Полипептиды lag-3v1, lag-3v2 и lag-3v3 и кодирующие их кднк

Номер патента: 3086

Опубликовано: 26.12.2002

Авторы: Мастранджели Ренато, Романьяни Серджо, Триебель Фредерик

Есть еще 7 страниц.

Смотреть все страницы или скачать PDF файл.

Формула / Реферат

1. кДНК SEQ ID NO:1, приведенная в перечне последовательностей, кодирующая полипептид LAG-3V1 с аминокислотной последовательностью SEQ ID NO:2, приведенной в указанном перечне, а также варианты данной кДНК, полученные на основе вырожденности генетического кода.

2. Последовательность нуклеотидов, полностью комплементарная кДНК по п.1.

3. Полипептид LAG-3V1 с аминокислотной последовательностью SEQ ID NO:2, кодируемый кДНК по п.1.

4. кДНК SEQ ID NO:3, приведенная в перечне последовательностей, кодирующая полипептид LAG-3V2 с аминокислотной последовательностью SEQ ID NO:4, приведенной в указанном перечне, а также варианты данной кДНК, полученные на основе вырожденности генетического кода.

5. Последовательность нуклеотидов, полностью комплементарная кДНК по п.4.

6. Полипептид LAG-3V2 с аминокислотной последовательностью SEQ ID NO:4, кодируемый кДНК по п.4.

7. кДНК SEQ ID NO:5, приведенная в перечне последовательностей, кодирующая полипептид LAG-3V3 с аминокислотной последовательностью SEQ ID NO:6, приведенной в указанном перечне, а также варианты данной кДНК, полученные на основе вырожденности генетического кода.

8. Последовательность нуклеотидов, полностью комплементарная кДНК по п.7.

9. Полипептид LAG-3V3 с аминокислотной последовательностью SEQ ID NO:6, кодируемый кДНК по п.7.

 

