Рекомбинантная двухцепочная последовательность днк для экспрессии сахарозофосфорилазы в растении, способ получения трансгенного растения с повышенной экспрессией сахарозофосфорилазы в различных частяхрастения и линия трансформированных клеток растения

Есть еще 8 страниц.

Смотреть все страницы или скачать PDF файл.

Формула / Реферат

1. Рекомбинантная двухцепочечная последовательность ДНК для экспрессии сахарозофосфорилазы в растении, содержащая следующие конструктивные элементы:

- промотор, активный в определенных клетках растений;

- ген, кодирующий фермент сахарозофосфорилазу Streptococcus mutans, имеющий следующую последовательность нуклеотидов:

Рисунок 1

(SEQ ID NO:5); и

3` - нетранслируемую область, обеспечивающую терминацию транскрипции гена сахарозофосфорилазы и полиаденилирование мРНК сахарозофосфорилазы.

2. Рекомбинантная двухцепочечная последовательность ДНК по п.1, отличающаяся тем, что указанный промотор представляет собой промотор зеина или промотор пататина или промотор глутеина риса или 7S промотор субъединицы сои или промотор АДФ-глюкозопирофосфорилазы или промотор TFM7 или промотор TFM9 томатов.

3. Способ получения трансгенного растения с повышенной экспрессией сахарозофосфорилазы в различных частях растения, включающий введение в геном клеток недифференцированного каллуса рекомбинантной двухцепочечной последовательности ДНК по любому из пп.1 или 2 формулы и регенерацию из трансформированных клеток трансгенного растения, геном которого содержит указанную последовательность ДНК.

4. Способ по п.3, отличающийся тем, что повышенная экспрессия сахарозофосфорилазы приводит к увеличению содержания полисахарида, в частности крахмала, в клубнях, семенах или плодах трансгенного растения и более однородному распределению крахмала и твердых веществ в клубнях, семенах или плодах трансгенного растения.

5. Способ по п.4, отличающийся тем, что трансгенное растение представляет собой кукурузу, пшеницу, рис, томат, картофель, батат, арахис, ячмень, маниок и землянику.

6. Способ по п.4, отличающийся тем, что повышенная экспрессия сахарозофосфорилазы приводит к увеличению содержания крахмала в клубнях, семенах или плодах трансгенного растения.

7. Способ по п.6, отличающийся тем, что трансгенное растение представляет собой томат или картофель или батат.

8. Способ по п.3, отличающийся тем, что рекомбинантную двухцепочечную последовательность ДНК вводят в геном клеток кукурузы, пшеницы, риса, томата, картофеля, батата, арахиса, ячменя, маниока, сахарной свеклы, сахарного тростника, банана съедобного, банана кормового и земляники.

9. Способ по п.8, отличающийся тем, что указанные клетки представляют собой клетки картофеля.

10. Способ по п.8, отличающийся тем, что указанные клетки представляют собой клетки кукурузы.

11. Способ по п.8, отличающийся тем, что указанные клетки представляют собой клетки пшеницы, ячменя, риса или томата.

12. Линия трансформированных клеток растения, полученного в соответствии со способом по любому из пп.3-11 формулы, содержащих рекомбинантную двухцепочечную последовательность ДНК по любому из пп.1-2 формулы.

13. Линия по п.12, отличающаяся тем, что указанные клетки представляют собой клетки кукурузы, пшеницы, риса, томата, картофеля, батата, арахиса, ячменя, маниока, сахарной свеклы, сахарного тростника, банана съедобного, банана кормового и земляники.

 

