилацетат. Изготовление материала основы включает первую стадию, где монофункциональный мономер и полифункциональный мономер взвешивают в соответствующем отношении и добавляют точно взвешенный разбавитель или растворитель, который используют с целью регуляции пор в образовавшихся частицах, и, аналогично, добавляют точно взвешенный инициатор полимеризации, после чего все хорошо перемешивают. Затем эту смесь подвергают полимеризации в суспензии типа масло в воде, при которой смесь добавляют в растворенную в водном растворе суспензию стабилизатора, предварительно точно взвешенного, и капли масла целевого размера образуются посредством перемешивания мешалкой, и полимеризацию проводят путем постепенного нагревания смешанного раствора. Отношение монофункционального мономера к полифункциональному мономеру обычно составляет приблизительно 1 моль монофункционального мономера и приблизительно 0,01-0,2 моль полифункционального мономера так, чтобы получить мягкие частицы материала основы. Долю полифункционального мономера можно повысить до приблизительно 0,2-0,5 моль, чтобы получить твердые частицы материалов основы. Для получения еще более твердых частиц можно использовать только полифункциональный мономер. Инициатор полимеризации также не ограничен конкретно, и обычно используют инициаторы азобис-типа и/или перекисного типа. Стабилизаторы суспензии, такие как ионные поверхностно-активные вещества, неионные поверхностно-активные вещества и полимеры с амфипатическим свойством или их смеси также можно использовать для предотвращения агрегации самих капель масла. Диаметр образовавшихся частиц обычно составляет приблизительно от 2 до 500 мкм. Предпочтительный диаметр частиц составляет от 2 до 30 мкм, и более предпочтительно приблизительно от 2 до 10 мкм. Когда целью является крупномасштабная очистка нуклеиновых кислот с высокой чистотой, он составляет приблизительно от 10 до 100 мкм, а при выделении целевого продукта из сырого исходного раствора он может составлять от 100 до 500 мкм, более предпочтительно от приблизительно 200 до 400 мкм. Для регуляции диаметра частиц можно регулировать скорость вращения мешалки во время полимеризации. Когда необходимы частицы с малым диаметром, число оборотов можно увеличить, а когда желательны большие частицы, число оборотов можно уменьшить. Здесь, поскольку используемый разбавитель применяют для регуляции пор в образующихся частицах, выбор разбавителя особенно важен. В качестве основного принципа, в отношении растворителя, используемого для полимеризации, регуляцию осуществляют, комбинируя по-разному растворитель, являющийся слабым растворителем для мономера,с растворителем, являющимся хорошим растворителем для мономера. Величина диаметра пор может быть правильно выбрана в зависимости от размера молекул нуклеиновых кислот, предназначенных для выделения, но предпочтительно он должен находиться в интервале от 500 до 4000 для набивочного материала для гидрофобной хроматографии и в интервале от 1500 до 4000 для набивочного материала для ионообменной хроматографии. При гидрофобной хроматографии для разделения нуклеиновых кислот с различной гидрофобностью предпочтительно путем использования набивочных материалов с различной гидрофобностью соответственно, важна поверхностная модификация материала основы. Гидрофобные группы могут быть выбраны среди длинноцепочечных или разветвленных, включая насыщенные углеводородные группы или ненасыщенные углеводородные группы с числом атомов углерода от 2 до 20. Ароматическое кольцо также может содержаться в этой углеводородной группе. Гидрофобные группы также могут быть выбраны среди соединений, имеющих следующую формулу: где n = от 0 до приблизительно 20, и метиленовая группа может быть прямоцепочечной или разветвленной, m = от 0 до приблизительно 3, и углеводородная группа может быть прямоцепочечной или разветвленной, и А представляет собой группу С=O или эфирную группу, но метиленовая группа может быть связана непосредственно с материалом основы без А. Гидрофобные группы могут дополнительно включать эфирную группу алкиленгликоля с количест- 17010576 вом атомов углерода от 2 до 20, которая состоит из 0-10 повторяющихся единиц, где противоположный конец функциональной группы, взаимодействующей с материалом основы, может представлять собой группу ОН, оставленную, как есть, или блокированную алкильной группой с количеством атомов углерода от 1 до 4. Вышеописанные гидрофобные группы для модификации поверхности можно использовать отдельно или в смеси. Цепь алкильных групп с числом атомов углерода от 6 до 20 предпочтительна для низкой гидрофобности, например плазмид. Длинная цепь алкильных групп, имеющих от 2 до 15 атомов углерода, предпочтительна для разделения соединений с высокой гидрофобностью, таких как РНК, происходящая изEscherichia coli, и РНК в клетках человека и животных. Алкильные группы из 4-18 атомов углерода предпочтительны для разделения соединений с относительно низкой гидрофобностью, таких как ДНК,происходящие из Escherichia coli, и ДНК в клетках человека и животных. При выделении этих соединений соединения для модификации поверхности могут быть выбраны соответственно без ограничения указанными примерами. Фактически, степень гидрофобности набивочного материала варьируется в зависимости от концентрации соли в среде или от концентрации соли в элюенте для адсорбции. Кроме того, степень гидрофобности набивочного материала различается в зависимости от количества конкретной группы, введенной в материал основы. Диаметр пор материала основы для гидрофобной хроматографии особенно предпочтительно составляет от 500 до 4000 , но он может быть выбран соответственно из указанного интервала в зависимости от размера молекул нуклеиновых кислот, которые нужно разделить. В общем случае, поскольку удерживание нуклеиновых кислот на набивочном материале и адсорбционная способность (загрузка образца) различаются в зависимости от диаметра пор, предпочтительно использовать материал основы с большим диаметром пор для нуклеиновых кислот с большим размером молекул и материал основы с малым диаметром пор для нуклеиновых кислот с малым размером молекул. Например, стироловый материал основы можно подвергать взаимодействию с гидрофобной группой, содержащей длинную цепь алкильных групп, используя галогенсодержащее соединение и/или карбонилгалогенид, и катализатор, такой как FeCl3, SnCl2 или AlCl3, и используя реакцию Фриделя-Крафта,возможно добавить ее непосредственно на ароматическое кольцо в материале основы в виде дегалогенированного соединения и/или ацилированного соединения. В случае, когда материал основы представляет собой частицы, содержащие галогеновую группу, например, при использовании соединений с группой ОН, содержащейся в добавляемой функциональной группе, такой как бутанол, и, используя реакцию Вильямсона со щелочным катализатором, таким как NaOH или KOH, можно ввести функциональную группу посредством простой эфирной связи. В случае, когда функциональная группа, которую желательно добавить, представляет собой соединение, содержащее аминогруппу, такое как гексиламин, ее возможно добавить, используя щелочной катализатор, такой как NaOH или KOH, и используя реакцию кислотного дегалогенирования. В случае, когда материал основы содержит группу ОН, напротив, если в функциональную группу, которую желательно добавить, предварительно ввести эпоксигруппу, галогеновую группу или карбонилгалогенидную группу, можно ввести эту функциональную группу посредством простой эфирной или сложной эфирной связи. В случае, когда материал основы содержит эпоксигруппу, при взаимодействии с соединением с группой ОН или аминогруппой, содержащейся в функциональной группе, которую