Текст

Смотреть все

1 Настоящее изобретение касается идентификации образующихся в результате альтернативного сплайсинга вариантов молекулы LAG-3 и их применения в качестве иммуномодуляторов. В настоящее время известно, что белки,кодируемые генами класса II МНС (главный комплекс гистосовместимости), вовлечены во многие процессы иммунного узнавания, включая взаимодействие между различными типами лимфоидных клеток, таких как лимфоциты и антиген-презентирующие клетки. Различные исследования также показали наличие других механизмов, которые не связаны с участием антигена CD4 в проявлении эффекторной функции хелперных Т-лимфоцитов. Лимфоцит-активирующий ген-3 (LAG-3),экспрессирующийся в активированных клетках Т и NK человека, кодирует мембранный белок I типа, состоящий из 498 аминокислот, включающий четыре внеклеточных домена, представляющих суперсемейство иммуноглобулинов (IgSF). Анализ этой последовательности показал наличие сегментов существенной идентичности при сопоставлении с сегментами аминокислотной последовательности, занимающими соответствующие положения в составе CD4, хотя общий уровень гомологии аминокислотных последовательностей при сравнении лишь ненамного превышает базовый уровень(приблизительный уровень гомологии последовательности 20%). Также имеется несколько внутренних участков гомологии последовательности в составе молекулы LAG-3, находящихся между доменами 1 (D1) и 3 (D3), а также между доменами 2 (D2) и 4 (D4): это подтверждает, что белок LAG-3 эволюционировал, как и белокCD4, за счт механизма генных дупликаций, а предковой являлась бинарная IgSF2-структура. Кроме того, гены, кодирующие белки LAG-3 иCD4, локализованы очень близко друг к другу в дистальной части короткого плеча хромосомы 12 [2: B.Huard, P.Gaulard, F.Faure, T.Hercend Т.,Triebel F, 1994, Immunogenetics, 39, 213]. Соответственно, гены LAG-3 и CD4 могут быть образно названы эволюционными "двоюродными братьями" в пределах гораздо более разрозненного суперсемейства IgSF. С применением количественного теста на клеточную адгезию авторы настоящего изобретения ранее показали, что образование "розеток" между клетками COS-7, трансфицированными геном LAG-3, и В-лимфоцитами, позитивными по генам класса II МHС, проявляет специфическую зависимость от взаимодействияLAG-3/MHC-II. Также с использованием химерной конструкции белков LAG-3/Ig было показано, что имеет место прямое специфическое связывание LAG-3 с различными молекулами класса II МНС человека (включая продукты различных аллелей и различные изотипы), равно как и с молекулами класса II МНС мышей и обезьян. 2 Этот димерный рекомбинантный глобулинLAG-3/Ig связывается с мономорфными компонентами класса II МНС с более высокой аффинностью (Kd=60 нМ при 37 С) по сравнению сCD4/Ig; LAG-3 действительно способен блокировать взаимодействие между CD4 и молекулами класса II МНС в тесте на межклеточную адгезию. Роль взаимодействия LAG-3/MHC-II была исследована с использованием моноклональных антител, специфичных в отношении LAG-3 и молекул LAG-3/Ig. Такое взаимодействие обусловливает негативную регуляцию активации клонов Т-лимфоцитов. Эффективность взаимодействия LAG-3/MHC-II опосредуется контактами между Т-клетками ("Т-Т"), в основном через передачу негативного сигнала молекул класса II МНС в Т-клетки. В целом, белок LAG-3 экспрессируется только после активации лимфоцитов, причм как in vivo, так и in vito, а, следовательно, не играет роли в индукционной фазе иммунного ответа в противоположность антигену CD4. Кроме того, эксперименты по блокированию действием моноклональных антител показали, что LAG-3 не участвует в распознавательной фазе, связанной с ограниченными поMHC-II CD4-позитивным Т-клеточным клонам. Функциональное значение белка LAG-3, соответственно, принципиально отличается от такового, характерного для других лигандов системы МНС - CD4 и CD8. В настоящее время принята точка зрения, согласно которой Тлимфоциты, несущие молекулы класса II МНС,играют ту роль, которая сходна с CTLA-4 по тому, что происходит после связывания LAG-3: т.е. индукция клонального делегирования ранее активированных Т-лимфоцитов. Недавно было обнаружено, что предпочтительная экспрессия и секреция LAG-3 осуществляется активированными клетками Тh1, т.е. хелперными Т-лимфоцитами, вырабатывающими -интерферон и фактор некроза опухоли, при этом оно позитивно регулируется интерлейкином-12 - мощным Тh1-индуцирующим цитокином (F.Annunziato, R.Manetti, L.Tomasevic,M.G.Giudizi, R.Biagiotti, V.Gianno, P.Germano P.,C.Mavilia, E.Maggi, S. Romagnani, 1996, FASEBJ., 10, 769-775). Высокие уровни цитоплазматических LAG-3 (sLAG-3) также были обнаружены в сыворотке у пациентов с диагнозом рецидивного рассеянного склероза (цит. там же) и у отдельных пациентов с системной красной волчанкой (S.Romagnani, 1996, Clin. Immunol. Immunopathol, 80, 225-235). Эти данные подтверждают, что LAG-3 может являться эффективным диагностическим маркром для опосредованных клетками Тh1 иммунных заболеваний,таких как тироидит Хасимото, сахарный диабетI типа, рассеянный склероз, болезнь Крона, ревматоидный артрит, острое отторжение пересаженных тканей и органов и острый синдромsLAG-3 в сыворотке у пациентов с рассеянным склерозом и, вероятно, у пациентов с другими вышеназванными заболеваниями, подтверждает естественную защитную роль белка sLAG-3 за счт того, что он может конкурировать со связанной с мембраной формой, что тем самым обеспечивает блокировку иммунных ответов,опосредованных белком LAG-3. Авторы настоящего изобретения исследовали