Текст

Смотреть все

1 Значительные успехи, достигнутые в области генной инженерии за последнее время,позволили разработать методы трансформации растений путем введения в эти растения чужеродного гена. В настоящее время стало возможным продуцировать растения с уникальными свойствами, имеющими важное значение как с агрономической, так и с технологической точки зрения. Одним из таких важных свойств культурных растений является повышенное содержание крахмала и/или твердых веществ и их качество. Другим важным свойством является повышенное содержание масла и белка в семенах культурных растений. Сахароза является запасной формой углеводов, которая транспортируется из тканиисточника в большинстве растений в акцептирующие ткани. В акцептирующих тканях сахароза гидролизуется, и ее компоненты используются для построения других более сложных запасных соединений, главным образом, крахмала, белка и масла. Этот гидролиз осуществляется, в основном, сахарозосинтазой, которая продуцирует УДФ-глюкозу и фруктозу. УДФглюкоза превращается в глюкозо-1-фосфат под действием УДФ-глюкозопирофосфорилазы. Увеличение содержания крахмала в акцепторных тканях различных культурных растений осуществляют посредством использования гена,кодирующего бактериальную АДФ-глюкозопирофосфорилазу. См. заявку РСТ WO 91/19806(эквивалентную заявке США рег. 08/120703,Kishore, которая приведена в настоящем описании в качестве ссылки) . Этот фермент катализирует образование АДФ-глюкозы из глюкозо 1-фосфата. Было также обнаружено, что продуцирование АДФ-глюкозы во время определенных фаз развития семян может приводить к снижению содержания масла, что, очевидно,обусловлено шунтированием исходного материала на путь метаболизма крахмала с одновременным уменьшением его доступности для продуцирования масла. Повреждение картофеля является обычным явлением, имеющим место при крупномасштабном производстве, транспортировке и хранении. Это повреждение проявляется в виде темного пятна, появляющегося, главным образом, на коже клубней картофеля. Такие повреждения могут приводить к потере качества клубней, к снижению потребительского спроса на этот картофель и его продукты, и к потерям при переработке клубней, имеющих слишком высокую степень повреждения. При этом было установлено, что те сорта картофеля, которые имеют более высокое содержание крахмала, являются более чувствительными к повреждению. Поэтому, было бы желательно уменьшить уровень или вероятность возникновения повреждения клубней, а особенно предпочтительно, чтобы такое уменьшение можно было достигнуть од 000634 2 новременно с повышением содержания крахмала в клубнях картофеля. Кроме того, было бы желательно достигнуть более однородного распределения крахмала и твердых веществ в клубнях картофеля. В сердцевине или центральной части картофеля обычно содержится меньше твердых веществ,чем во внешней части или коже картофеля. Так,например, если клубень картофеля нарезать продольными длинными полосками как для приготовления картофеля-фри, то средние части этих полосок имеют более низкие уровни твердых веществ, чем их концы, особенно, когда эти полоски нарезаны по центру картофеля. Ломтики картофеля, имеющие более низкий уровень твердых веществ или содержащие области с более низким уровнем твердых веществ, требуют более длительного времени варки для достижения нужного уровня готовности. Более длительное время варки может привести к перевариванию более твердых ломтиков картофеля. Более продолжительное время жарки также приводит к повышенной абсорбции жира, и менее твердые ломтики и ломтики, содержащие менее твердые области, будут иметь повышенное содержание жира. Известно, что жареные продукты с повышенным содержанием жира обладают меньшей питательной ценностью. При изготовлении картофельных чипсов клубни картофеля нарезаются тонкими поперечными ломтиками, и неравномерное распределение твердых участков в таких ломтиках может приводить к получению жареного продукта, имеющего пережаренные края, недожаренную сердцевину и повышенное содержание жира (особенно в сердцевине). Неравномерное распределение твердых участков в клубне картофеля также приводит к непропорциональной потере твердых веществ (из крайних участков клубней) в процессе очистки картофеля от кожуры. Кроме того, желательно, чтобы томаты также имели высокое содержание твердых веществ. Повышенное содержание твердых веществ, присутствующих в растворимой форме(обычно в виде сахаров и кислот) и в нерастворимой форме, способствует более эффективной обработке томатов и повышению выхода соответствующих продуктов, таких как кетчуп, томатная паста, соусы и сальса. Эти твердые вещества также определяют вкус и консистенцию переработанного продукта. Более высокое содержание твердых веществ также способствует улучшению вкусовых качеств свежих томатов. Сахарозофосфорилаза является бактериальным ферментом, который катализирует образование глюкозо-1-фосфата непосредственно из сахарозы. Его активность обнаруживается в бактериях и грибках широкого круга, и этот фермент был выделен из различных бактерий и. грибков (Pimentel и др., 1992; Vandamme и др.,1987). Гены этого фермента были выделены изAgrobac-terium spp. (Fournier и др., 1994, и рабо 3 ты, цитированные в настоящей заявке), Streptococcus mutans (этот ген был обозначен gtfa)(Russell и др., Perry и др.) и из Leuconostoc mesenteroides (этот ген был обозначен spl) (Kitao и др., 1992). Гетерологическая экспрессия гена,выделенного из S. mutans, в E.coli, раскрывается в патенте США 4 888 170 (Curtiss, 1989), приведенном в настоящем описании в качестве ссылки. Трансформированный микроорганизм используется в качестве вакцины против S.mutans. Задачей настоящего изобретения является разработка улучшенного способа повышения содержания крахмала в различных растениях. Другой задачей настоящего изобретения является разработка способа снижения содержания сахарозы в семенах масличных культур, который позволяет уменьшить уровень нежелательных углеводов, таких как стахиоза и раффиноза,и повысить уровень углевода, необходимого для продуцирования масла и белка. Следующей задачей настоящего изобретения является получение новой ДНК-конструкции, которая может быть использована в вышеуказанных способах. Другой задачей настоящего изобретения является получение клубней картофеля, имеющих повышенное содержание крахмала и его более равномерное распределение в клубне. Следующей задачей настоящего изобретения является получение клубней картофеля с пониженной восприимчивостью к повреждению. Еще одной задачей настоящего изобретения является получение улучшенных сортов культурных растений, таких как кукуруза, рис, пшеница и ячмень. Краткое описание изобретения Настоящее изобретение относится к рекомбинантной двухцепочечной последовательности, которая кодирует фермент сахарозофосфорилазу (SP) и может быть использована для получения растений с повышенным содержанием крахмала. В другом своем аспекте настоящее изобретение относится к семенам, которые, благодаря экспрессии SP, имеют пониженное содержание сахарозы и других углеводов, и в результате этого, продуцируют повышенный уровень масла и белка. Исходя из вышеуказанного настоящее изобретение относится к способу модификации содержания углеводов в целевых тканях трансгенных растений, включающему следующие стадии:(а) введение в геном растительной клетки рекомбинантной двухцепочечной ДНКмолекулы, содержащей в указанном порядке следующие последовательности:(i) промотор, который функционирует в клетках ткани целевого растения;(ii) структурную ДНК-последовательность,на основе которой синтезируется РНКпоследовательность, кодирующая фермент сахарозофосфорилазу; 4 растения и которая обеспечивает терминацию транскрипции и присоединение полиаденилированных нуклеотидов к 3'-концу РНКпоследовательности;(b) получение трансформированных клеток растений; и(c) регенерацию из трансформированных растительных клеток генетически трансформированных растений. В другом своем аспекте настоящее изобретение относится к рекомбинантной двухцепочечной ДНК-молекуле, содержащей в указанном порядке следующие последовательности:(i) промотор, который функционирует в клетках ткани целевого растения;(ii) структурную ДНК-последовательность,на основе которой синтезируется РНКпоследовательность, кодирующая фермент сахарозофосфорилазу;(iii) 3'-нетранслируемую ДНК-последовательность, которая функционирует в клетках растения и которая обеспечивает терминацию транскрипции и присоединение полиаденилированных