желательно добавить, можно ввести эту функциональную группу посредством простой эфирной связи или аминной связи. Кроме того, в случае, когда функциональная группа, которую желательно добавить, содержит галогеновую группу, можно добавить эту функциональную группу посредством простой эфирной связи, используя кислый катализатор. Поскольку на долю функциональной группы, вводимой в материал основы, влияет гидрофобность целевого продукта, который желательно отделить, она не может быть ограничена, но, как правило, пригоден набивочный материал с количеством функциональной группы приблизительно от 0,05 до 4,0 ммоль, добавленной на 1 г сухого материала основы. В отношении поверхностной модификации, способ добавления функциональной группы посредством последующего взаимодействия после образования материала или частиц основы является таким же,как описано. Поверхностную модификацию проводят согласно тому же способу, при котором материал основы образуют после полимеризации с использованием мономеров с указанными функциональными группами, добавленными перед полимеризацией. Материал основы также может представлять собой пористый силикагель. Способ изготовления силикагеля включает связывание силана с использованием такого соединения, как алкилтриметоксисилан,непосредственно на частицах, полученных согласно способу, описанному в "Latest High-Speed LiquidBookstore in 1988). До или после связывания силана с использованием агента сочетания силана, содержащего эпоксигруппы, можно добавить функциональную группу согласно упомянутому выше способу. Подходящей является доля вводимой функциональной группы от приблизительно 0,05 до 4,0 ммоль функциональной группы, добавленной на 1 г сухого материала основы. Элюенты используют на стадии выделения или очистки посредством гидрофобной хроматографии.- 18010576 Как правило, используют два типа элюентов. Один элюент содержит высокую концентрацию соли, тогда как второй элюент содержит низкую концентрацию соли. Способ элюирования включает ступенчатое переключение с элюента, имеющего высокую концентрацию соли, на элюент, имеющий низкую концентрацию соли, также можно использовать способ градиентного элюирования, постепенно меняя состав с одного элюента на другой. Можно использовать буферы и соли, обычно используемые для гидрофобной хроматографии. Для элюента, содержащего высокую концентрацию соли, особенно предпочтителен водный раствор с концентрацией соли от 1,0 до 4,5 М и значением рН от 6 до 8. Для элюента, содержащего низкую концентрацию соли, особенно предпочтителен водный раствор с концентрацией соли от 0,01 до 0,5 М и значением рН от 6 до 8. Как правило, в качестве солей можно использовать сульфат аммония и сульфат натрия. Стадию очистки плазмидной ДНК посредством гидрофобной хроматографии можно проводить путем последовательного комбинирования набивочного материала, в который введена функциональная группа со слабой гидрофобностью, с набивочным материалом, в который введена функциональная группа с сильной гидрофобностью. Фактически, среда для культивирования Escherichia coli содержит в большом количестве различные компоненты, различающиеся по гидрофобности, такие как полисахариды, геномная ДНК, РНК плазмид и белки Escherichia coli. Также известно, что существуют различия в гидрофобности даже среди самих нуклеиновых кислот. Белки, которые становятся примесями, обладают более высокой гидрофобностью по сравнению с плазмидами. Многие смолы для гидрофобной хроматографии имеются в продаже, такие как Fractoge propyl,Toyopearl, Source isopropyl или любые другие смолы, имеющие гидрофобные группы. Наиболее предпочтительными смолами являются сыпучие полимерные среды Toyopearl. Toyopearl представляет собой метакриловый полимер, обладающий высокой механической и химической стабильностью. Смолы имеются в продаже в виде нефункционализированных смол серии "HW" и могут быть модифицированы при помощи химии поверхностных явлений для ионообменной хроматографии или гидрофобных взаимодействий. Можно использовать четыре типа смол Toyopearl HIC, обладающих различными химическими свойствами поверхности и уровнями гидрофобности. Гидрофобность смол Toyopearl HIC повышается в сериях: Ether, Phenyl, Butyl и Hexyl. Структуры предпочтительных смол Toyopearl HIC, то есть ToyopearlHW-65, имеющих диаметр пор 1000 , представлены ниже: Вышеописанные смолы Toyopearl могут иметь различный тип в зависимости от размера частиц.Toyopearl 650C имеет размер частиц от приблизительно 50 до 150 мкм, предпочтительно приблизительно 100 мкм, тогда как Toyopearl 650M имеет размер частиц от приблизительно 40 до 90 мкм, предпочтительно приблизительно 65 мкм, и Toyopearl 650S имеет размер частиц от приблизительно 20 до 50 мкм,предпочтительно приблизительно 35 мкм. Хорошо известно, что размер частиц влияет на разделение, то есть разделение улучшается от типа С к М и к S по размеру частиц, и, следовательно, увеличивается с уменьшением размера частиц. Наиболее предпочтительной смолой Toyopearl, используемой на стадииHIC хроматографии в процессе выделения и очистки плазмидной ДНК согласно настоящему изобретению, является Toyopearl butyl-650S, которую продает фирма Tosoh Bioscience. Согласно предпочтительному воплощению осуществляют дополнительную стадию диафильтрации. Стандартные имеющиеся в продаже материалы для диафильтрации пригодны для использования в данном процессе в соответствии со стандартными методиками, известными в данной области техники. Предпочтительным способом диафильтрации является диафильтрация с использованием ультрафильтрационной мембраны, с порогом задержания по молекулярной массе в интервале от 30000 до 500000 в зависимости от размера плазмиды. Эта стадия диафильтрации обеспечивает возможность обмена буфера,после чего проводят концентрирование. Элюат концентрируют в 3-4 раза с помощью проточной фильтрации вдоль потока (порог задержания мембраны 30 кДа) до целевой концентрации приблизительно от 2,5 до 3,0 мг/мл, и в концентрате путем диафильтрации заменяют буфер при постоянном объеме с 10 объемами физиологического раствора и доводят до целевой концентрации плазмид физиологическим- 19010576 раствором. Концентрацию плазмидной ДНК вычисляют, исходя из поглощения образцов концентрата при 260 нм. Раствор плазмидной ДНК фильтруют через 0,2 мкм капсульный фильтр и делят на несколько аликвот, которые хранят в контейнерах в холодной комнате при 2-8 С до дальнейшей обработки. Таким образом, получают очищенный концентрат, в котором концентрация плазмидной ДНК суперспирализованной плазмиды составляет приблизительно 70, 75, 80, 85, 90, 95 и предпочтительно 99%. Общий выход плазмиды в данном процессе составляет по меньшей мере 35, 40, 45, 50, 55, 60, 65, 70 и 80% при среднем выходе 60%. Согласно данному воплощению стадию диафильтрации проводят в соответствии с приведенными ниже условиями: используют буфер для стадии а) и для стадии б): 1) первая диафильтрация (стадия а) против 12,5-13,0 объемов 50 мМ Трис/HCl, 150 мМ NaCl, pH 7,4(буфер I) и 2) проводят вторую диафильтрацию концентрата с приведенной выше стадии (а) (стадия б) против 3,0-3,5 объемов солевого эксципиента (150 мМ NaCl). Эта предпочтительная стадия диафильтрации согласно настоящему изобретению эффективно и в значительной степени удаляет сульфат аммония иEDTA. Также в результате указанных стадий диафильтрации получают соответствующую физиологическую концентрацию NaCl (приблизительно 150 мМ) и конечную концентрацию Трис ниже 1 мМ (между 200 мкМ и 1 мМ). Препарат плазмидной ДНК, полученный таким образом, с использованием указанной стадии диафильтрации, содержит NaCl в качестве солевого эксципиента и соответствующую концентрацию Трисбуфера, такую чтобы поддерживать