возможную экспрессированность других форм LAG-3, которые могут быть обусловлены альтернативным сплайсингом первичного ядерного транскрипта. Большинство эукариотических генов, кодирующих белки, включают последовательности, присутствующие в соответствующих зрелых мРНК в виде непрерывных фрагментов ДНК (экзоны), прерываемых последовательностями (интроны), которые не являются частью зрелых (процессированных) мРНК. Первичные транскрипты этих генов, таким образом, содержат последовательности, которые соответствуют и экзонам, и интронам. Интронные последовательности вырезаются в ходе многоступенчатого внутриядерного процесса, известного как"сплайсинг пре-мРНК". При этом интроны "демаркированы" присутствием консенсусных последовательностей, расположенных по их 5'- и 3'-концам (соответственно, донорному и акцепторному). Процесс сплайсинга включает расщепление по акцепторному сайту с последующим лигированием 5'- и 3'-концов экзонов. В большинстве случаев присутствующие в составе гена экзоны попадают в одну зрелую молекулу мРНК благодаря инвариантному лигированию соответствующих пар донорных и акцепторных сайтов сплайсинга, в результате чего образуется единственный генный продукт. Однако в некоторых случаях тот же ген может включать сайты альтернативного сплайсинга, что может обусловливать появление дифференцированных транскриптов. Механизм,регулирующий процесс альтернативного сплайсинга, пока точно не определн, но, по крайней мере, для некоторых генов известно, что эти механизмы специфичны по типам клеток и этапах индивидуального развития. Альтернативный сплайсинг приводит к образованию множественных изоформ одного и того же белка, кодируемых одним геном. Соответственно, этот процесс является одним из молекулярных механизмов, обеспечивающих многообразие белков. В настоящее время известно более 50 генов, для которых подтверждено образование белкового разнообразия за счт механизма альтернативного сплайсинга. Этот механизм характеризуется общими чертами и свойственен генам, кодирующим сократительные белки. Авторы настоящего изобретения обнаружили три новых дифференцированно сплайси 003086 4 руемых варианта LAG-3: соответственно, они были обозначены LAG-3V1, LAG-3V2 и LAG3V3. Вариант LAV-3V1 кодирует цитоплазматический белок с молекулярной массой 36 кД,включающий 8 новых аминокислотных остатков после домена D2; вариант LAG-3V2 кодирует белок с молекулярной массой 61 кД не содержит домена D4; а вариант LAG-3V3 кодирует цитоплазматический белок с молекулярной массой 52 кД, включающий 8 новых аминокислотных остатков после домена D3. Эти варианты предоставляют новые возможности изучения как механизмов регуляции собственно гена LAG-3, так и биологических функций кодируемого им белка, а также применимы для производства новых иммуномодулирующих соединений, особенно таких соединений, которые мимируют биологические функции самого LAG-3 или которые могут действовать как агонисты или антагонисты взаимодействия между LAG-3 и молекулами класса II МНС. Объектом настоящего изобретения, таким образом, является выделенная нуклеотидная последовательность, выбираемая из группы,которая включает:c) нуклеотидные последовательности, являющиеся модифицированными в результате вырожденности генетического кода нуклеотидными последовательностями, определнными выше в пп.(а) и (b), и которые кодируют полипептид, являющийся генетическим вариантом молекулы LAG-3. Также настоящее изобретение направлено на очищенные полипептиды, кодируемые нуклеотидными последовательностями, определнными выше. Упомянутые полипептиды здесь и далее обозначаются как "варианты LAG-3". Также настоящее изобретение касается фармацевтических композиций, включающих варианты LAG-3. Эти композиции применимы для лечения иммунологических патологий, в частности, тех заболеваний, которые опосредуются участием клеток Th1, таких как тироидит Хасимото, сахарный диабет I типа, рассеянный склероз, болезнь Крона, ревматоидный артрит,острое отторжение пересаживаемых тканей и органов, острый синдром "трансплантат-противхозяина" (GVHD), офтальмопатия Грейва, церебральная малярия, артрит Лайма, инфекционный (индуцируемый бактерией рода Yersinia) артрит, HCV-индуцируемый хронический гепатит, первичный склерозирующий колангит контактный дерматит, повторяющиеся выкидыши 5 неясной этиологии, апластическая анемия и вызываемый бактериями вида Helicobacter pilori гастероантрит. Также настоящее изобретение касается применения вариантов белка LAG-3 в производстве иммуномодуляторных соединений. Такие соединения могут мимировать или изменять биологические функции самого LAG-3 и (или) вариантов LAG-3, индуцируя таким образом некоторые модификации клеточных взаимодействий, участниками которых являются самLAG-3 или его варианты. Также настоящее изобретение представляет поликлональные или моноклональные антитела и их фрагменты Fab, Fab' и F(ab')2 или Fv,специфичные в отношении конкретных эпитопов в составе одного из вышеназванных вариантов LAG-3. Применение этих специфичных антител для очистки упомянутых вариантов или для выработки терапевтических или диагностических композиций, равно как и сами получаемые в результате композиции также входят в объм настоящего изобретения. Далее настоящее изобретение представляет способ лечения, предназначенный для лечения иммунных патологий, включающий введение пациенту эффективного количества варианта LAG-3 или композиции, содержащей упомянутый вариант в качестве активного компонента. Далее настоящее изобретение представляет способ, предназначенный для