нуклеотидов к 3'-концу РНКпоследовательности. В соответствии с другим своим аспектом настоящее изобретение также относится к линии клеток растения, которые содержат ДНКмолекулу, состоящую из вышеуказанных последовательностей (i), (ii) и (iii). В соответствии с еще одним своим аспектом настоящее изобретение относится к способу получения трансгенных растений картофеля, томата и злаковых,имеющих повышенное содержание крахмала в клубнях, плодах и семенах, соответственно; и трансгенных масличных культур, семена которых имеют пониженный уровень сахарозы и олигосахаридов, содержащих сахарозу, например стахиозу и раффинозу. Кроме того, настоящее изобретение относится к способам повышения содержания крахмала в крахмалпродуцирующих органах растений, таких как клубни картофеля и семена злаковых культур; а также к способам снижения уровней сахарозы в масличных культурах, таких, как соя и канола, которое приводит к повышению содержания масла и белка в этих растениях. Неожиданно было обнаружено, что у картофеля, полученного вышеуказанными способами, имеется более равномерное распределение крахмала от сердцевины до краев клубней картофеля. В другом своем аспекте настоящее изобретение относится к получению картофеля,имеющего пониженную восприимчивость к повреждениям. Дополнительное преимущество сахарозофосфорилазной активности в акцепторной ткани, такой, как клубни картофеля, заключается в том, что она обеспечивает повышенную новую сахарозогидролизующую активность, имеющую гораздо более низкое значение константы Km для сахарозы (1-25 мМ), чем значения Km для 5 растительных ферментов, гидролизующих сахарозу, таких, как сахарозосинтаза и инвертаза,которые имеют Km в пределах 50 - 300 мМ. Это преимущество имеет важное значение для формирования и прочности указанных акцепторных тканей, и придания им прочности. Подробное описание изобретения Экспрессия растительного гена присутствующего в виде двухцепочечной ДНК предусматривает транскрипцию матричной РНК(мРНК), заключающуюся в синтезе этой мРНК на одной цепи ДНК с участием фермента РНКполимеразы с последующим процессингом первичного транскрипта мРНК внутри ядра. При этом указанный процессинг включает в себя присоединение 3'-нетранслируемой последовательности, которая добавляет полиадениловые нуклеотиды к 3'-концу РНК. Транскрипция ДНК в мРНК регулируется участком ДНК, обычно называемым промотором. Этот промоторный участок содержит последовательность оснований ДНК, к которой присоединяется РНК-полимераза, что служит сигналом инициации транскрипции, сопровождающейся синтезом мРНК на одной из цепей ДНК, служащей в качестве матрицы для образования соответствующей комплементарной цепи РНК. В литературе описан ряд промоторов, которые являются активными в клетках растений. Такими промоторами являются промоторы генов нопалинсинтазы (ONS) и октопинсинтазы(OCS) (которые содержатся в опухольиндуцирующих плазмидах Agrobacterium tumefaciens); промоторы колимовирусов, такие как промоторы вируса мозаики цветной капусты(CaMV) 19S и 35S и вируса мозаики норичника 35S; индуцируемый световым излучением промотор гена малой субъединицы рубилозо-1,5 бифосфаткарбоксилазы (ssRUBISCO, очень распространенного в растениях полипептида), и промотор гена, кодирующего белок, связывающийся с хлорофиллом а/b, и т.п. Все указанные промоторы были использованы для создания ДНК-конструкций различного типа, которые были экспрессированы в растениях; см., например, опубликованную заявку WO 84/02913(Rogers и др., Monsanto). В настоящем изобретении могут быть использованы промоторы, которые, как известно или как было установлено, инициируют транскрипцию ДНК в клетках растений. Такие промоторы могут быть получены из разных источников, таких, как растения и вирусы растений, и примерами подходящих промоторов могут служить промотор повышенной активности CaMV 35S и промоторы растительных генов, таких как ген ssRUBISCO. Как указывается ниже, предпочтительно, чтобы конкретно выбранный промотор обеспечивал достаточную экспрессию гена, приводящую к продуцированию эффективного количества фермента сахарозофосфо 000634 6 рилазы (SP), способствующего желаемому увеличению содержания крахмала. Кроме того,предпочтительно, чтобы экспрессия гена SP осуществлялась в конкретных тканях растения,таких как корни, клубни, семена, плоды и т.п., и,поэтому, необходимо выбирать такой промотор,который обладал бы специфичностью к конкретной нужной ткани и к конкретному периоду развития этой ткани. Кроме того, следует отметить, что количество сахарозофосфорилазы,необходимое для индуцирования увеличения содержания крахмала, может варьировать в зависимости от типа растения, однако, при этом,следует иметь в виду, что слишком высокая активность сахарозофосфорилазы может неблагоприятным образом воздействовать на растение. Поэтому, функция промотора должна быть оптимизирована путем отбора промотора, способного осуществлять экспрессию в нужной ткани,и обладающего соответствующей активностью,а также путем отбора трансформанта, продуцирующего нужную сахарозоосфорилазную активность в тканях-мишенях. Отбор нужного трансформанта из имеющегося пула трансформантов осуществляют традиционным способом,используемым при экспрессии гетерологических структурных генов в растениях, поскольку трансформанты, содержащие один и тот же ген,отличаются друг от друга сайтами инсерции гена в геноме растения. (Такое изменение обычно называют "эффектом положения"). Предпочтительно, чтобы промоторы, используемые в двухцепочечных ДНК-молекулах настоящего изобретения, обеспечивали высокий уровень экспрессии этих ДНК-молекул в тканях,в которых необходимо получить повышенное содержание крахмала и/или нужных сухих веществ, например, в таких тканях, как клубни картофеля, плоды томата, или семена кукурузы,пшеницы, риса и ячменя. Экспрессия двухцепочечных ДНК-молекул настоящего изобретения под контролем конститутивного промотора,экспрессирующего ДНК-молекулу во всех или в большинстве тканей растения, редко бывает предпочтительной, а в некоторых случаях она может оказаться неблагоприятной для роста растения. Было показано, что промотор гена пататина класса I является в высокой степени активным и клубнеспецифическим промотором(Bevan и др., 1986; Jefferson и др., 1990). В соответствии с настоящим изобретением для экспрессии в клубнях предпочтительно использовать последовательность, составляющую приблизительно 1,0 kb-часть клубнеспецефического промотора гена пататина класса I. Известны также и другие гены с клубнеспецифической или усиленной экспрессией, включая гены клубня картофеля ADPGPP, как большой, так и малой субъединиц (Muller и др., 1990), ген сахарозосинтазы (Salanoubat и Belliard, 1987, 1989),гены мажорных белков клубня картофеля, 7 включая, 22 кД-белковые комплексы и ингибиторы протеиназы (Hannapel, 1990), ген синтазы,связывающей крахмал в гранулы (GBSS) (Rohde и др., 1990); и гены других пататинов класса I иII (Rocha-Sosa и др., 1989; Mignery и др., 1988). Другими подходящими промоторами, которые могут быть использованы в целях настоящего изобретения, являются промоторы, обеспечивающие повышенную или специфическую экспрессию нужных генов в клубнях картофеля, то есть, промоторы, ассоциированные с экспрессией генов ферментов, ответственных за биосинтез или модификацию крахмала, либо промоторы, обнаруживающие различные профили экспрессии генов в клубнях картофеля. Примерами таких промоторов могут служить промоторы генов, кодирующих [связывающую в гранулы крахмал]-синтазу и другие крахмал-синтазы,ветвящие ферменты (Kossmann и др., 1991;(Stukerlj и др., 1990), ингибитор карбоксипептидазы, полифенолоксидазы клубней (Shahar и др.,1992; номера допуска генного банка данных(GenBank) М 95196 и М 95197), предполагаемый ингибитор трипсина; и другие кДНК клубней (Stiekema и др., 1988), а также гены амилазы и спорамина (из Ipomoea batatas; Yoshida и др., 1992; Ohta и др., 1991). Кроме того, промоторы клубнеспецифических генов могут быть идентифицированы путем скрининга к ДНК-библиотеки для генов картофеля, которые избирательно или преимущественно экспрессируются в клубнях, а затем определения промоторных участков в целях выявления клубнеспецифических промоторов или промоторов, усиливающих экспрессию генов в клубнях. Для экспрессии гена сахарозофосфорилазы в конкретных тканях, таких, как семена или плоды, могут быть также использованы и другие промоторы. -Конглицинин (известный также, как белок 7S) является одним из главных запасных белков, обнаруживаемых в сое (Glycine max) (Tierney, 1987). Промотор для конглицинина и другие семяспецифические промоторы, например, промоторы для напина и фазеолина, могут быть использованы для сверхэкспрессии гена SP в семенах. Такая сверхэкспрессия гена SP будет приводить к уменьшению содержания сахарозы в семенах, что, в свою очередь, будет приводить к снижению уровня нежелательных олигосахаридов, и потенциально к увеличению содержания масла и/или белка в семенах, которые традиционно используются для производства масла или белка, например, 000634 8 такие, как семена сои, канолы, масличного рапса, подсолнечника, сафлора и т.