или регулировать значение рН между 7 и 7,5. Препараты плазмидной ДНК согласно настоящей заявке особенно полезны, поскольку плазмидная ДНК в них может удивительным образом сохраняться в стабильной неразрушенной форме в этих условиях в течение продолжительного периода времени при 5 С и вплоть до 25 С, то есть при комнатной температуре. Как описано, согласно способу выделения по изобретению, плазмидная ДНК с высокой чистотой может быть получена в большом количестве с помощью более простых манипуляций по сравнению с общепринятым способом. Процесс очистки плазмид можно использовать после способа непрерывного лизиса, как описано выше, или любых альтернативных способов лизиса, которые хорошо известны в данной области техники. Например, можно использовать лизис клеток микроорганизмов, содержащих плазмиду посредством протекания через нагревательный элемент. Этот процесс описан среди прочего в международной публикации WO 96/02658. Конкретный теплообменник состоял из нержавеющей стальной трубки с наружным диаметром 10 футов (305 см)0,25 дюймов (0,625 см), закрученной в спираль. Эта спираль полностью погружена в водяную баню с постоянной высокой температурой. Перепускной объем спирали составляет приблизительно 50 мл. Для измерения температур на входе и на выходе и температуры водяной бани использовали термопары и термометр соответственно. Поток продукта нагнетали в нагревающую спираль, используя перистальтический насос Masterflex с силиконовыми трубками. Клеточный лизат выходил из спирали, после чего его центрифугировали в производственной центрифуге Beckman J-21 для осветления. После центрифугирования плазмидную ДНК можно было очистить, используя способ очистки согласно настоящему изобретению. При альтернативном клеточном лизисе можно последовательно использовать статические смесители. Фактически, как описано в WO97/23601 (включенной в данное описание изобретения посредством ссылки), первый статический смеситель для лизиса клеток с помощью первого статического смесителя и для осаждения клеточного лизата с помощью второго статического смесителя можно использовать в качестве альтернативного способа лизиса клеток перед способом очистки плазмидной ДНК согласно настоящему изобретению. Большие объемы клеток можно аккуратно и непрерывно поточно лизировать,используя статический смеситель, и эти другие статические смесители размещают линейно для выполнения других функций, таких как разбавление и осаждение. Подходящие статические смесители, полезные в способе по настоящему изобретению, включают любое проточное устройство, называемое в данной области техники статическим или неподвижным смесителем, достаточной длины, чтобы обеспечить осуществление процессов по настоящему изобретению. Например, с целью лизиса клеток статический смеситель должен будет иметь длину, которая обеспечит достаточное время контакта между лизирующим раствором и клетками, чтобы вызвать лизис целевых клеток во время их прохождения через смеситель. В предпочтительном воплощении пригодные статические смесители содержат внутреннюю спиральную структуру, которая вызывает контактирование двух жидкостей друг с другом в противоположном вращающемся потоке, что приводит к смешиванию этих жидкостей вместе в турбулентном потоке. Способ выделения и очистки плазмидной ДНК согласно настоящему изобретению можно использовать для выделения и очистки любых типов векторов любых размеров. Диапазон размеров плазмидной ДНК, которая может быть выделена способом согласно настоящему изобретению, составляет от приблизительно 5 до приблизительно 50 килобаз (кб), предпочтительно от 15 до 50 кб, где ДНК включает векторный каркас приблизительно 3 кб, терапевтический ген и ассоциированные регуляторные последовательности. Таким образом, векторный каркас, полезный в изобретении, может быть способен нести вставки величиной приблизительно 10-50 кб или более. Вставка может включать ДНК из любого орга- 20010576 низма, но предпочтительно будет происходить из млекопитающих, и может включать, в дополнение к гену, кодирующему терапевтический белок, регуляторные последовательности, такие как промоторы,последовательности полиаденилирования, энхансеры, участки локус-контроля и т. д. Ген, кодирующий терапевтический белок, может иметь геномное происхождение, и, следовательно, содержать экзоны и интроны, как отражено в его геномной организации, либо может происходить от комплементарной ДНК. Такие векторы могут включать, например, векторный каркас, способный реплицироваться путем высококопийной репликации, имеющий полилинкер для вставки терапевтического гена, ген, кодирующий селективный маркер, например SupPhe тРНК, ген устойчивости к тетрациклину/канамицину, и физически является небольшим и стабильным. Векторный каркас плазмиды предпочтительно обеспечивает возможность вставки фрагментов ДНК млекопитающих, других эукариотов, прокариотов или вирусов, и полученную в результате плазмиду можно очистить и применять в терапии, основанной на плазмидах, invivo или ex vivo. Векторы, имеющие большое число копий, то есть в интервале от 20-40 копий/клетку вплоть до 1000-2000 копий/клетку, можно выделить и очистить способом согласно настоящему изобретению. Например, вектор, который включает точку начала репликации pUC, является предпочтительным согласно способу по изобретению. Точка начала репликации pUC обеспечивает более эффективную репликацию плазмидной ДНК и приводит в результате к десятикратному увеличению числа копий плазмиды/клетку по сравнению, например, с точкой начала репликации pBR322. Предпочтительно плазмидная ДНК со стандартной точкой начала репликации или pCOR, как описано в US 2003/1618445, может быть выделена способом согласно настоящему изобретению. Полученное в результате большое число копий значительно увеличивает долю плазмидной ДНК по отношению к хромосомной ДНК, РНК, клеточными белками и кофакторами, улучшает выход плазмиды и способствует более простой дальнейшей очистке. Соответственно, любой вектор (плазмидную ДНК) можно использовать согласно изобретению. Типичные векторы включают, без ограничения ими, плазмиду NV1FGF. NV1FGF представляет собой плазмиду, кодирующую кислый фактор роста фибробластов или фактор роста фибробластов типа 1 (FGF-1),полезный для лечения пациентов с конечной стадией окклюзионного заболевания периферических артерий (PAOD) или с заболеванием периферических артерий (PAD). В Camerota et al. (J Vasc. Surg., 2002, 35,5: 930-936) описано, что 51 пациенту с необратимой конечной стадией PAD, с болями в покое или некрозами ткани, внутримышечно инъецировали NV1FGF в возрастающей однократной или повторных дозах в ишемизированное бедро и икру. Затем оценивали различные параметры, такие как чрескожное давление кислорода, брахиальные индексы лодыжки и пальцев ног, оценка болей и излечение язвы. После введения NV1FGF наблюдали значительное увеличение брахиальных индексов, уменьшение боли, сокращение размера язвы и улучшенную перфузию. Клетки-хозяева, полезные согласно изобретению, могут представлять собой любой бактериальный штамм, то есть как грамположительные, так и грамотрицательные штаммы, такие как Е. coli и Salmonellatyphimurium или Bacillus, которые способны поддерживать большое число копий плазмид, описанных выше, например 20-200 копий. Штаммы-хозяева Е. coli могут быть использованы в соответствии с изобретением и включают НВ 101, DH1 и DH5F, XAC-1 и XAC-1pir116, TEX2 и TEX2pir42 (WO 04/033664). Штаммы, содержащие F-плазмиду или производные F-плазмиды (например JM109), как правило, не являются предпочтительными, поскольку F-плазмида может очищаться совместно с терапевтическим плазмидным продуктом. Согласно другому аспекту изобретение также относится к