лечения иммунных патологий, включающий введение пациенту обозначенного выше антитела, специфичного в отношении варианта LAG-3, или терапевтической композиции, содержащей упомянутое антитело в качестве активного компонента. В предпочтительном варианте настоящее изобретение направлено на выделенную нуклеотидную последовательность, выбираемую из группы, которая включает SEQ ID NO 1, SEQ IDNO 3 или SEQ ID NO 5, или полностью комплементарные им последовательности. Также настоящее изобретение касается очищенного полипептида, который образуется в результате экспрессии одной из нуклеотидных последовательностей по настоящему изобретению. Предпочтительно этот полипептид выбирается из группы, которая включает вариантыLAG-3V1, LAG-3V2 и LAG-3V3, которые, соответственно, кодируются нуклеотидными последовательностями SEQ ID NO 1, SEQ ID NO 3 иSEQ ID NO 5 и которые соответствуют аминокислотным последовательностям, показанным вSEQ ID NO 2, SEQ ID NO 4 и SEQ ID NO 6. Полипептиды в соответствии с настоящим изобретением могут быть получены с применением любого стандартного метода очистки мембранных или цитоплазматических белков, с помощью пептидного синтеза или путм применения методов генетической инженерии. Упомя 003086 6 нутые методики включают внесение нуклеотидной последовательности, кодирующей один из пептидов по настоящему изобретению, в состав экспрессирующего вектора, такого как плазмида, и трансформацию клеток-хозяев этим экспрессирующим вектором, используя при этом любой из методов, известных специалистам в данной области техники, таким как электропорация. Преимущественно нуклеотидные последовательности по настоящему изобретению получают методом ПЦР с ревертированием (полимеразная цепная реакция с использованием обратной транскриптазы) в отношении кДНК соответствующего варианта LAG-3. Вкратце, общий пул РНК экстрагируют из активированных лимфоцитов периферической крови человека и подвергают обратной транскрипции и амплификации с использованием специфической пары олигонуклеотидных затравок. В случае настоящего изобретения затравки включают смысловую и антисмысловую затравки, которые располагаются в двух конкретных сайтах последовательности гена LAG-3, которые будут более подробно описаны в нижеследующих примерах. Полученную в результате кДНК затем амплифицируют методом ферментативной (полимеразной) амплификации, и она может быть субклонирована в состав подходящей клеткихозяина. Настоящее изобретение также касается экспрессирующих векторов, несущих нуклеотидную последовательность, кодирующую полипептид в соответствии с настоящим изобретением, а также клетки-хозяева, трансформированные этими векторами. Термин "экспрессирующий вектор" обозначает способную к репликации конструкцию ДНК, используемую либо для амплификации,либо для экспрессирования последовательности,которая кодирует один из полипептидов по настоящему изобретению. Клетки-хозяева могут быть прокариотическими или эукариотическими, включая, но тем самым не ограничиваясь, бактерии, дрожжи,клетки насекомых, клетки млекопитающих,включая культивируемые клеточные линии,доступные на коммерческой основе. Настоящее изобретение также представляет антитела, специфичные по отношению к вариантам LAG-3, или их фрагменты в соответствии с тем, на что было указано выше. Необязательно эти антитела или их фрагменты могут быть соединены с маркром (радиоактивным изотопом, флуоресцентным красителем, ферментным маркром и т.п.) или с терапевтически активной молекулой, которая, например, является цитотоксичным соединением. Поликлональные антитела могут быть получены в соответствии с хорошо известными методами, такими которые описаны Бенедиктом с соавт. (Benedict A.A. et аl.). Методы получения 7 моноклональных антител также хорошо известны на предшествующем уровне техники, в частности, метод, описанный Клером и Мильштейном (KohlerMilstein). Этот метод, наряду с его модификациями, описан Йелтоном с соавт.(Yelton et al.). Эти антитела могут быть использованы в методе очистки полипептида по настоящему изобретению или в методе дозирования или идентификации. Упомянутым методом, например, являются такие методы (не ограничиваясь ими), как радиоиммунологический метод типа РИА или иммунорадиометрический тест, иммуноферментный тест, такой как метод ТИФА,или метод прямого или непрямого иммунофлуоресцентного лечения. Настоящее изобретение также представляет применение упомянутых антител для производства терапевтических композиций, способных блокировать активность вариантов LAG-3,т.е. обладающих иммуномодуляторной активностью, такой как индукция созревания, дифференциации, пролиферации и(или) функционирования клеток, экспрессируюших вариант LAG-3,например, активированными клетками Т и NK. Антитела к вариантам LAG-3 могут быть использованы в качестве потенциирующих(усиливающих) факторов вакцин или иммуностимуляторов для пациентов, страдающих иммунодепрессией, например, пациентов, заражнных вирусом иммунодефицита (ВИЧ) или проходящих лечение с применением иммуносупрессорных препаратов. Терапевтические композиции в соответствии с настоящим изобретением включают цитоплазматические варианты LAG-3 или антитела,определявшиеся здесь выше, а также фармацевтически приемлемый наполнитель. Эти композиции могут быть получены в соответствии со стандартными методиками. Наполнитель может варьироваться, исходя из выбираемого типа введения композиции: перорального, парентерального, подъязычного, ректального или назального. Для композиций, предназначенных для парентерального введения, наполнителем