п. Ген SP продуцирует более сырой материал с большей быстротой, однако, собственные регуляторные механизмы растения, если на них не оказывают влияния другие ферменты, продуцируемые на основе гетерологичных генов, будут способствовать экспрессии этого гена в акцепторных тканях. Зеины представляют группу запасных белков, обнаруживаемых в эндосперме. Были выделены геномные клоны генов зеина (Pedersen,1982) и промоторы из этих клонов, включая промоторы генов 15 кД, 16 кД, 19 кД, 22 кД, 27 кД и гамма, могут быть также использованы для экспрессии гена SP в семенах кукурузы и других растений. Другими промоторами, которые,как известно, функционируют в растениях кукурузы, являются промоторами следующих генов: waxy, Brittle, Shrunken 2, ветвящих ферментов I и II, крахмал-синтаз, деветвящих ферментов, олеозинов, глютелинов и сахарозосинтаз. Особенно предпочтительным промотором для экспрессии гена SP в эндосперме кукурузы является промотор гена глютелина риса, а более предпочтительным является промотор Osgt-1(Zheng и др., 1993). Если вместо крахмала необходимо увеличить образование масла в семенах кукурузы, то следует выбрать такой промотор, который будет обеспечивать экспрессию гена SP в период отложения масла. Такой промотор будет активироваться во время формирования зародыша растения. Примерами промоторов, являющихся активными в период эмбриогенеза, могут служить промоторы генов глобулина I и активных белков (1 еа) позднего эмбриогенеза. Примерами промоторов, подходящих для экспрессии гена SP в растениях пшеницы, могут служить промоторы генов, кодирующих субъединицы АДФ-глюкозофосфорилазы (ADPGPP),[связывающую в гранулы крахмал]-синтазу или другие крахмал-синтазы; ветвящий и деветвящий ферменты; белки, продуцируемые в избытке при эмбриогенезе; глиадины; и глютенины. Примерами соответствующих промоторов для экспрессии в растениях риса являются промоторы генов, кодирующих субъединицы ADPGPP,[связывающую в гранулы крахмал]-синтазу и другие крахмал-синтазы, ветвящий фермент,деветвящий фермент, сахарозосинтазы и глютелины. Особенно предпочтительным является промотор гена глютелина риса, Osgt-1. Примерами соответствующих промоторов для экспрессии в растениях ячменя являются промоторы генов, кодирующих субъединицы ADPGPP,[связывающую в гранулы крахмал]-синтазу и другие крахмал-синтазы, ветвящие ферменты,деветвящие ферменты, сахарозосинтазы, гордеины, глобулины зародыша и алейронспецифические белки. 9 Содержание твердых веществ в плодах томатов может быть увеличено путем экспрессии гена SP под контролем плодоспецифического промотора. Промотор из геномного клона 2 А 11(Pear, 1989) контролирует экспрессию АДФглюкозофосфорилазы в плодах томата. Экспрессию гена SP в плодах томата также контролирует промотор Е 8 (Deikman, 1988). Кроме того, в заявке PCT/US 94/07072, поданной 27 июня 1994 (которая приведена в настоящем описании в качестве ссылки), описаны промоторы, которые функционируют на стадии образования зеленых плодов томатов. Эти промоторы были обозначены TFM7 и TFM9. TFM7 представляет собой ДНК-фрагмент, выделенный из растения томата, и составляющий примерно 2,3 kb, из которых 1,4 kb 3'-концевого участка имеют SEQID3. TFM9 представляет собой ДНКфрагмент, имеющий примерно 900 п.о., из которых 400 п.о. 3'-концевого участка имеют SEQ ID4. В настоящее время также известно, что промоторы из клубня картофеля функционируют в растениях томата и контролируют плодоспецифическую экспрессию встроенного гена.(См. заявку на патент США рег. 08/344639,Barry и др., поданную 4 ноября 1994 и приведенную в настоящем описании в качестве ссылки). Такими промоторами являются промоторы пататина картофеля, промоторы ADPGPP картофеля и промоторы [связывающей в гранулы крахмал]-синтазы. Особенно предпочтительным для экспрессии в плодах томата является промотор гена, кодирующего малую субъединицуADPGPP картофеля. Содержание твердых веществ в корневой ткани может быть увеличено путем экспрессии гена SP под контролем корнеспецифического промотора. Экспрессия гена SP в ткани корней может быть осуществлена под контролем гена кислой хитиназы (Samac и др., 1990). Экспрессия в корневой ткани может быть осуществлена посредством использования корнеспецефического промотора для субдоменов CaMV35S,которые были идентифицированы Benfey и др.(1989). РНК, полученная на основе ДНКконструкции в соответствии с настоящим изобретением, может также содержать 5'нетранслируемую лидерную последовательность. Эта последовательность может происходить из промотора, выбранного для экспрессии гена, и может быть специфически модифицирована таким образом, чтобы она способствовала усилению трансляции мРНК. 5'-Нетранслируемые области могут быть также получены из вирусных РНК, подходящих эукариотических генов, или из последовательности синтетического гена. Настоящее изобретение не ограничивается конструкциями, представленными в нижеследующих примерах, где нетранслируемой областью является 5'-нетранслируемая последовательность, прилежащая к промоторной после 000634 10 довательности. Предпочтительнее, если нетранслируемая лидерная последовательность будет происходить из неродственного промотора или от кодирующей последовательности,описанной выше. Сигнальные последовательности, обеспечивающие направленный транспорт Альтернативный метод увеличения скорости гидролиза сахарозы направлен на переносSP в апопласт. Для осуществления этого метода необходимо, чтобы на N'-конце функционального белка присутствовал сигнальный пептид. Предпочтительным примером последовательности, кодирующей такую сигнальную последовательность, является сигнальная последовательность эндоплазматического ретикулуума растения, происходящая из белка PR-1B (Ohshima и др., 1990). Так, например, благодаря такому переносу, SP будет активной в апопласте, в результате чего будет осуществляться внеклеточный гидролиз сахарозы и, тем самым, более быстрый транспорт глюкозы в клетки. Другой альтернативный метод предусматривает перенос SP в вакуолярное пространство. Направленная доставка SP в вакуоль растительной клетки требует, помимо сигнального пептида, дополнительной информации (Nakamura иMatsuoka, 1993). Поэтому, для переноса фермента в вакуоль препросигнальный пептид может быть присоединен к аминоконцу FT (Sonnewald и др., 1991). Альтернативно, для направленного транспорта фермента в вакуоль, вместе с сигнальной последовательностью ЕР может быть использована карбоксиконцевая удлиняющая последовательность. Сахарозофосфорилазы Используемый в настоящем описании термин "сахарозофосфорилаза" означает фермент,который катализирует обратимое превращение сахарозы и неорганического фосфата в -Dглюкозо-1-фосфат и D-фруктозу. Этот фермент может быть выделен из многих бактериальных источников, включая Streptococcus mutans,Clostridium pasteurianum (Vandamme и др.,1987), Pseudomonas seccharophila (Silverstein и др.), Pseudomonas putrifaciens, Pullularia pullulans, Acetobacter xylinum (Vandamme и др.,1987), Agrobacterium sp. (Fournier и др., 1994) иLeuconostoc mesenteroides. Ген, кодирующий фермент SP, может быть получен известными методами и уже был выделен из нескольких микроорганизмов, таких какS.mutans был экспрессирован в E.coli (Robeson и др., 1983, где активность фермента была идентифицирована как глюкозилтрансферазная активность). Выделение гена из Streptococcus mutans описано в примере, приведенном ниже. Последовательность этого гена представлена какSEQ ID5. Выделенный ген может быть встроен в вектор экспрессии в растениях, под 11 ходящий для осуществления способа трансформации, выбранного как описано ниже. Ген, кодирующий SP (ORF 488) был идентифицирован в Ti-плазмидах почвенной бактерии Agrobacterium vitus (ранее именуемой биотипом 3 A.tumefaciens). Сообщалось, что родственные последовательности были обнаружены вTi-плазмидах других штаммов A.tumefaciens, в частности, в