композиции, содержащей высокоочищенную плазмидную ДНК, которая является по существу чистой от примесей или где примеси составляют ниже миллионных долей, и, следовательно, представляет собой ДНК фармацевтической чистоты. Композиция плазмидной ДНК фармацевтической чистоты согласно настоящему изобретению, таким образом, содержит примеси гДНК, РНК и белков в количестве ниже миллионных долей (0,0001%, то есть 0,0001 мг на 100 мл плазмидной ДНК). Композиция плазмидной ДНК фармацевтической чистоты, таким образом, содержит менее чем приблизительно 0,01%, или менее 0,001%, и предпочтительно менее 0,0001%, или предпочтительно менее 0,00008% (0,0008%, то есть 0,0008 мг на 100 мг плазмидной ДНК) хромосомной ДНК или геномной ДНК. Композиция плазмидной ДНК фармацевтической чистоты, таким образом, содержит менее чем приблизительно 0,01%, или менее 0,001%, и предпочтительно менее 0,0001%, или предпочтительно менее 0,00002% (0,0002%, то есть 0,0002 мг на 100 мг плазмидной ДНК) примеси РНК. Композиция плазмидной ДНК фармацевтической чистоты, таким образом, содержит менее приблизительно 0,0001%, и наиболее предпочтительно менее 0,00005% белковых примесей. Композиция плазмидной ДНК фармацевтической чистоты, таким образом, содержит менее 0,1 ЭЕ эндотоксина/мг. Композиция плазмидной ДНК фармацевтической чистоты, таким образом, содержит преимущественно кольцевую форму, а точнее содержит более чем 80, 85, 90, 95 или 99% замкнутой кольцевой формы плазмидной ДНК. Настоящее изобретение также относится к жидкому препарату плазмидной ДНК, который является- 21010576 стабильным и разрушается при комнатной температуре в течение длительного периода времени и, таким образом, является полезным для хранения плазмидной ДНК, которую используют в исследованиях и в соответствующей терапии человека. Настоящее изобретение, таким образом, относится к стабильному препарату плазмидной ДНК, содержащему плазмидную ДНК, очень разбавленный буферный раствор и солевой эксципиент, где буферный раствор представлен в такой концентрации, чтобы поддерживать рН указанного препарата или композиции между 7 и 7,5. Буферные растворы, которые способны поддерживать рН композиции между 7 и 7,5, состоят либо из системы кислота/основание, содержащей Трис [трис(гидроксиметил)аминометан] или лизин, и кислоту, выбранную из сильной кислоты (например соляной кислоты) или слабой кислоты (например малеиновой кислоты, яблочной кислоты или уксусной кислоты), либо из системы кислота/основание, содержащей HEPES [2-(4-(2-гидроксиэтилпиперазин)-1-ил)этансульфоновая кислота] и сильное основание(например гидроксид натрия). Буферный раствор может также содержать смеси Трис/HCl, лизин/HCl,Трис/малеиновая кислота, Трис/яблочная кислота, Трис/уксусная кислота или HEPES/гидроксид натрия. Предпочтительно рН поддерживается между 7 и 7,5, и еще более конкретно составляет около 7,2. Солевой эксципиент, который можно использовать в препарате по настоящему изобретению, предпочтительно представляет собой NaCl в концентрации между 100 и 200 мМ, и предпочтительно в концентрации приблизительно 150 мМ. Другой солевой эксципиент может содержать анионы и катионы,выбранные из группы, состоящей из ацетата, фосфата, карбоната, SO2-4, Cl-, Br-, NO3-, Mg2+, Li+, Na+, K+ иNH4+. Молярную концентрацию буферного раствора определяют таким образом, чтобы вызвать буферный эффект в пределах и в объеме, где значение рН стабилизировано между 7 и 7,5. Стабильная композиция для сохранения плазмидной ДНК согласно настоящему изобретению, таким образом, содержит плазмидную ДНК, солевой эксципиент и буферный раствор, где буферный раствор присутствует в концентрации вплоть до 1 мМ, и предпочтительно между 250 мкМ и 1 мМ, или предпочтительно между 400 мкМ и 1 мМ, так чтобы поддерживать рН указанного препарата или композиции между 7 и 7,5. Среди буферных систем согласно изобретению Трис-буферный раствор в концентрации 400 мкМ обеспечивает особенно удовлетворительные результаты и, следовательно, является предпочтительным в плазмидном препарате по настоящему изобретению. Как показано в приведенных ниже примерах, препарат плазмидной ДНК согласно настоящему изобретению обладает великолепной стабильностью как при 4 С, так и при комнатной температуре (RT),например 20 или 25 С. В частности, препарат плазмидной ДНК является полезным в течение продолжительного периода времени длительностью от 1, 2, 3 до 6 месяцев, и вплоть до 12 месяцев при 4 С и при 25 С, например при RT. Настоящее изобретение, таким образом, относится к композиции, содержащей плазмидную ДНК,буферный раствор и солевой эксципиент, где буферный раствор присутствует в концентрации, достаточной для сохранения плазмидной ДНК в стабильной форме при температуре от 4 до 25 С. Настоящее изобретение также относится к композиции, содержащей плазмидную ДНК, буферный раствор и солевой эксципиент, где буферный раствор присутствует в концентрации, достаточной для сохранения плазмидной ДНК в стабильной форме при температуре от 4 до 25 С в течение продолжительного периода времени длительностью от 1 месяца, 2, 3 до 6 месяцев, и вплоть до 12 месяцев. В действительности, плазмидная ДНК, которую хранят при 5 С или при комнатной температуре в течение длительного периода времени, демонстрирует очень низкие скорости депуринизации и образования открыто-кольцевой формы, менее 20, 15, 10, 5 или менее или равные 1% в месяц. Композиция согласно настоящему изобретению может дополнительно содержать адъювант, такой как, например, полимер, выбранный из полиэтиленгликоля, плюроника, полисорбатного сахара или спирта. Согласно другому аспекту настоящее изобретение относится к способу сохранения плазмидной ДНК в композиции, включающем а) приготовление очищенного образца плазмидной ДНК и б) объединение указанного очищенного образца плазмидной ДНК с солевым эксципиентом и с буферным раствором, который поддерживает рН полученной в результате композиции между 7 и 7,5. Настоящее изобретение также относится к способу сохранения плазмидной ДНК в композиции при температуре вплоть до приблизительно 20 С, включающем а) приготовление очищенного образца плазмидной ДНК и б) объединение указанного очищенного образца плазмидной ДНК с солевым эксципиентом и с буферным раствором, где буферный раствор присутствует в концентрации менее 1 мМ, или между 250 мкМ и 1 мМ, и предпочтительно 400 мкМ; и в) хранение композиции плазмидной ДНК при температуре от приблизительно 4 С вплоть до приблизительно 20 С. Примеры Общие методики клонирования и молекулярной биологии Традиционные методы молекулярной биологии, такие как расщепление ферментами рестрикции,гель-электрофорез, трансформация в Е. coli, осаждение нуклеиновых кислот и тому подобное, описаны в литературе (Maniatis et al., Т., Е. F. Fritsch, and J. Sambrook, 1989. Molecular cloning: a laboratory manual,- 22010576molecular biology 1987-1988. John Willey and Sons, New York). Нуклеотидные последовательности определяли методом терминации цепи согласно уже опубликованному протоколу (Ausubel et al., 1987). Ферменты рестрикции поставлялись New England Biolabs, Beverly, MA (Biolabs). Для проведения лигирований фрагменты ДНК инкубируют в буфере, содержащем 50 мМ Трис-HCl рН 7,4, 10 мМ MgCl2, 10 мМ DTT, 2 мМ АТФ в присутствии ДНК лигазы фага Т 4 (Biolabs). Олигонуклеотиды синтезируют, используя фосфорамидитную химию с форфорамидитами, защищенными в bbb-положении группой цианоэтил (Sinha, N. D., J. Biernat, J. McManusand H. Koster, 1984.Am. Biotechnol., Nov./Dec), и автоматический синтезатор ДНК Biosearch 8600 с использованием рекомендации фирмы-производителя. Лигированные ДНК или ДНК, тестируемые на эффективность трансформации, используют для трансформации следующего компетентного штамма: Е. coli DH5 [F/endAl, hsdR17, supE44. thi-1. recA1.XAC-pir (для любой плазмиды, производной от pCor). Мини-препараты плазмидной ДНК получают согласно протоколу Klein et al., 1980. Культуральную среду LB используют для выращивания штаммов Е. coli (Maniatis et al., 1982). Штаммы инкубируют при 37 С. Бактерии высевают на чашки со средой LB, в которую добавлены соответствующие антибиотики. Пример 1. Регулировка диаметров соответственно используемым скоростям потока следует из вычислений чисел Рейнольдса в спиралях системы непрерывного лизиса. Поскольку приведенный ниже анализ предполагает, что поведение жидкостей является Ньютоновским, фигуры, приведенные ниже, являются полностью правомерными только в В 1 а и до некоторой степени в В 2. Значение числа Рейнольдса дает возможность специалисту в данной области техники точно определить тип поведения, с которым он сталкивается. Здесь авторы изобретения обращаются только к потоку жидкости в трубке (гидравлическая инженерия). 