обычно является стерильная вода, равно как и другие компоненты, обеспечивающие растворение композиции или е способность к хранению. Парентеральный способ введения может включать внутривенные, внутримышечные или подкожные инъекции. Терапевтическая композиция может относиться к типу с замедленным выделением, пригодной, в частности, для долговременной терапии, например, при лечении аутоиммунных заболеваний. Предназначенная для введения доза зависит от конкретного пациента, лечение которого проводится, в частности, от параметров его(е) иммунной системы с точки зрения достижения желательного уровня защиты. Точные количества предназначенного для введения ак 003086 8 тивного компонента могут быть легко определены практикующим врачом, назначающим данное лечение. Терапевтические композиции в соответствии с настоящим изобретением могут включать,в дополнение к цитоплазматическим вариантамLAG-3 или антителам по настоящему изобретению, другой, являющийся подходящим, активный компонент, химически соединнный с вариантом LAG-3 или с антителом по настоящему изобретению. В качестве примера можно привести слияние вариантов LAG-3 по настоящему изобретению с токсинами, например, с рицином или с дифтерийным анатоксином, способным связываться с молекулами класса II главного комплекса гистосовместимости и уничтожать клетки-мишени, например, лейкозные или меланомные клетки, или слитые с радиоактивным изотопом. Приводимые ниже примеры, наряду с определяемыми далее фигурами, должны проиллюстрировать настоящее изобретение с большими подробностями. Описание чертежей Фиг. 1 представляет схематическое изображение молекулы LAG-3 дикого типа и е вариантов V1, V2 и V3. Вариант LAG-3V1 происходит в результате сохранения последовательности 4-го интрона, т.е. расщепления по донорному и акцепторному сайтам, фланкирующим 4-й интрон, не происходит. Оказывающийся в пределах открытой рамки стопкодон, расположенный через 8 кодонов, имеющихся в составе сохраняющегося 4-го интрона,приводит к образованию укороченного цитоплазматического белка LAG-3V1, включающего домены D1, D2 и 8 новых аминокислотных остатков. Вариант LAG-3V2 утрачивает 6-й экзон,что обусловливается сшиванием донорного сайта сплайсинга 5-го интрона с акцепторным сайтом 6-го интрона. Поскольку при таком процессе сдвига кодирующей рамки не происходит, то образующийся в результате белок LAG-3V2 является трансмембранным белком не содержащим в свом составе домена D4. Вариант LAG-3V3 образуется в результате расщепления первичного ядерного транскрипта по отличающемуся сайту полиаденилирования,расположенному примерно на 170 пар нуклеотидов ниже 5'-конца 5-го интрона. Сохраняющаяся последовательность 5-го интрона включает внутрирамочный стоп-кодон. Образующаяся в результате зрелая мРНК кодирует укороченный цитоплазматический белок, включающий в свом составе домены D1, D2, D3 и 8 новых аминокислотных остатков. Фиг. 2 представляет схематическое изображение экзон-интронной организации генаLAG-3. Пунктирной линией показаны процессы сплайсинга, в результате которых образуются зрелые РНК-транскрипты, кодирующие LAG-3SP - сигнальный пептид; D1-D4 - иммуноглобулиноподобные домены 1-4; ТМ - трансмембранная последовательность; CYT - цитоплазматический домен; 11-19 - интроны от 1-го по 9-й. Новые экзоны в составе вариантов LAG3V1 и LAG-3V3 показаны в виде заштрихованных прямоугольников. Фиг. 3 показывает схематическое изображение LAG-3 дикого типа и варианта LAG-3V1. Локализация затравок и зондов, использовавшихся для выделения LAG-3V1, обозначена стрелками. Фрагменты ДНК, амплифицированные с использованием специфических затравок,обозначены одиночными линиями. Обозначен размер фрагментов, полученных в методе ПЦР с ревертированием. Фиг. 4 представляет данные анализа методом Саузерн-блоттинга фрагментов кДНК LAG3 дикого типа и варианта LAG-3V1, амплифицированных с помощью ПЦР с ревертированием с использованием затравок F459 и R460; а) гель, окрашенный бромистым этидием;b) блот, гибридизовавшийся с кДНК-зондом,специфичным в отношении LAG-3. Нижний бэнд является производным от LAG-3 дикого типа, в то время как верхний бэнд, проявляющийся только после гибридизации, является производным от LAG-3V1. Фиг. 5 показывает данные анализа методом Саузерн-блоттинга кДНК-фрагментов LAG3V1, амплифицированных с помощью ПЦР с ревертированием с использованием затравокF176 и R460; а) гель, окрашенный бромистым этидием. Самый крупный бэнд происходит от LAG-3 дикого типа; b) блот, гибридизовавшийся с олигонуклеотидным зондом, специфичным в отношении последовательности 4-го интрона генаLAG-3. Верхний бэнд является производным от варианта LAG-3V1, в то время как нижний бэнд- от гетеродуплекса, образованного LAG-3 дикого типа и LAG-3V1. Фиг. 6 представляет схематическое изображение LAG-3 дикого типа и варианты LAG3V2 и LAG-3V3. Расположение затравок и зондов, использовавшихся при выделении LAG3V2 и LAG3V3, обозначено стрелками. Фрагменты ДНК, амплифицированные с использованием этих специфических затравок, показаны одиночными линиями. Обозначен размер фрагментов, полученных методом ПЦР с ревертированием. Фиг. 7 показывает данные анализа методом Саузерн-блоттинга кДНК-фрагментов LAG3 дикого типа и вариантов LAG-3V2 и LAG3V3, амплифицированных с применением ПЦР с ревертированием с использованием затравокLAG-3V2. Верхний бэнд является производным от LAG-3 дикого типа, в то время как бэнды размером 780 и 940 пар нуклеотидов, являются производными от вариантов LAG-3V2 и LAG3V3 соответственно. Фиг. 8 показывает параметры электрофореза в агарозном геле продуктов ПЦР с ревертированием, полученных с использованием затравок, специфичных в отношении LAG-3V2 иLAG-3V3, т.