плазмиде pTiC58 (Fournier и др.,1994). Очевидно, что ген, кодирующий SP, может быть обнаружен во всех таких плазмидах. Была показана возможность очистки фермента SP из других бактериальных и грибковых источников (как описано выше). Доступность указанных материалов облегчает последующее клонирование гена указанного фермента; причем, этот белок может быть использован в качестве иммуногена для получения антител, с помощью которых могут быть идентифицированы клоны в библиотеке экспрессируемых последовательностей, таких как gtll (Sambrook и др.); пептидные последовательности N-концевых участков указанных белков могут быть получены стандартным методом секвенирования белков; после осуществления четко определенного лимитированного протеолиза, могут быть также определены последовательности внутренних областей. Эти последовательности могут быть использованы для конструирования нуклеотидных зондов или праймеров, которые, в свою очередь, могут быть использованы для идентификации генов из банка клонов или для амплификации гена или фрагментов гена в РНК-,кДНК- или ДНК-препаратах, полученных из микроорганизма-источника. Детекция бактерий Е.coli, содержащей клоны сахарозофосфорилазы, может быть также осуществлена путем их культивирования на минимальной среде в присутствии сахарозы в качестве единственного углеродного источника (Ferretti и др., 1988). Другие микроорганизмы, использующиеSP для гидролиза сахарозы, могут быть обнаружены путем выявления микроорганизмов, способных к утилизации сахарозы в качестве единственного источника углерода (Russell и др.). Этот белок может быть выделен известными методами по ферментативной активности, обнаруживаемой в соответствующих фракциях. Затем, как уже описывалось выше, может быть выделен ген, кодирующий указанный белок. Таким образом, может быть выделено много разных генов, которые кодируют белок, обладающий сахарозофосфорилазной активностью и которые могут быть использованы в настоящем изобретении. Сигнал полиаденилирования 3'-нетранслируемая область химерного растительного гена содержит сигнал полиаденилирования, который функционирует в растениях и вызывает добавление полиадениловых нуклеотидов к 3'-концу РНК. Примерами подходящих 3'-областей являются 12 транскрибируемые нетранслируемые области,содержащие сигнал полиаденилирования для генов Ti-плазмиды (опухоль-индуцирующей плазмиды) Agrobacterium, например, гена нопалинсинтазы, и (2) растительные гены, такие как ген запасного белка сои и ген малой субъединицы рибулозо-1,5-бифосфаткар-боксилазы(ssRUBISCO). Примером предпочтительной 3'области является 3'-область гена ssRUBISCO гороха, известная также, как 3'-область Е 9. Конструирование синтетического гена Ген SP, происходящий из Streptococcusmutans, имеет высокое содержание А+Т, которое может неблагоприятным образом сказаться на высоком уровне экспрессии в растительных клетках, хотя, как показано ниже, этот ген экспрессируется на уровне, достаточном для положительного воздействия на содержание крахмала. Если необходимо, последовательность генаSP может быть изменена без изменения последовательности белка так, чтобы экспрессия белка увеличивалась и, тем самым, способствовала увеличению содержания крахмала в трансформированных растениях. Способ такого изменения генной последовательности описан в WO 90/10076 (Fischhoff и др.). Ген, синтезированный этим способом, может быть введен в растения в соответствии с методикой, описанной ниже, в результате чего, уровень экспрессии ферментаSP будет повышаться. Эта методика может быть особенно успешно использована в отношении однодольных растений, таких как кукуруза, рис,пшеница и ячмень. Комбинация с другими трансгенами Действие SP в трансгенных растениях может быть усилено путем объединения с другими генами, которые положительно влияют на содержание крахмала и/или масла. Так, например,ген, способствующий увеличению АДФглюкозофосфорилазной (ADPGPP) активности в растениях, может быть использован в комбинации с геном SP для увеличения содержания крахмала. Такими ADPGPP-генами являются генglgC E.coli и его мутант glgC16. В WO 91/19806 раскрывается способ введения этого гена во многие виды растений в целях увеличения продуцирования в этих растениях крахмала и/или твердых веществ. Другим геном, который может быть объединен с геном SP для увеличения содержания крахмала, является ген сахарозофосфатсинтазы(SPS), который может быть выделен из растений. Один из таких генов, а также его использование в трансгенных растениях раскрываются вWO 92/16631. Другим геном, который может быть объединен с геном SP для увеличения содержания масла, является ген ацетил-СоА-карбоксилазы,который может быть выделен из растений. Один из таких генов описан в WO 93/11243. 13 Трансформация/регенерация растений В соответствии с настоящим изобретением могут быть получены растения, которые имеют повышенное содержание полисахарида (например, крахмала), и примерами которых являются,но не ограничиваются указанными, кукуруза,пшеница, рис, томат, картофель, сладкий картофель (батат), арахис, ячмень, хлопчатник, земляника, малина и тапиока. Растениями, которые могут быть получены методами настоящего изобретения и которые имеют модифицированное содержание углеводов, являются, но не ограничиваются указанными, кукуруза, пшеница,рис, томат, батат, арахис, ячмень, сахарная свекла, сахарный тростник, яблоня, груша,апельсин, виноград, хлопчатник, земляника,малина и тапиока. Растениями, которые могут быть получены методами настоящего изобретения и которые имеют пониженный уровень обесцвечивания, вызванного повреждениями,являются, но не ограничиваются указанными,пшеница, картофель, батат, ячмень, сахарная свекла, сахарный тростник, яблоня, груша, персик, апельсин, виноград, банан, банан овощной и тапиока. Растениями, которые могут быть получены методами настоящего изобретения и которые имеют однородное распределение сухих веществ, являются, но не ограничиваются указанными, картофель, батат, банан, овощной банан и тапиока. Растениями, которые могут быть получены методами настоящего изобретения и которые дают повышенный урожай, являются, но не ограничиваются указанными, кукуруза, пшеница, рис, томаты, картофель, батат,арахис, ячмень, сахарная свекла, сахарный тростник, яблоня, груша, апельсин, персик, банан,овощной банан, виноград, хлопчатник, земляника, малина и тапиока. Растениями, которые могут быть получены таким образом, что они будут иметь пониженный уровень сахарозы и,благодаря этому, повышенное содержание масла или белка, являются соя, кукуруза, канола и подсолнечник. Двухцепочечная ДНК-молекула, заявленная в соответствии с настоящим изобретением,содержащая ген SP, может быть встроена в геном растения любым подходящим способом. Подходящими векторами для трансформации растений являются векторы, сконструированные на основе Тi-плазмиды Agrobacterium tumefaciens, а также векторы, описанные в работах,например, Herrera-Estrella (1983), Bevan (1984),Klee (1985) и в опубликованной заявке ЕР 120 516(Shilperoorte и др.). Помимо растениетрансформирующих векторов, происходящих изTi-плазмиды или Ri-плазмиды (плазмида, индуцирующая избыточное разрастание корней) Agrobacterium, для встраивания ДНК-конструкции настоящего изобретения в растительные клетки могут быть использованы альтернативные методы. Такими методами могут быть, например,использование липосом; электропорация; ис 000634 14 пользование химических соединений, способствующих усилению поглощения свободной ДНК; доставка свободной ДНК посредством микробомбардировки и трансформация с использованием вируса или пыльцы. Плазмидный вектор экспрессии, подходящий для введения гена SP в однодольные растения путем микробомбардировки, состоит из следующих элементов: промотора, являющегося специфическим, или усиливающего экспрессию этого гена в крахмалзапасающих тканях однодольных растений, в основном, в эндосперме,например, такого промотора, как промотор генов зеина, обнаруживаемых в эндосперме кукурузы (Pederson и др., 1982); интрона, обеспечивающего наличие сайта сплайсинга для облегчения экспрессии гена, например, такого как интрон Нsp70 (опубликованная заявка WО 93/19189); и 3'-последовательности полиаденилирования, такой как 3'-последовательность нопалинсинтазы (NOS-3; Fraley и др., 1983). Этот экспрессирующий кластер может быть собран на многокопийных репликонах, подходящих для продуцирования больших количеств ДНК. Для трансформации двудольных растений,особенно подходящим растениетрансформирующим