1) Неньютоновская жидкость Два типа неньютоновских жидкостей, наиболее часто встречающиеся в промышленности, представляют собой Bingham и Ostwald de Waele. В данном случае число Рейнольдса (Re) вычисляют следующим образом:ReN представляет собой обобщенное число РейнольдсаD - внутренний диаметр поперечного сечения (m)- объемная масса жидкости (кг/м 3)W - трехмерная скорость жидкости (м/с)N - индекс поведения потока (безразмерный)M - коэффициент консистенции жидкости (дин. cn/см 2) И n, и m определяют эмпирически (исследование реологического поведения). 2) Ньютоновская жидкость Как для первого раздела, в уравнении (1) мы имеем:Re = f(внутренний диаметр, ,и u), поскольку n и m являются функциями .- объемная масса жидкости (кг/м 3);- вязкость жидкости (Пас, и 1 мПас = 1 сП (сантипуаз;D - внутренний диаметр поперечного сечения (m);U - средняя трехмерная скорость ЖИДКОСТИ (м/с). Уравнение (1) для n=1 сокращается до уравнения (2). Когда Q - скорость потока (м 3/ч) и S - площадь поверхности поперечного сечения (m2) и, еслидано в сП, тогда В круговом трубопроводе поток является ламинарным для числа Рейнольдса ниже 2500, и представляет собой гидравлически постоянный турбулентный поток для числа Рейнольдса между 2000 и 500000. Граница умышленно является нечеткой, между 2000 и 2500, где оба типа поведения используют для определения того, что может происходить, и выбор делают апостериори. 3) Вычисления Поскольку n и m, как правило, неизвестны, для оценки течений использовали следующие приближения:- 23010576 Ньютоновская жидкость (во всех поперечных сечениях)= 1000 кг/м 3 (для всех жидкостей)= 5 сП в В 1 а и 40 сП в В 1 б (данные авторов изобретения) 2,5 сП в В 2 (данные авторов изобретения) Приведенные ниже вычисления проводили, используя уравнение (3) для двух стандартных тестируемых конфигураций трубок, названных конфигурация 1 и конфигурация 2 (без трубки В 1 б): Таблица 2 В этих двух конфигурациях потоки являются ламинарными на всех стадиях, и растворы достаточно смешиваются друг с другом. Для других конфигураций трубок (без трубки В 1 б) мы имеем: Таблица 3 Аналогичные вычисления проводили, используя уравнение (3) для различных конфигураций трубок при наличии обеих трубок В 1 а и В 1 б: Таблица 4 Ясно, что предварительно определенные значения Рейнольдса могут быть получены путем регулирования диаметра трубок и скоростей потока. Специалист в данной области техники может представить множество комбинаций диаметров и длин для В 2 или для двух секций В 1 (В 1 а и В 1 б). Например, первую секцию В 1 можно уменьшить с 6 мм- 24010576 до 3 мм с целью уменьшения длины и усиления перемешивания. Кроме того, n и m можно определить на основании исследования реологического поведения жидкостей и использовать для определения правильных характеристик трубок. Кроме эффективности перемешивания, можно также учитывать продолжительность перемешивания, которую в некоторых воплощениях настоящего изобретения получают путем регуляции длин спиралей. Диаметр трубок или скорость тока не является доминирующим в уравнении (1) для неньютоновской жидкости (данные не показаны). Иными словами, изменение диаметра не кажется более эффективным, чем изменение скорости потока, если уравнение (1) используют для вычислений в пределах В 1 б и в В 2. Когда желательны высокие скорости потока, диаметр может варьироваться вместе со скоростью потока. Эти принципы можно применять в качестве основания для ограничения перемешивания, насколько это возможно, в В 1 б и В 2 с целью избежать фрагментирования гДНК. Во время лизиса перемешивание может быть достаточно энергичным до тех пор, пока гДНК не денатурирует. Уменьшение диаметра в начале В 1 дает возможность усилить перемешивание (увеличенноеRe), чтобы в достаточной степени смешать раствора 2 с клетками. С другой стороны, когда клетки лизированы, перемешивание и силы трения о стенки можно уменьшить, чтобы избежать фрагментирования нуклеиновых кислот. Увеличение диаметра дает возможность уменьшить перемешивание (уменьшенноеRe) и трение (пониженная скорость). М 1: смешивание жидкостей. В 1 а: тонкая настройка смешивания в начале лизиса: явление конвекции (макросмешивание). В 1 б: обеспечивает возможность осуществления денатурации плюс явления диффузии (микросмешивание). Предполагается, что обобщенное число Рейнольдса имеет такое же значение для неньютоновской жидкости, какое классическое число Рейнольдса имеет для ньютоновской жидкости. В частности, предполагается, что границей ламинарного режима в трубопроводе с круглым поперечным сечением являетсяReN2300. Нейтрализацию осуществляют внутри В 2. Высокие скорости потока увеличивают фрагментирование геномной ДНК, вызывая перемешивание, которое является слишком энергичным, и из-за сил трения на стенках (механические нагрузки). Использование большого диаметра трубки дает возможность уменьшить перемешивание (Re) и силы трения (скорость). Авторы изобретения расположили здесь трубку малого диаметра (6 мм), чтобы избежать недостаточного перемешивания. Наблюдения авторов изобретения показывают, что лучше иметь трубку только малого диаметра для В 2, чтобы "сильно и быстро" перемешать нейтрализованный лизат. Пример 2. Авторы изобретения могут разделить систему CL (непрерывного лизиса) на 5 стадий. В одном конкретном воплощении конфигурация является следующей: 1) Смешивание: клетки (в растворе 1) + раствор 2 (М 1 + 3 м трубки диаметром 6 мм). Начало лизиса клеток посредством SDS без риска фрагментирования ДНК, пока она не денатурирует. 2) Окончание лизиса и денатурация гДНК (13 м трубки диаметром 16 мм). 3) Смешивание: лизат + раствор 3 (М 2 + 3 м трубки диаметром 6 мм). 4) Сбор нейтрализованного лизата при 4 С. 5) Осаждение флокулята и больших фрагментов гДНК в течение ночи при 4 С. Следующие условия можно использовать для проведения непрерывного лизиса: Раствор 1: EDTA 10 мМ, глюкоза (Glc) 9 г/л и Трис HCl 25 мМ, рН 7,2. Раствор 2: 1% SDS и 0,2 н. NaOH. Раствор 3: Уксусная кислота 2 М и ацетат калия 3 М. Скорость потока 60 л/ч: раствор 1 и раствор 2 Скорость потока 90 л/ч: раствор 3 Клетки доводят до 38,5 г/л раствором 1. Клетки в растворе 1 пропускают через 3 насадки, которые диспергируют их в раствор 2, который поступает из противоположного направления. Смеситель М 1 имеет геометрическое строение, дающее возможность оптимизировать смешивание двух жидкостей (см. фигуру 2, схематическое изображение смесителя). Первой секцией трубки после М 1 является В 1 а, а второй секцией является В 1 б. В 1 а: длина 3 м, диаметр 6 мм, время удерживания 2,5 с. В 1 б: длина 13 м, диаметр 16 мм, время удерживания 77 с. Способ по настоящему изобретению обеспечивает преимущество в отношении эффективности, сложенное из дисперсии, кратковременного сильного перемешивания и мягкого перемешивания посредством диффузии. С использованием способа по настоящему изобретению число лизированных клеток увеличивается и, следовательно, количество выделенной пДНК возрастает.