е. соответственно 173/V2R и 173/V3R. Фиг. 9 показывает результаты Вестернблоттинга ФГА-бластов с использованием моноклональных антител, специфичных в отношении LAG-3. Примеры Пример 1. Клонирование варианта 1 LAG3 человека (LAG-3 VI) с помощью ПЦР с ревертированием в отношении РВМС человека (моноядерные клетки периферической крови). Экстракция РНК и ПЦР с ревертированием. Моноядерные клетки периферической крови (РВМС) были выделены с помощью центрифугирования в градиенте плотности FicollHypaque и активированы 1 мкг/мл фитогемагглютинина (ФГА) и 100 ед./мл интерлейкина-2 в течение 48 ч при 37 С при 5% СО 2. Пулы мРНК были экстрагированы с использованием набора реактивов Oligotex Direct mRNA kit (QuiagenInc., Chatsworth, CA, США) и подвергнуты обратной транскрипции с олигодезокситимидиновой затравкой и набора реактивов для синтеза первой цепи (RT-PCR kit: Stratagene, LaJolla, CA, США). Амплификация кДНК была осуществлена с 2,5 ед. Taq-полимеразы и 100 нг каждой затравки - прямой затравки F459 (5'-ТСТСТСAGAGCCTCCGATGGGTCATTTTG-3') (SEQ IDNO 7) и обратной затравки R460 (5'TCCTGCAGATGGATATGGCAGGTGTAGGTC3') (SEQ ID NO 8), которые отжигали на нуклеотиды 762-791 и 1217-1246 нуклеотидной последовательности LAG-3, соответственно (фиг. 3). Было проведено тридцать циклов ПЦР: каждый цикл включал этап денатурации при 94 С в течение 1 мин, отжиг при 66 С в течение 1 мин и достройку цепи при 72 С в течение 2 мин. Анализ амплифицированной ДНК методом Саузерн-блоттинга. 10-мкл аликвоты амплифицированной ДНК фракцинировали в 2% агарозном геле. Был выявлен ожидаемый фрагмент длиной 485 пар нуклеотидов, соответствующий LAG-3 (фиг. 4 а). После блоттинга на нитроцеллюлозный мембранный фильтр и гибридизации с 32 Р-помеченным кДНК-зондом, специфичным в отношении LAG-3D1D2, в дополнение к 485 нуклеотидному фрагменту был выделен бэнд, 11 соответствующий фрагменту длиной примерно 890 пар нуклеотидов. Фрагмент длиной 890 пар нуклеотидов был подвергнут повторной амплификации, клонирован и секвенирован. Клонирование и секвенирование 890 нуклеотидного фрагмента LAG-3. 890-Нуклеотидный фрагмент был клонирован в состав вектора pCRII (Promega), а вставку секвенировали с использованием набора реактивов ABI Prism Dye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer) и с использованием автоматического секвенсора ДНК, модель 373 А (Perkin-Elmer). Полученные результаты указывают на то, что этот фрагмент состоит из 892 нуклеотидов и происходит от варианта LAG-3, сохраняющего последовательность 4-го интрона (фиг. 2). Благодаря присутствию внутрирамочного стоп-кодона в последовательности 4-го интрона этот вариант, обозначаемый как LAG-3V1, предсказательно кодирует цитоплазматический белок с молекулярной массой 36 кД, включающий домены D1, D2 и 8 новых С-концевых аминокислотных остатковLAG-3V1 происходит от мРНК, но не от геномной ДНК, был проведн второй эксперимент с ПЦР с ревертированием, в котором использовали прямую затравку F176 (5'-CCTGGGCCAGGCCTCGAJGAC-3') (SEQ ID NO 9), которую отжигали на нуклеотиды 725-745 последовательности LAG-3, а также обратную затравку R460(фиг. 3). Затравка F176, которая покрывает сайт сллайсинга участков, кодирующих доменыD1/D2, не должна приводить к амплификации геномной последовательности гена LAG-3. В условиях разгонки продуктов ПЦР методом электрофореза в агарозном геле был выявлен ожидаемый бэнд длиной 520 пар нуклеотидов, соответствующий LAG-3 дикого типа (фиг. 5 а). Саузерн-блоттинг с использованием олигонуклеотидного зонда 14 (5'-CCCCACTCTGCTTCACATTT-3') (SEQ ID NO 10), специфичного для 4-го интрона гена LAG-3, показал наличие ожидаемого из 930 пар нуклеотидов бэнда LAG3V1 и дополнительно бэнда, соответствующего примерно 800-нуклеотидному фрагменту (фиг. 5). Эти два фрагмента подвергали повторному амплифицированию и секвенировали. Было подтверждено, что верхний бэнд соответствует варианту LAG-3V1, в то время как нижний бэнд является гетеродуплексом, образованным LAG3 дикого типа и LAG-3V1. Пример 2. Клонирование варианта 2 LAG3 (LAG-3V2) и варианта 3 LAG-3 (LAG-3V3) человека с помощью ПЦР с ревертированием из активированных клеток РВМС. Экстракция РНК и ПЦР с ревертированием. Моноядерные клетки периферической крови (РВМС) были выделены с применением 12 центрифугирования в градиенте плотности Ficoll-Hypaque и активированы 1 мкг/мл ФГА и 100 ед./мл интерлейкина-2 в течение 48 ч при 37 С при 5% СO2. Общий пул РНК экстрагировали с применением реагента TriZol (Gibco BRL). Общую РНК (5 мкг) подвергали обратной транскрипции с использованием смеси якорных олигодезокситимидиновых затравок АТ 17 А, АТ 17 С и AT17GID NO 1), завершающихся нуклеотидом А, С или G соответственно (фиг. 6), которые позволяют получать молекулы кДНК, характеризующиеся гомогенными 3'-концами и "якорем", являющимся мишенью для последующих этапов ПЦР. Реакцию обратной транскрипции осуществляли при конечном объме в 50 мкл 1 х обратнотранскриптазного буфера, 10 мМ дитиотреитола, 1 мМ дНТФ, 40 ед. РНКазного ингибитора (Boehringer) и 400 ед. Superscript II RT(Gibco BRL) при 37 С в течение 90 мин. Реакцию обратной транскрипции останавливали нагреванием до 90 С на 5 мин. РНК расщепляли 1 ед. РНК-азы-Н (Boehringer) при 37 С в течение 30 мин. ПЦР проводили с использованием прямой затравки F176 и обратной затравки R401 (5'GGCCCTGGATCCGGACCTAA-3') (SEQ ID NO 12), которые отжигали на 3'-якорные