вектором, происходящим из Agrobacterium, является плазмидный вектор pMON530(Rogers, S. G., 1987). Плазмида pMON530 является производной от плазмиды pMON505, полученной путем переноса StuI-HindIII-фрагмента(2,3 kb) плазмиды pMON316 (Rogers, S.G., 1987) в плазмиду pMON526. Плазмида pMON526 является, в свою очередь, простой производной от плазмиды pMON505, в которой Smal-сайт был удален путем гидролиза ферментом Xmal, обработки полимеразой Кленова и лигирования. Плазмида pMON530 сохраняет все свойства плазмидыCaMV35S-NOSэкспpeccирующего кластера и, кроме того, содержит уникальный рестрикционный сайт для фермента Smal, расположенный между промотором и сигналом полиаденилирования. Бинарный вектор pMON505 был получен из pMON200 (Rogers, S.G., 1987), где Tiплазмидная область гомологии, LIH, была заменена HindIII-Smal-сегментом (3,8 kb) миниплазмиды РК 2, pTJS75 (SchmidhauserHelinski, 1985). Этот сегмент содержит сайт инициации репликации РК 2, oriV и сайт инициации переноса, oriT, для конъюгирования в Agrobacterium с использованием процедуры тройного скрещивания (HorschKlee, 1986). ПлазмидаpMON505 сохраняет все важные элементы плазмиды pMON200, включая синтетический мультилинкер для инсерции нужных ДНКфрагментов; химерный NOS/NRTII/NOS-ген устойчивости к канамицину в растительных клетках; генетический маркер устойчивости к спектиномицину/стрептомицину для отбора в Е.coli и A.tumefaciens; интактный ген нопалинсинтазы для облегчения подсчета трансформан 15 тов и оценки наследования признаков у потомства и сайт инициации репликации от рВР 322 для облегчения получения больших количеств этого вектора в Е. coli. Плазмида pMON505 содержит один край Т-ДНК-фрагмента, происходящий из правого конца Т-ДНК плазмиды нопалинового типа pTiT37. Саузерн-анализ показал,что плазмида pMON505 и любая ДНК, которую она содержит, являются интегрированными в геном растения, то есть, цельная плазмида представляет собой Т-ДНК, встроенную в геном растения. Один конец интегрированной ДНК расположен между правой крайней последовательностью и геном нопалинсинтазы, а другой ее конец расположен между крайней последовательностью и последовательностями pBR322. Другим подходящим Ti-плазмидным кластерным вектором является pMON17227. Этот вектор описан Barry и др. в заявке WO 92/04449(которая соответствует заявке на патент США сper.07/749611 и которая приведена в настоящем описании в качестве ссылки) и содержит ген, который кодирует фермент, обладающий устойчивостью к глифосату (обозначаемый СР 4), и который является прекрасным селективным маркерным геном для многих растений,включая томаты и картофель. Этот ген соединен с пептидом, ответственным за транспорт EPSPS в хлоропласты Arabidopsis (CTP2), и экспрессируется с промотора FMV, описанного в настоящей заявке. При получении адекватного числа клеток(или протопластов), содержащих ген SP или кДНК, из этих клеток можно регенерировать целые растения. Выбор конкретной методики для осуществления регенерации не имеет решающего значения при условии, что будет использована схема регенерации, подходящая для следующих конкретных хозяев семейства бобовых (люцерна, соя, клевер и т.п.), семейства зонтичных (морковь, сельдерей, пастернак), семейства крестоцветных (капуста, редька, канола/масличный рапс и т.п.), семейства тыквенных(дыня и огурец), семейства злаковых (пшеница,ячмень, рис, кукуруза и т.п.), семейства пасленовых (картофель, табак, томаты, перец), различных цветковых культурных растений, таких как подсолнечник, и орехоплодных деревьев,таких как миндаль, анакардия западная (кешью),орех и кария пекан. См., например, Ammirato,1984; Shimamoto, 1989; Fromm, 1990; Vasil,1990; Vasil, 1992; Hayashimoto, 1989; Shimamoto,1989; и Datta, 1990. Для более наглядной иллюстрации осуществления настоящего изобретения приводятся нижеследующие примеры, которые, однако, не должны рассматриваться как ограничивающие объем изобретения. Специалистам в данной области следует иметь в виду, что в методы и гены, описанные в настоящей заявке, могут быть внесены различные модификации и изменения,не выходящие за пределы данного изобретения. 16 Пример 1. Все основные манипуляции с ДНК, такие как полимеразная цепная реакция (PCR), электрофорез в агарозном геле, рестрикционный гидролиз, лигирование и трансформация E.coli,были осуществлены в соответствии со стандартными методиками описанными Сэмбруком и др. (Sambrook et al.). Ген сахарозофосфорилазы, gtfA, генерировали из клеток Streptococcus mutant путем PCRамплификации. Этот ген был амплифицирован с использованием 5'-олигонуклеотида: 5'CCCGGATCCATGGCAATTACAAATAAAACTCATTTTCTG (SEQ ID NO 2). При этом, использовали следующие условия PCR-циклов: 94 С, 3 мин; 55 С, 2 мин; 72 С, 2 мин (5 циклов); 94C 1 мин; 55 С, 2 мин; 72 С, 2 мин (30 циклов). Полученный PCRпродукт размером 1462 п.о. очищали с использованием системы для очистки GeneCleanSacI-сайты pUC-119. Лигированную ДНК трансформировали в JM101 и скринировали на бело-голубые колонии для идентификации колоний плазмиду с определенной рестрикционной картой. Гидролиз ферментом HindIII использовали для скрининга трансформантов, содержащих ген gtfA. Клоны с правильными рестрикционными картами скринировали на фенотипическую экспрессию по их способности к утилизации сахарозы в качестве единственного источника углерода следующим образом: клоны трансформировали в gal-штамм Е.coli, SK1592,культивировали на минимальной среде, содержащей раффинозу (которую растворяли и гидролизовали с образованием галактозы и сахарозы) и активный клон идентифицировали и обозначали pMONl7353. Экспрессирующий кластер конструировали в целях осуществления конститутивной экспрессии гена gtfA в растениях. Фрагмент, содержащий усиленный промотор 35S (Кау R.,1987), 3'-область нопалинсинтазы (Bevan, M.,1984) и остов вектора pUC, получали изpMON999 (Rogers и др., 1987 а) путем рестрикционного гидролиза ферментами BglII и SacI. Фрагмент, содержащий кодирующую областьgtfA, получали из плазмиды pMON17353 посредством рестрикционного гидролиза ферментами BamHI и SacI. Соответствующие фрагменты выделяли с помощью электрофореза в агарозном геле и очищали с использованием системы GeneClean. Полученные фрагменты лигировали, трансформировали в JM101 Е.coli, и предполагаемые рекомбинантные плазмиды скринировали посредством рестрикционного гидролиза ферментом NotI. Один клон идентифицировали и обозначали PMON17359. 17 Затем конструировали второй экспрессирующий кластер в целях осуществления экспрессии гена gtfA в клубнях картофеля. Фрагмент, содержащий промотор пататина 1.0 (описанный выше), 3'-область нопалинсинтазы и остов вектора pUC, получали из промежуточного вектора путем рестрикционного гидролиза ферментами BamHI и Sad. Кроме того, конструировали экспрессирующий кластер для осуществления экспрессии гена gtfA в плодах томата. Фрагмент, содержащий промотор TFM7,3'-область нопалинсинтазы и остов вектораpUC, получали из плазмиды pMON16987(заявка PCT/US 94/07072, поданная 27 июля 1994), которая происходит из плазмидыpMON999, но не содержит промотора TFM7,посредством рестрикционного гидролиза ферментами BglII и SacI. Соответствующие фрагменты выделяли путем электрофореза в агарозном геле и очищали методом с использованиемGeneClean. Каждый из этих фрагментов лигировали с BamHI- и SaсI-фрагментом изpMONl7353. Трансформацию и скрининг клонов осуществляли, как описано выше. Полученные нужные клоны обозначали pMONl7356(TFM7/gtfA/NOS). Для осуществления экспрессии гена gtfA в клубнях картофеля конструировали третий экспрессирующий кластер с использованием 3,5kb-промотора пататина. 