- 25010576 Идея диффузии является особенно важной в связи с трудностью смешивания этих жидкостей из-за их свойств, в частности вязкоупругих свойств. Способ по настоящему изобретению дает возможность ограничить напряжение сдвига и, следовательно, ограничить фрагментирование гДНК, облегчая ее удаление в процессе последующей хроматографической очистки. Следующая задача состоит в смешивании с раствором 3, который может быть охлажден до 4 С. В одном воплощении в способе по изобретению используют смеситель М 2, который представляет собой Y с внутренним диаметром приблизительно 10 мм; секцию трубки В 2, помещенную после смесителя М 2. В 2: 2 м трубки диаметром 6 мм; время удерживания: 1 с. В приведенной ниже табл. 5 приведены результаты, полученные в сравнительных тестах, чтобы показать преимущества процесса непрерывного лизиса по изобретению по сравнению с периодическим лизисом. Таблица 5 Пример 3. Используемая колонка представляет собой 1 мл колонку HiTrap, активированную NHS (Nгидроксисукцинимидом, Pharmacia), соединенную с перистальтическим насосом (производительность 1 мл/мин). Используемый специфический нуклеотид имеет группу NH2 на 5'-конце, его последовательность приведена ниже: 5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1). В данном примере использовали следующие буферные растворы: Буфер для связывания: 0,2 М NaHCO3, 0,5M NaCl, pH 8,3. Буфер А: 0,5 М этаноламин, 0,5 М NaCl, pH 8,3. Буфер Б: 0,1 М ацетат, 0,5 М NaCl, pH 4. Колонку промывают 6 мл 1 мМ HCl, а затем на колонку наносят олигонуклеотид, разведенный в буфере для связывания (50 наномоль в 1 мл), и оставляют на 30 минут при комнатной температуре. Колонку промывают три раза последовательно 6 мл буфера А, а затем 6 мл буфера Б. Таким образом, олигонуклеотид ковалентно связан с колонкой посредством связи CONH. Колонку хранят при 4 С в PBS(фосфатно-солевом буфере) с 0,1% NaN3, и ее можно использовать по меньшей мере четыре раза. Синтезировали следующие два олигонуклеотида: олигонуклеотид 4817: 5'GATCCGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA GAAGAAGG-3' (SEQ IDNO: 13) и олигонуклеотид 4818: 5'-AATTCCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCG-3' (SEQ ID NO: 14). Эти олигонуклеотиды при гибридизации и клонировании в плазмиде вводят гомопуриновуюгомопиримидиновую последовательность (GAA)17 (SEQ ID NO: 15) в соответствующую плазмиду, как описано выше. Последовательность, соответствующую этим двум гибридизованным олигонуклеотидам, клонируют в множественном сайте клонирования плазмиды pBKS+ (Stratagene Cloning System, La Jolla CA), несущей ген устойчивости к ампициллину. К этому моменту олигонуклеотиды гибридизируют следующим образом: 1 мкг этих двух олигонуклеотидов помещают вместе в 40 мл конечного буфера, содержащего 50 мМ Трис HCl рН 7,4, 10 мМ MgCl2. Эту смесь нагревают до 95 С, а затем помещают при комнатной температуре, так чтобы температура медленно уменьшалась. 10 нг смеси гибридизованных олигонуклеотидов лигируют с 200 нг плазмиды pBKS+ (Stratagene Cloning System, La Jolla CA), гидролизованнойBamHI и EcoRI, в конечном объеме 30 мкл. После лигирования аликвоту трансформируют в DH5a. Трансформационные смеси высевают на среду L, в которую добавлен ампициллин (50 мг/л) и X-gal (20 мг/л). Рекомбинантные клоны должны демонстрировать отсутствие синей окраски на этой среде в противоположность исходной плазмиде (pBKS+), которая обеспечивает возможность а-комплементации фраг- 26010576 ментаbbb-галактозидазы Е. coli. После получения мини-препарата плазмидной ДНК из 6 клонов все они демонстрировали исчезновение сайта Pstl. локализованного между сайтами EcoRI и BamHI pBKS+ и увеличение молекулярной массы полосы 448 п.о. Pvull. содержащей множественный сайт клонирования. Отобрали один клон, и соответствующую плазмиду обозначили как pXL2563. Клонированную последовательность проверяли секвенированием, используя праймер -20 (5'-TGACCGGCAGCATG-3' (SEQ IDMegaprep (Promega Corp. Madison, WI) в соответствии с рекомендациями поставщика. Этот препарат плазмидной ДНК используют в примерах, описанных ниже. Плазмиду pXL2563 очищают на колонке HiTrap, связанной с олигонуклеотидом, описанным в 1.1.,из раствора, также содержащего плазмиду pBKS+. При данной очистке используют следующие буферы: Буфер Е: 2 М NaCl, 0,2 М ацетат, рН от 4,5 до 5. Буфер Д: 1 М Трис HCl, рН 9, 0,5 мМ EDTA. Колонку промывают 6 мл буфера Е, и плазмиды (20 мкг pXL2563 и 20 мкг pBKS+ в 400 мкл буфера Е) наносят на колонку и инкубируют в течение 2 ч при комнатной температуре. Колонку промывают 10 мл буфера Е, а затем проводят элюирование буфером Д. Плазмиды обнаруживают после электрофореза в 1%-ном агарозном геле и окрашивания бромистым этидием. Долю плазмид в растворе оценивали, измеряя их трансформирующую активность в отношении Е. coli. Начиная со смеси, содержащей 30% pXL2563 и 70% pBKS+, на выходе колонки выделяли раствор,содержащий 100% pXL2563. Чистота, оцениваемая по отношению OD при 260 и 280 нм, повысилась с 1,9 до 2,5, что указывает на удаление белковых примесей данным способом. Пример 4. Связывание олигонуклеотида (5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ED NO: 1 с колонкой осуществляют, как описано в примере 3. Для связывания олигонуклеотид модифицируют на 5'-конце аминной группой, связанной с фосфатом спейсера плечом, содержащим 6 атомов углерода (Modified oligonucleotide Eurogentec SA, Belgium). Плазмиду pXL2563 очищают, используя набор Wizard Megaprep(Promega Corp., Madison, WI), в соответствии с рекомендациями поставщика. В данном примере используют следующие буферы: Буфер Е: 0-2 М NaCl, 0,2 М ацетат, рН от 4,5 до 5. Буфер Д: 1 М Трис HCl рН 9, 0,5 мМ EDTA. Колонку промывают 6 мл буфера Е, а затем 100 мкг плазмиды pXL2563, разведенной в 400 мкл буфера Е, наносят на колонку и инкубируют в течение 2 ч при комнатной температуре. Колонку промывают 10 мл буфера Е, а затем проводят элюирование буфером Д. Плазмиду определяют количественно путем измерения оптической плотности при 260 нм. В данном примере связывание проводят в буфере, молярность которого в отношении NaCl варьируется от 0 до 2 М (буфер Е). Степень очистки уменьшается по мере снижения молярности NaCl. Значение рН буфера для связывания может варьироваться от 4,5 до 5, причем лучшая степень очистки соответствует 4,5. Также возможно использовать другой буфер для элюирования с щелочным рН: таким образом,элюирование проводят буфером, содержащим 50 мМ борат, рН 9, 0,5 мМ EDTA. Связывание олигонуклеотида (5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1 с колонкой осуществляют, как описано в примере 3. Плазмиду pXL2563 очищают, используя набор WizardMegaprep (Promega Corp., Madison, WI), в соответствии с рекомендациями поставщика. В данном примере используют следующие буферы: Буфер Е: 0,1 М NaCl, 0,2 М ацетат, рН 5. Буфер Д: 1 М Трис HCl рН 9, 0,5 мМ EDTA. Колонку промывают 6 мл буфера Е, а затем 100 мкг плазмиды pXL2563, разведенной в 400 мкл буфера Е, наносят на колонку и инкубируют в течение одного часа при комнатной температуре. Колонку промывают 10 мл буфера Е, а затем проводят элюирование буфером Д. Измеряют содержание геномной или хромосомной ДНК Е. coli. присутствующей в образцах плазмиды до и после прохождения через олигонуклеотидную колонку. Эту геномную ДНК определяют количественно с помощью ПЦР, используя праймеры в гене Е. coli galK. в соответствии с приведенным ниже протоколом: Последовательность этих