последовательности кДНК (фиг. 6). Затравки F176 и R401 должны позволить амплифицировать все сплайсинговые варианты LAG-3, включающие участок от D1/D2-соединения до полиаденилового"хвоста". ПЦР проводили в 5 мкл кДНК-эквивалента по отношению к 0,5 мкг общей РНК при конечном объме в 100 мкл, включающем 1x Taqполимеразного буфера, 2,5 ед. ДНК-полимеразыTaq (Advanced Biotechnology), 1,5 мМ хлорида магния, 200 мМ дНТФ, 10% диметилсульфоксида и 50 пкмоль каждой из затравок F176 и R401. Был применн метод "горячего старта" с последующими 30 циклами ПЦР (каждый из них: 96 С - 30 с, 65 С - 30 с, 72 С - 4 мин). В качестве негативного контроля в эксперименте с ПЦР использовали РНК без обратной транскриптазы. Анализ методом Саузеры-блоттинга продуктов ПЦР с ревертированием. Продукты ПЦР с ревертированием (10 мкл) фракционировали методом электрофореза в агарозном геле и промокали на нейлоновую мембрану Hy-bond-N+(Amersham). Блот гибридизовали с помеченным дигоксигенином олигонуклеотидным зондом F459, специфичным дляLAG-3 D2, (фиг. 6) в 5 х SSC, 0,02% SDS, 0,5% блокирующего реагента (Воеhringer), 0,1% Nлаурилсаркозина при 55 С в течение 30 мин. Затем блот промывали дважды в растворе 2xSSC, 0,1% SDS при 55 С. Выявление гибридных молекул проводили с использованием соединнных с пероксидазой редьки антител к(Amersham). Полученные результаты показали, что в дополнение к ожидаемому фрагменту длиной 1120 пар нуклеотидов, соответствующему LAG3 дикого типа, два минорных бэнда, соответствующие фрагментам длиной примерно 940 и 780 пар нуклеотидов, были выявлены в геле,окрашенным бромистым этидием (фиг. 7 а) и при Саузерн-блоттинге (фиг. 7b). Секвенирование фрагментов LAG-3. ПЦР-фрагменты, состоящие из 940 и 780 пар нуклеотидов, были выделены из агарозного геля, повторно амплифицированы с использованием затравок F176/R401 и секвенированы напрямую. Полученные результаты показали, что фрагмент, состоящий из 780-нуклеотидов, происходит в результате проскакивания 6-го экзона гена LAG-3 (фиг. 2). Этот вариант, обозначенный как LAG-3V2, предсказательно кодирует транс-мембранный белок с молекулярной массой 61 кД, который не включает домен D4 (фиг. 1). Секвенирование фрагмента, состоящего из 940 пар нуклеотидов, показало, что он образуется в результате расщепления первичного ядерного транскрипта в отличающемся сайте полиаденилирования, расположенном примерно на 170 нуклеотидов дальше от 5'-конца 5-го интрона (фиг. 2). Оставшаяся последовательность 5-го интрона включает внутрирамочный стоп-кодон. Образующаяся в результате мРНК транслируется в вариант LAG-3, обозначаемый как LAG3V3, который включает домены D1, D2 и D3, за которыми имеется ещ 8 новых аминокислотных остатков (фиг. 1). В обоих вариантах LAG-3V2 и LAG-3V3 - сохраняются характерные для LAG-3 дикого типа четыре сайта потенциального гликозилирования. Подтверждение экспрессии LAG-3V2 иLAG-3V3. Для подтверждения экспрессии вариантовLAG-3V2 и LAG-3V3 и для оценки присутствия полноразмерной 5'-последовательности, кодирующей N-концевую часть белка LAG-3, ПЦР с ревертированием была осуществлена в отношении общего пула РНК, выделенной из клеток РВМС с использованием прямой затравки F173(5'-TATAGGATCCGGTGCCCAGACCATAGGAGAGATG-3') (SEQ ID NO 13), которую отжигали на нуклеотиды 212-233 последовательностиLAG-3, в составе которой имеется старт-кодонCCGAGAT-3') (SEQ ID NO 15) (фиг. 6). Поскольку затравка V2R отжигается на сайт сплайсинга доменов D3/TM варианта LAG-3V2,а затравка V3R отжигается на 5'-последовательность 5-го интрона варианта LAG-3V3, то 14 должна происходить амплификация обоих этих вариантов. ПЦР была проведена при использовании температуры отжига 68 С для первых двух циклов и 72 С в остальные 28 циклов. При проведении электрофореза в агарозном геле были обнаружены ожидаемые фрагменты длиной 1100 нуклеотидов (LAG-3V2) и 1230 нуклеотидов (LAG-3V3) (фиг. 8). Секвенирование ДНК в составе амплифицированных фрагментов подтвердило, что LAG-3V2 кодирует трансмембранный белок с молекулярной массой 61 кД, включающий домены D1, D2, D3, трансмембранный домен (ТМ) и цитоплазматический домен (CYT), в то время как вариант LAG-3V3 кодирует растворимый (цитоплазматический) белок с молекулярной массой 52 кД, включающий домены D1, D2 и 8 новых С-концевых аминокислот (фиг. 1). В заключение можно отметить, что в настоящее время идентифицированы четыре молекулы LAG-3 - две связанные с мембранойLAG-3 в линиях отдельных Т-лимфоцитов и при разном статусе их активации может обеспечить полезную информацию для лучшего понимания функций белка LAG-3. Пример 3. Характеристика белка LAG3V3. Моноядерные клетки периферической крови (РВМС) человека были получены путм центрифугирования в градиенте плотности Фиколл-диатризоата на материале поверхностной плнки отдельных проб донорской крови. РВМС были получены от двух здоровых доноров. РВМС, взятые из зоны соприкосновения надосадочного слоя и слоя градиента, трижды промывали в фосфатном буфере и в конечном счте ресуспендировали при концентрации 2 млн. клеток на 1 мл в культуральной средеRPMI-1640 обогащенной 10% плодной телячьей сыворотки, 2 мМ L-глутамина, 100 ед./мл пенициллина и 100 мкг/мл стрептомицина. Затем добавляли фитогемагглютинин (ФГА) и рекомбинантный человеческий интерлейкин-2 (IL-2) при конечной концентрации 1 мкг/мл и 100 ед./мл соответственно. Клетки инкубировали при 37 С в присутствии 5% CO2 в течение 72 и 120 ч. По окончании инкубации клеточные суспензии переносили в 50-мл полипропиленовые пробирки и центрифугировали при 400g в