3,5 kb-промотор пататина получали из плазмиды pB1240.7 (Bevan и др., 1986). Большую часть 3,5 kb-промотора вырезали из pBl240.7, от HindIII-сайта (в положении 3500) дoXbaI-caйтa X в положении -337, и объединяли с оставшейся частью промотора, от(ранее DraI-сайт) с тройным лигированием в вектор, с введением BglII-сайта, в результате чего получали плазмиду pMONl7280. Промежуточный вектор получали путем гидролизаpMONl7353 ферментами BamHI/SaCI с последующей инсерцией фрагмента в pBS. Затем этот вектор гидролизовали ферментами EcoRI и SacI.pMON17280 гидролизовали ферментами EcoRI и SacI, в результате чего получали фрагмент,содержащий 3,5 kb-промотор пататина, 3'область нопалинсинтазы и остов вектора pUC. Фрагменты нужного размера выделяли путем электрофореза в агарозном геле и методомGeneClean. Полученные фрагменты лигировали,трансформировали в E.coli JM101, и скринировали путем рестрикционного гидролиза ферментом HindIII. Один правильно сконструированный клон обозначали PMON17495. В pMON17356, pMON17359, pMON17389 и pMON17495/промотор, ген gtfA и областьNOS 3' могут быть выделены в составе NotIрестрикционного фрагмента. Эти фрагменты могут быть затем встроены в уникальный NotIсайт либо вектора pMONl7227 (описанного выше), либо вектора pMON17320 в целях получе 000634 18 ния векторов для трансформации глифосатселектируемых растений. Плазмида pMON17320 является производной от pMON17227, которая также содержит пататин 1.0/СТР 1-glgС 16 кластер. Гибрид CTPl-glgC16 кодирует модифицированную АДФ-глюкозофосфорилазу, описанную Kishore в заявке WO 91/19806. Для экспрессии GtfA в томатах был также сконструирован вектор посредством объединения гена gtfA и 3'-области pMON17356 с 2,0 kb-промотором гена малой субъединицы АДФ-глюкозофосфорилазы картофеля (см. заявку на патент СШАper. 08/344639, Barry и др., поданную 4 ноября 1994 и приведенную в настоящем описании в качестве ссылки) в растениетрансформирующем векторе, в результате чего был получен векторpMON17486. Векторную ДНК получали путем гидролиза ферментом NotI с последующей обработкой из кишечника теленка (CIAP). gtfA-содержащие фрагменты получали путем гидролиза ферментом NotI с последующим электрофорезом в агарозном геле и очисткой с использованиемGeneClean. Вектор и ДНК-вставку лигировали,трансформировали в штамм LE392 Е.coli, и трансформанты скринировали путем рестрикционного гидролиза для идентификации клонов,содержащих gtfA-экспрессирующие кластеры. Клоны, в которых транскрипция с gtfA-кластера происходит в том же направлении, что и транскрипция селектируемого маркера, считались правильно сконструированными и были обозначены pMON17357 (FMV/CP4/E9, Pat1.0/gtfA/(FMV/CP4/E9,Pat3.5/gtfA/NOS). Был сконструирован трансформирующий вектор для осуществления экспрессии гена gtfA в семенах кукурузы. Фрагмент, содержащий промотор глютелина Osgt-1, интрон Hsp70 (описанный выше), 3'-область нопалинсинтазы, ген резистентности к канамицину и остов вектораpUC, получали путем рестрикционного гидролиза, электрофореза в агарозном геле и очистки с использованием GeneClean. Фрагмент, содержащий gtfA-кодирующую область, получали из плазмиды pMON17359 путем рестрикционного гидролиза ферментами Ncol и NotI. Эти фрагменты лигировали, трансформировали и скринировали путем рестрикционного гидролиза. Нужный клон идентифицировали и обозначалиPMON24502 (Osgt1/Hsp70/gtfA/NOS). Был также сконструирован трансформирующий вектор для экспрессии гена gtfA в семенах масличных культур. Для этого, BamHIEcoRI-фрагмент из pMON17353 лигировали вBglII-EcoRI-сайты промежуточного вектора, в результате чего получали pMON26104, в кото 19 ром ген gtfA помещали за промотором 7S (описанным выше) и в котором использовали последовательность 3'-терминатора Е 9.NotIфрагмент, содержащий промотор FMV, гибридный ген СТР 2, ген резистентности к глифосату,и последовательность NOS 3', лигировали вNotI-сайт вектора pMON26104, в результате чего получали вектор pMON26106, который представляет собой двухграничный (doubleWO 94/28149 для глифосат-селекции трансформированных линий. В результате был получен ряд клеточных линий, которые были проанализированы в полевых условиях. Данные этого анализа представлены ниже в таблице 1. Как видно из таблицы, было идентифицировано несколько линий, имеющих повышенное содержание крахмала (измеренное как общее содержание сухих веществ), а некоторые из них имели более низкий уровень повреждения. 20 2. Как видно из таблицы, у десяти из двенадцати линий наблюдалась пониженная разность между содержаниями сухих веществ в сердцевине и по краям клубней картофеля. Таблица 2 Линия Разность в содержании сухих веществ (%) Контроль 4,61 3 4,53 4 4,16 6 3,57 8 3,20 11 3,94 12 4,39 14 4,67 15 3,56 17 2,61 18 3,79 19 5,19 22 3,92 Таблица 1 Содержание сухих Индекс повреждевеществ (%) ния Среднее значение Среднее значение 21,9 3,399 22,9 3,798 22,2 3,479 23,3 2,899 21,8 2,798 22,7 2,979 21,6 2,968 22,0 3,383 22,3 3,218 22,7 2,979 22,3 3,394 21,7 3,394 22,4 3,213 22,7 3,503 Пять из этих линий были проанализированы в эксперименте, проведенном на следующий год в полевых условиях, причем, 4 из них были испытаны на нескольких фермах. (Линия 8 была протестирована только на одной ферме). Для всех пяти линий наблюдалось абсолютное увеличение количества сухих веществ, что свидетельствовало об увеличении содержания крахмала в каждой из испытуемых линий. Результаты эксперимента представлены в таблице 3. Таблица 3 Линия Увеличение содержания сухих веществ 1 0,256 4 0,856 8 2,61 15 0,211 22 0,162 Клубни от двенадцати линий были протестированы на любое изменение распределения крахмала от сердцевины клубня до кожуры. Для этого, с клубней снимали кожуру, а затем эти клубни разрезали на полоски аналогично тому,как нарезают картофель для приготовления картофеля-фри, и определяли содержание сухих веществ в сравнительном тесте посредством флотации с помощью солевого раствора. Затем,среднее значение содержания сухих веществ для полосок из середины клубня вычитали из среднего значения содержания сухих веществ для полосок из поверхностного участка клубня. Полученная таким образом разность содержания сухих веществ, величина которой была меньше,чем контрольная величина (в данном тесте 4,61%), свидетельствовала о более однородном распределении крахмала в полученных клубнях,что является в высшей степени желательным фактом. Результаты теста приводятся в таблице Пример 3. Экспрессия гена gtfA в растениях кукурузы приводит к генерации новой каталитической активности, которая может облегчать импорт сахарозы в эндосперм посредством создания более резкого градиента концентрации и сохранения энергии, поскольку для превращения сахарозы в гексозу + гексозофосфат обычно требуется один моль АТФ. Вектор pMON24502 вводили в клетки кукурузы методом бомбардировки клеточной стенки с использованием для трансформации ткани эмбриогенного каллюса двух различных типов. Котрансформацию осуществляли с использованием либо (1) вектора Идентифицированная линия Контроль 1 3 4 6 8 11 12 14 15 17 18 19 22 21 кластера для отбора на резистентность к глифосату, каждый из которых включает промотор актина риса и интрон Hsp70, но при этом, один из них имеет ген, кодирующий глифосатоксидазу, а другой имеет ген резистентности к глифосату СР 4.(1) Незрелые эмбрионы кукурузы (генотип Н 99) выделяли как описано в заявке ЕР 586 355 А 2. Эмбриогенный каллюс получали путем культивирования незрелых эмбрионов примерно в течение двух недель на среде, описаннойDuncan и др. (1985) и обозначаемой Средой D. Через 2 недели получали каллюс (Тип I) и этот каллюс поддерживали путем субкультивирования каждые 2-3 недели на свежей Среде D. Приблизительно за 4 ч до бомбардировки, активно растущий каллюс (средний цикл субкультивирования) помещали на Среду D, в которую добавляли маннит и сорбит для предварительной осмотической обработки. Примерно через 16 24 ч после бомбардировки частицами, нагруженными векторамиpMON19476, ткань помещали на Среду D, не содержащую маннита и сорбита. Примерно через два дня ткань переносили на Среду D, содержащую паромомицин. Резистентную ткань переносили на свежую Среду D с паромомицином приблизительно с интервалом в три недели. Регенерацию растений осуществляли на СредеD, содержащей 6-бензиламинопурин (и не содержащей пестицида дикамбы), в течение 3 - 6 дневного "импульса", а затем на среде MS, не содержащей гормонов.