праймеров описана Debouck et al. (Nucleic Acids Res. 1985,13, 1841-1853): 5'-CCG AAT TCT GGG GAC CAA AGC AGT TTC-3' (SEQ ID NO: 17) и 5'-CCA AGC TTC ACT GTT CAC GAC GGG TGT-3' (SEQ ID NO: 18). Реакционная среда содержит в 25 мкл ПЦР-буфера (Promega France, Charbonnieres): 1,5 мМ MgCl2; 0,2 мМ dXTP (Pharmacia, Orsay); 0,5 мМ праймера; 20 Ед/мл Taq полимеразы (Promega). Реакцию проводили в соответствии со следующей последовательностью: 5 мин при 95 С 30 циклов по 10 с при 95 С,- 27010576 30 с при 60 С, 1 мин при 78 С 10 мин при 78 С. Амплифицированный фрагмент ДНК длиной 124 пары оснований отделяют с помощью электрофореза в 3%-ном агарозном геле в присутствии SybrGreen I (Molecular Probes, Eugene, USA), а затем определяют количественно в сравнении с сериями геномной ДНК Qltrapur из Е. coli штамма В (Sigma, refD4889). Пример 5. В данном примере описана очистка плазмидной ДНК из осветленного лизата бактериальной культуры в так называемом "мини-препаративном" масштабе: 1,5 мл ночной культуры штаммов DH5a, содержащих плазмиду pXL2563, центрифугируют, и осадок ресуспендируют в 100 мкл 50 мМ глюкозы, 25 мМ Трис HCl, рН 8, 10 мМ EDTA. Добавляют 200 мкл 0,2 М NaOH, 1% SDS, пробирки переворачивают для смешивания, затем добавляют 150 мкл 3 М ацетата калия, рН 5, и пробирки переворачивают для смешивания. После центрифугирования надосадочную жидкость отделяют и наносят на олигонуклеотидную колонку, полученную, как описано в примере 1. Связывание, промывки и элюирование идентичны описанным в примере 3. Приблизительно 1 мкг плазмиды выделяют из 1,5 мл культуры. Полученная плазмида, проанализированная посредством электрофореза в агарозном геле и окрашивания бромистым этидием, принимает форму одной полосы "суперспирализованной" кольцевой ДНК. Никаких следов высокомолекулярной (хромосомной) ДНК или РНК не обнаруживают в плазмиде, очищенной данным способом. Пример 6. В данном примере описан эксперимент по очистке плазмидной ДНК, проведенный в тех же условиях, что и в примере 5, начиная с 20 мл бактериальной культуры штаммов DH5a, содержащих плазмидуpXL 2563. Осадок клеток растворяют в 1,5 мл 50 мМ глюкозы, 25 мМ Трис HCl, рН 8, 10 мМ EDTA. Лизис проводят с 2 мл 0,2 М NaOH, 1% SDS, а нейтрализацию проводят посредством 1,5 мл 3 М ацетата калия, рН 5. Затем ДНК осаждают 3 мл 2-пропанола, и осадок собирают в 0,5 мл 0,2 М ацетата натрия, рН 5,0,1 М NaCl, и наносят на олигонуклеотидную колонку, полученную, как описано в приведенном выше примере. Связывание, промывку колонки и элюирование проводят, как описано в приведенном выше примере, за исключением того, что молярность промывочного буфера в отношении NaCl составляет 0,1 М. Полученная плазмида, проанализированная посредством электрофореза в агарозном геле и окрашивания бромистым этидием, принимает форму одной полосы "суперспирализованной" кольцевой ДНК. Никаких следов высокомолекулярной (хромосомной) ДНК или РНК в очищенной плазмиде не обнаруживается. Гидролиз плазмиды с ферментом рестрикции дает одну полосу с ожидаемой молекулярной массой 3 килобазы. Плазмида содержит кассету, содержащую промотор цитомегаловируса, ген, кодирующий люциферазу, и гомопуриновую-гомопиримидиновую последовательность (GAA)17 (SEQ ID NO: 15), происходящую из плазмиды pXL2563. Штамм DH1 (Maniatis et al., 1989), содержащий эту плазмиду,культивируют в 7-литровом ферментере. Осветленный лизат получают из 200 г клеток: осадок клеток растворяют в 2 л 25 мМ Трис, рН 6,8, 50 мМ глюкозы, 10 мМ EDTA, к которым добавляют 2 л 0,2 МNaOH, 1% SDS. Лизат нейтрализуют добавлением одного литра 3 М ацетата калия. После диафильтрации 4 мл этого лизата наносят на 5 мл колонку HiTrap-NHS, связанную с олигонуклеотидом, имеющим последовательность 5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1), согласно способу, описанному в примере 3. Промывку и элюирование проводят, как описано в приведенном выше примере. Пример 7. В данном примере описано использование олигонуклеотида, несущего метилированные цитозины. Последовательность используемого олигонуклеотида приведена ниже: 5' -GAGGMeCTTMeCTTMeCTTMeCTTMeCCTMeCTTMeCTT-3' (SEQ ID NO: 19) Этот олигонуклеотид имеет группу NH2 на 5'-конце. МеС=5-метилцитозин. Этот олигонуклеотид обеспечивает очистку плазмиды pXL2563 в условиях примера 1 с буфером для связывания, рН 5 (риск разрушения плазмиды таким образом от этого снижается). Пример 8. В приведенных выше примерах используемый олигонуклеотид модифицируют на 5'-конце аминной группой, присоединенной к фосфату посредством плеча, содержащего 6 атомов углерода: NH2-(CH2)6. В данном примере аминная группа связана с фосфатом 5'-конца посредством плеча, содержащего 12 атомов углерода: NH2-(CH2)12. Связывание олигонуклеотида и пропускание через колонку проводят, как описано в примере 3, с буфером Е: 2 М NaCl, 0,2 М ацетат, рН 4,5. Этот олигонуклеотид обеспечивает возможность получить лучшие степени очистки: получают 53% выход, тогда как с олигонуклеотидом,содержащим 6 атомов углерода, данный выход составляет порядка 45% в тех же условиях. Пример 9. Следуя стратегии клонирования, описанной в примере 3, конструировали две другие плазмиды, несущие гомопуриновые-гомопиримидиновые последовательности: плазмиду pXL2725, которая содержит последовательность (GGA)16, (SEQ ID NO: 20), и плазмиду pXL2726, которая содержит последовательность (GA)25(SEQ ID NO: 21). Плазмиды pXL2725 и pXL2726, аналогичные плазмиде pXL2563, конструировали в соответствии со- 28010576 стратегией клонирования, описанной в примере 3, используя следующие пары олигонуклеотидов: 5986: 5'-GATCC(GA)25GGG-3' (SEQ ID NO: 22) 5987: 5'-ААТТССС(TC)25G-3' (SEQ ID NO: 23) 5981: 5'-GATCC(GGA)17GG-3' (SEQ ED NO: 24) 5982: 5'-AATT(CCT)17CCG-3' (SEQ ID NO: 25) Пару олигонуклеотидов 5986 и 5987 используют для конструирования плазмиды pXL2726 путем клонирования олигонуклеотидов в сайтах BamHI и EcoRI pBKS+ (Stratagene Cloning System, La Jolla CA),тогда как олигонуклеотиды 5981 и 5982 используют для конструирования плазмиды pXL2725. Используют такие же условия эксперимента, как для конструирования плазмиды pXL2563, и меняют только пары олигонуклеотидов. Аналогично, клонированные последовательности подтверждают посредством секвенирования плазмид. Это позволяет увидеть, что плазмида pXL2725 модифицирована по сравнению с ожидаемой последовательностью вместо последовательности GGA, повторенной 17 раз, присутствуетGGAGA(GGA)15 (SEQ ID NO: 26). Пример 10. Олигонуклеотиды, образующие тройные спирали с этими гомопуриновыми последовательностями,связывают с колонками HiTrap в соответствии с методикой, описанной в примере 1.1. Олигонуклеотид с последовательностью 5'-AATGCCTCCTCCTCCTCCTCCTCCT-3' (SEQ ED NO: 27) используют для очистки плазмидыpXL2725,а олигонуклеотид с последовательностью 5'AGTGCTCTCTCTCTCTCTCTCTCTCT-3' (SEQ ID NO: 28) используют для очистки плазмиды pXL2726. Две колонки, полученные таким образом, обеспечивают очистку соответствующих плазмид в соответствии с методикой, описанной в примере 2, со следующими буферами: Буфер Е: 2 М NaCl, 0,2 М ацетат, рН 4,5. Буфер Д: 1 М Трис HCl, рН 9, 0,5 мМ EDTA. Полученные выходы составляют 23% и 31% для pXL2725 и pXL2726 соответственно. Пример 11. В данном примере показано влияние длины специфической последовательности, присутствующей в плазмиде, на степень очистки. Репортерный ген, использованный в данных экспериментах с целью демонстрации активности композиций по изобретению, представляет собой ген, кодирующий люциферазу (Luc). Плазмида pXL 2621 содержит кассету, содержащую 661-п.