течение 10 мин. Надосадочные фракции отбирали и сразу замораживали при 20 С. Определение общего белка проводили по методу Бредфорда с использованием теста с окрашиванием кумасси голубым(Pierce, Rockford, IL, США). Для проведения анализа 100 мкг образца полностью высушивали с использованием вакуумной центрифуги, ре 15 суспендировали в 10 мкл бидистиллированной воды, 10 мкл образцового буфера 2 х добавляли и образцы инкубировали в течение 5 мин при 100 С. Образцы затем загружали в 8% полиакриламидный гель с трис-глицином для проведения анализа методом электрофореза в SDS-ПААГ,который проводили в денатурирующих и восстанавливающих условиях при напряжении в 125 В. Электрофоретическую разгонку останавливали тогда, когда граница красителя достигала дна геля. Гель снимали и инкубировали в течение 20 мин в трансферном буфере. Нитроцеллюлозные мембраны 0,45 мкм инкубировали в течение 10 мин в трансферном буфере в отдельной емкости при легком перемешивании. Затем белки из геля электрофоретически переносили на мембрану в течение 90 мин при постоянном напряжении 75 В. По завершении переноса мембрану высушивали при комнатной температуре и затем инкубировали в течение 20 мин в 1% (весовые проценты) едком калии при тщательном перемешивании и промывали 4 раза фосфатным буфером в течение 5 мин. Мембрану окрашивали в течение 5 мин раствором красителя понсо-S, позволяющим выявлять тестируемые белки и маркры молекулярных масс, и затем обескрашивали четырежды фосфатным буфером. Сайты неспецифического связывания блокировали путм инкубирования мембраны в течение ночи при 4 С при 1% Mile в фосфатном буфере +0,5% Твин. После удаления блокирующего раствора на мембрану накапывали специфичное в отношении LAG-3 моноклональное антитело 2 Н 6,разведнное в 5 мкг/мл блокирующего раствора. Через 1 ч инкубации при комнатной температуре при перемешивании мембрану 5 раз промывали фосфатным буфером +0,5% Твин в течение 10 мин (каждая промывка) и затем инкубировали в течение 1 ч при комнатной температуре при перемешивании с козьими поликлональными антителами к мыши, соединнной с пероксидазой редьки, разведнной в соотношении 1:1000 в блокирующем растворе. По окончании инкубации мембрану промывали так же, как это было описано выше. Результаты Подвергнутые иммуноблоттингу белки затем выделяли с применением метода "усиливающей люминесценции" (ECL) (AmershamItalia, Milan, Италия). Колонки 1 и 3 на фиг. 9 представляют результаты, полученные от 1-го донора через 72 и 120 ч инкубации соответственно, в то время как колонки 2 и 4 соответствуют данным 2-го донора, а колонка 5 - лимфобластоидной клеточной линии RAJI, взятой в качестве негативного контроля. Исходные концентрации белков составили соответственно 3,1, 1,9, 2,8, 3,4, 3,4 мг/мл от 1-й к 5-й колонке. 16 Бэнд, соответствующий молекулярной массе примерно 5,5 кД, реагировал с моноклональным антителом к LAG-3. Эта выявленная величина молекулярной массы согласуется с той, которая является расчтной для вариантаLAG-3V3, исходя из последовательности, соответствующей мРНК. Этот бэнд специфически проявляется ФГА-стимулированными бластами и отсутствует в надосадочной фракции Влимфобластных клетках линии RAJI, полученных в качестве супер-натантов ФГА-стимулированных бластов. Список последовательностей ФОРМУЛА ИЗОБРЕТЕНИЯ 1. кДНК SEQ ID NO:1, приведенная в перечне последовательностей, кодирующая полипептид LAG-3V1 с аминокислотной последовательностью SEQ ID NO:2, приведенной в указанном перечне, а также варианты данной кДНК, полученные на основе вырожденности генетического кода. 2. Последовательность нуклеотидов, полностью комплементарная кДНК по п.1. 24 3. Полипептид LAG-3V1 с аминокислотной последовательностью SEQ ID NO:2, кодируемый кДНК по п.1. 4. кДНК SEQ ID NO:3, приведенная в перечне последовательностей, кодирующая полипептид LAG-3V2 с аминокислотной последовательностью SEQ ID NO:4, приведенной в указанном перечне, а также варианты данной кДНК, полученные на основе вырожденности генетического кода. 5. Последовательность нуклеотидов, полностью комплементарная кДНК по п.4. 6. Полипептид LAG-3V2 с аминокислотной последовательностью SEQ ID NO:4, кодируемый кДНК по п.4. 7. кДНК SEQ ID NO:5, приведенная в перечне последовательностей, кодирующая полипептид LAG-3V3 с аминокислотной последовательностью SEQ ID NO:6, приведенной в указанном перечне, а также варианты данной кДНК, полученные на основе вырожденности генетического кода. 8. Последовательность нуклеотидов, полностью комплементарная кДНК по п.7. 9. Полипептид LAG-3V3 с аминокислотной последовательностью SEQ ID NO:6, кодируемый кДНК по п.7.(ПЦР без ревертирования) Колонки 3-4: мол. масса, мечение дигоксигенином Колонки 5-6: мол. масса(ПЦР без ревертирования) Колонки 3-4: мол. масса, мечение дигоксигенином Колонки 5-6: мол. масса Фиг. 7 А Колонка 1-2: мол. масса, мечение дигоксигенином Колонка 3-4: мол. масса Колонка 5: ПЦР с ревертированием с затравками F176/R401 Колонка 6: негативный контроль Фиг. 7 В Колонка 1-2: мол. масса, мечение дигоксигеном Колонка 3-4, мол. масса Колонка 5: ПЦР с ревертированием с затравками F176/R401 Колонка 6: негативный контроль

МПК / Метки

МПК: A61K 38/17, G01N 33/53, C12N 15/12, C07K 14/725

Метки: кодирующие, lag-3v2, полипептиды, lag-3v3, кднк, lag-3v1

Код ссылки

<a href="http://easpatents.com/15-3086-polipeptidy-lag-3v1-lag-3v2-i-lag-3v3-i-kodiruyushhie-ih-kdnk.html" rel="bookmark" title="База патентов Евразийского Союза">Полипептиды lag-3v1, lag-3v2 и lag-3v3 и кодирующие их кднк</a>

Похожие патенты