(2) Каллюс Типа II, полученный из незрелых зародышей генотипа "Hi-II", использовали в соответствии с методикой Dennehy и др. (1994). За 4 ч до бомбардировки векторами pMON24502 и pMON19336, каллюс Типа II предварительно обрабатывали на среде N6 1-100-25, содержащей 0,4 М маннита + сорбита (0,2 М каждого), а затем оставляли на этой же самой среде в течение 16 - 24 ч после обработки. После этого ткань переносили на среду N6 1-100-25, не содержащую маннита или сорбит. Селекцию осуществляли с использованием 1-3 мМ глифосата в среде N6 1-0-25 (не содержащей казаминокислот). Каждым из описанных методов были получены фертильные растения кукурузы, и семена этих растений были проанализированы. Экспрессия гена gtfA была подтверждена Вестернблот-анализом, проведенным с использованием козьего антитела против Е.coli-экспрессированного gtfA. Было установлено, что из 16 линий, скринированных на экспрессию, 9 линий обнаруживали экспрессию gtfA приблизительно на уровне 0,05 - 0,5% от общего клеточного белка. Уровень биосинтеза крахмала в ткани эндосперма кукурузы, экспрессирующей GtfA(сахарозофосфорилазу), измеряли in vitro посредством анализа с использованием сахарной подпитки, который был описан в литературе(Felker и др., 1990). Выращенные в полевых условиях растения скринировали с помощью полимеразной цепной реакции (PCR) для идентификации позитивных и негативных сегрегантов. Позитивный и контрольный початки от двухGtfA-трансформированных линий (Knowl и De) собирали через 20 - 22 дня после опыления, во время линейной фазы налива зерна. Фрагменты эндосперма выделяли и выдерживали в присутствии 14 С-сахарозы в концентрациях 50 и 200 мМ. Концентрация 200 мМ лучше всего соответствует физиологическим условиям, но вследствие того, что Km GtfA для сахарозы имеет более низкое значение, чем для эндогенных ферментов, то для получения более надежных результатов измерения была использована более низкая концентрация (50 мМ). Через 1 и 2 ч после выдерживания с 14 С измеряли радиоактивность, включенную во фракцию крахмала. Результаты, полученные для двух линий, были систематизированы в нижеследующей таблице(данные представлены в виде среднего значения счета радиоактивности, включенной во фракцию крахмала). Таблица 4 А. Подпитка 50 мМ сахарозой Время взятия КонтрольDe 1 час 10909 10860 2 часа 19193 24284 Таблица 4 В: Подпитка 200 мМ сахарозой Время взятия КонтрольDe образца 1 час 7703 7471 2 часа 11038 13007 Полученные результаты показали, что ткани эндосперма кукурузы, экспрессирующиеGtfA, могут продуцировать крахмал с большей скоростью (в два раза), чем контрольные ткани. При этом, разница в скорости продуцирования крахмала более заметна при более низких концентрациях субстрата, что, вероятно, обусловлено различием в субстратной кинетике междуGtfA и эндогенной сахарозосинтазой. Наблюдаются также различия при сравнении линий De и Knowl, при этом, более положительный эффект отмечался в случае линии Knowl. В линииKnowl наблюдался очень высокий уровень экспрессии GtfA в пределах от 0,5% от общего содержания белка, тогда как в линии De экспрес 23 сия GtfA составляла в пределах 0,05%. Очевидно, что различия в уровнях биосинтеза крахмала являются функцией уровней экспрессии GtfA. Пример 4. Вектор pMON26106 был введен в клетки каллюса канолы и сои путем трансформации с использованием Agrobacterium (Hinchee и др.). После селекции трансформированных клеток с использованием глифосата и регенерации этих клеток в цельные растения, семена, полученные от этих растений, были проанализированы. Пример 5. Вектор pMON24502 был введен в клетки пшеницы путем бомбардировки клеточной стенки. Незрелые эмбрионы пшеницы выделяли как описано Vasil и др. (1993). Эмбриогенный каллюс получали путем культивирования незрелых эмбрионов в течение 4-7 дней на модифицированной среде MS, содержащей около 40 г/л мальтозы и около 2 мг/л 2,4-D. Клетки каллюса подвергали бомбардировке микрочастицами,покрытыми pMON24502 и плазмидой, содержащей ген резистентности к биалофосу. Через 1 день после бомбардировки, незрелые эмбрионы переносили в среду роста, содержащую селективный агент биалафос. После 7-дневного культивирования на питательной и селективной среде, незрелый эмбриональный каллюс переносили в продуцирующую побеги среду (модифицированную среду MS, не содержащую 2,4-D),содержащую биалофос, и культивировали в течение 28-40 дней. Присутствие гена gtfA в побегах подтверждали с помощью PCR-анализа. Побеги, содержащие ген gtfA, образовывали корни и укоренялись в почве. Когда трансформированные растения достигали зрелости, их семена содержали повышенные уровни крахмала. Пример 6. Вектор pMON24502 может быть введен в клетки риса путем бомбардировки микрочастицами. После регенерации и селекции, трансформированные растения анализировали на экспрессию гена gtfA, и растения, обнаруживающие высокий уровень экспрессии гена,культивировали до состояния зрелости. Семена зрелых растений обнаруживали повышенные уровни крахмала. Все публикации и патенты, упомянутые в настоящем описании, приведены здесь в качестве ссылок. Следует отметить, что в некоторых случаях могут оказаться полезными те или иные модификации или варианты настоящего изобретения, которые могут быть использованы без отсылок на другие особенности и варианты. Однако следует иметь в виду, что эти варианты не должны выходить за рамки объема изобретения, определенного в нижеследующей формуле изобретения. Поскольку возможны различные варианты осуществления настоящего изобретения, не выходящие за рамки его объема, то представлен 000634 24 ные в настоящем описании примеры носят иллюстративный, а не ограничивающий характер. ЛИТЕРАТУРА ФОРМУЛА ИЗОБРЕТЕНИЯ 1. Рекомбинантная двухцепочечная последовательность ДНК для экспрессии сахарозофосфорилазы в растении, содержащая следующие конструктивные элементы:- ген, кодирующий фермент сахарозофосфорилазу Streptococcus mutans, имеющий следующую последовательность нуклеотидов:(SEQ ID NO:5); и 3 - нетранслируемую область, обеспечивающую терминацию транскрипции гена сахарозофосфорилазы и полиаденилирование мРНК сахарозофосфорилазы. 2. Рекомбинантная двухцепочечная последовательность ДНК по п.1, отличающаяся тем,что указанный промотор представляет собой промотор зеина или промотор пататина или промотор глутеина риса или 7S промотор субъединицы сои или промотор АДФ-глюкозопирофосфорилазы или промотор TFM7 или промотор TFM9 томатов. 3. Способ получения трансгенного растения с повышенной экспрессией сахарозофосфорилазы в различных частях растения, включающий введение в геном клеток недифференциро 30 ванного каллуса рекомбинантной двухцепочечной последовательности ДНК по любому из пп.1 или 2 формулы и регенерацию из трансформированных клеток трансгенного растения,геном которого содержит указанную последовательность ДНК. 4. Способ по п.3, отличающийся тем, что повышенная экспрессия сахарозофосфорилазы приводит к увеличению содержания полисахарида, в частности крахмала, в клубнях, семенах или плодах трансгенного растения и более однородному распределению крахмала и твердых веществ в клубнях, семенах или плодах трансгенного растения. 5. Способ по п.4, отличающийся тем, что трансгенное растение представляет собой кукурузу, пшеницу, рис, томат, картофель, батат,арахис, ячмень, маниок и землянику. 6. Способ по п.4, отличающийся тем, что повышенная экспрессия сахарозофосфорилазы приводит к увеличению содержания крахмала в клубнях, семенах или плодах трансгенного растения. 7. Способ по п.6, отличающийся тем, что трансгенное растение представляет собой томат или картофель или батат. 8. Способ по п.3, отличающийся тем, что рекомбинантную двухцепочечную последовательность ДНК вводят в геном клеток кукурузы,пшеницы, риса, томата, картофеля, батата, арахиса, ячменя, маниока, сахарной свеклы, сахарного тростника, банана съедобного, банана кормового и земляники. 9. Способ по п.8, отличающийся тем, что указанные клетки представляют собой клетки картофеля. 10. Способ по п.8, отличающийся тем, что указанные клетки представляют собой клетки кукурузы. 11. Способ по п.8, отличающийся тем, что указанные клетки представляют собой клетки пшеницы, ячменя, риса или томата. 12. Линия трансформированных клеток растения, полученного в соответствии со способом по любому из пп.3-11 формулы, содержащих рекомбинантную двухцепочечную последовательность ДНК по любому из пп.1-2 формулы. 13. Линия по п.12, отличающаяся тем, что указанные клетки представляют собой клетки кукурузы, пшеницы, риса, томата, картофеля,батата, арахиса, ячменя, маниока, сахарной свеклы, сахарного тростника, банана съедобного, банана кормового и земляники.

МПК / Метки

МПК: C12N 15/82

Метки: растении, экспрессии, частяхрастения, экспрессией, последовательность, трансформированных, клеток, способ, линия, сахарозофосфорилазы, получения, днк, растения, трансгенного, повышенной, двухцепочная, рекомбинантная, различных

Код ссылки

<a href="http://easpatents.com/16-634-rekombinantnaya-dvuhcepochnaya-posledovatelnost-dnk-dlya-ekspressii-saharozofosforilazy-v-rastenii-sposob-polucheniya-transgennogo-rasteniya-s-povyshennojj-ekspressiejj-saharozofos.html" rel="bookmark" title="База патентов Евразийского Союза">Рекомбинантная двухцепочная последовательность днк для экспрессии сахарозофосфорилазы в растении, способ получения трансгенного растения с повышенной экспрессией сахарозофосфорилазы в различных частяхрастения и линия трансформированных клеток растения</a>

Похожие патенты