о. промотор цитомегаловируса (CMV),клонированный вверх по направлению считывания от гена, кодирующего люциферазу, в сайтах Miul иHindlll. в векторе pGL на основе Vector (Promega Corp., Madison, WI). Эту плазмиду конструировали, используя стандартные методики молекулярной биологии. Плазмиды pXL2727-1 и pXL2727-2 конструировали следующим образом: Два микрограмма плазмиды pXL 2621 линеаризовали BamHI; фермент инактивировали путем обработки в течение 10 мин при 65 С; в то же время олигонуклеотиды 6006 и 6008 гибридизуют, как описано для конструирования плазмиды pXL2563. 6006: 5'-GATCT(GAA)17CTGCAGATCT-3' (SEQ ID NO: 29) 6008: 5'-GATCAGATCTGCAG(TTC)17A-3' (SEQ ID NO: 30). Эту гибридизационную смесь клонируют по BamHI концам плазмиды pXL 2621 и после трансформации в DH5a рекомбинантные клоны идентифицируют с помощью анализа с ферментом рестрикцииPstl, поскольку олигонуклеотиды вводят сайт Pstl. Выбирают два клона, и нуклеотидную последовательность клонированного фрагмента подтверждают,используя праймер(6282,5'ACAGTCATAAGTGCGGCGACG-3' (SEQ. ID NO: 31 в качестве праймера реакции секвенирования (Viera J. and J. Messing, 1982). pUC-Плазмиды системы, происходящей из M13mp7, использовали для инсерционного мутагенеза и секвенирования с синтетическими универсальными праймерами (Gene 19: 259268). Первый клон (pXL2727-1) содержит последовательность GAA, повторенную 10 раз. Второй клон(pXL2727-2) содержит последовательность 5'-GAAGAAGAG(GAA)7GGAAGAGAA-3' (SEQ ID NO: 32). Используют колонку, такую как описана в примере 3, которая связана с олигонуклеотидом 5'GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1). Плазмида pXL2727-1 несет 14 повторов последовательности GAA. Олигонуклеотид, описанный выше, который содержит только 7 повторов соответствующей последовательности гибридизации СТТ,может, следовательно, гибридизоваться с этой плазмидой в 8 различных положениях. Плазмида pXL 2727-2, напротив, имеет последовательность гибридизации (GAA)7 (SEQ ID NO: 36) такой же длины, что и олигонуклеотид, связанный с колонкой. Этот олигонуклеотид может, следовательно, гибридизоваться только в одном положении на pXL2727-2. Этот эксперимент является идентичным эксперименту, описанному в примере 4, с следующими буферами: Буфер Е: 2 М NaCl, 0,2 М ацетат, рН 4,5. Буфер Д: 1 М Трис HCl, рН 9, 0,5 мМ EDTA. Степень очистки составляет 29% с плазмидой pXL 2727-1 и 19% с PXL2727-2.- 29010576 Используемые клетки представляют собой клетки NIH 3T3, засеянные на сутки до эксперимента в 24-луночные культуральные планшеты исходя из 50000 клеток/лунку. Плазмиду разбавляют в 150 мМNaCl и смешивают с липофектантом RPR115335. Используют отношение положительные заряды липофектанта/отрицательные заряды ДНК, равное 6. Смесь взбалтывают, оставляют на десять минут при комнатной температуре, разбавляют средой без фетальной сыворотки теленка, а затем добавляют к клеткам в отношении 1 мкг ДНК на культуральную лунку. Через два часа при 37 С добавляют 10% об/об фетальной сыворотки теленка, и клетки инкубируют в течение 48 ч при 37 С в присутствии 5% of CO2. Клетки дважды промывают PBS, и измеряют активность люциферазы в соответствии с описанным протоколом (набор Promega, Promega Corp. Madison, WT) на люминометре Lumat LB9501 (EG and G Berthold, Evry). Плазмида pXL2727-1, очищенная, как в примере 8.2, обеспечивает вдвое большие выходы при трансфекции, чем получены с той же плазмидой с использованием набора Wizard Megaprep (PromegaCorp. Madison, WI). Пример 12. В приведенном ниже примере продемонстрирована очистка плазмид, происходящих от pCOR, с использованием аффинной хроматографии с образованием тройной спирали. Показано, что данная технология удаляет примеси нуклеиновых кислота (в частности геномной ДНК и РНК хозяина) до уровней,которые не были достигнуты при помощи общепринятых хроматографических способов. Гель триплексной аффинности синтезируют с Sephacryl S-1000 SF (Amersham-Pharmacia Biotech) в качестве хроматографической матрицы. Sephacryl S-1000 сначала активируют мета-периодатом натрия (3 мМ, комнатная температура, 1 ч) в 0,2 М ацетате натрия (рН 4,7). Затем олигонуклеотид связывают через его 5'-NH2-концевую группировку с альдегидными группами активированной матрицы путем восстановительного аминирования в присутствии аскорбиновой кислоты (5 мМ), как описано ранее для связывания белков (Hornsey et al., J. Immunol. Methods, 1986, 93, 83-88). Гомопиримидиновый олигонуклеотид,используемый для этих экспериментов (от Eurogentec, очищен ВЭЖХ) имел последовательность, которая комплементарна короткой 14-мерной гомопуриновой последовательности (5'-AAGAAGAA-3') (SEQID NO: 10), присутствующей в точке начала репликации (ori у) плазмиды pCOR (Soubrier et al., GeneTherapy, 1999, 6, 1482-1488). Как обсуждалось выше, последовательность гомопиримидинового нуклеотида представляет собой 5'-ТТСТТТТТТТТСТТ-3' (SEQ ID NO: 11). Следующие плазмиды подвергали хроматографии: pXL3296 (pCOR без трансгена, 2,0 тыс. п. о.),pXL3179 (pCOR-FGF, 2,4 тыс. п. о.), pXL3579 (pCOR-VEGFB, 2,5 тыс. п. о.), pXL3678 (pCOR-AFP, 3,7 тыс. п. о.), pXL3227 (pCOR-lacZ 5,4 тыс. п. о.) и pXL3397 (pCOR-Bdeleted FVIII, 6,6 тыс. п. о.). Все эти плазмиды очищают посредством двух стадий анионообменной хроматографии из клеточных лизатов,полученных, как описано в примере 4. Исследовали также плазмиду pBKS+ (pBluescript II KS + отCsCl. Все использованные плазмиды находятся в суперспирализованном (95%) топологическом состоянии или форме. В каждом эксперименте по очистке плазмидной ДНК, 300 мкг плазмидной ДНК в 6 мл 2 М NaCl,0,2 М ацетате калия (рН 5,0) загружают при скорости потока 30 см/ч на аффинную колонку, содержащую вышеупомянутый олигонуклеотид 5'-ТТСТТТТТТТТСТТ-3' (SEQ ID NO: 11). После промывания колонки 5 объемами того же буфера связанную плазмиду элюируют 1 М Трис/HCl, 0,5 мМ EDTA (рН 9,0) и количественно определяют с помощью УФ (260 нм) и ионообменной хроматографии на колонке Millipore Gen-Pak (Marquet et al., BioPharm, 1995, 8, 26-37). Выход плазмиды в собранной фракции составляет 207 мкг для pXL3296, 196 мкг для pXL3179, 192 мкг для pXL3579, 139 мкг для pXL3678, 97 мкг для pXL 3227 и 79 мкг для pXL3397. Никакого связывания плазмиды нельзя было обнаружить (3 мкг) при хроматографии pBKS на этой колонке. Это указывает на то, что олигонуклеотид 5'-ТТСТТТТТТТТСТТ-3' (SEQ ID NO: 11) образует стабильные триплексные структуры с комплементарной 14-мерной последовательностью 5'AAGAAGAA-3' (SEQ ID NO: 10), присутствующей pCOR (ori ), но не с близкородственной последовательностью 5'-AGAGGA-3' (SEQ ID NO: 8), присутствующей в pBKS. Это указывает на то, что введение единственной неканонической триады (в данном случае TGC) приводит к полной дестабилизации триплексной структуры. В качестве контроля, никакого связывания плазмиды (1 мкг) не наблюдалось при хроматографииpXL3179 на чистой колонке, синтезированной в строго аналогичных условиях, но без олигонуклеотида. Путем оперирования с данной колонкой для аффинной очистки в условиях, описанных здесь, уровень примеси геномной ДНК хозяина был снижен с 2,6 до 0,07% для препарата pXL3296. Аналогично уровень примеси геномной ДНК хозяина снижен с 0,5 до 0,008% для препарата pXL3179 при хроматографии этого образца через такую же аффинную колонку. Пример 13. В приведенном ниже примере продемонстрирована очистка плазмид, происходящих от ColEI, с использованием аффинной хроматографии с образованием тройной спирали. Показано, что посредством этой методики удаляются нуклеиново-кислотные примеси (в частности геномной ДНК и РНК хозяина)

МПК / Метки

МПК: C12Q 1/68, C12N 1/06, C12N 15/10

Метки: способ, днк, плазмидной, очистки

Код ссылки

<a href="http://easpatents.com/30-10576-sposob-ochistki-plazmidnojj-dnk.html" rel="bookmark" title="База патентов Евразийского Союза">Способ очистки плазмидной днк</a>

Похожие патенты