Новый способ получения рнк-вируса

Номер патента: 18564

Опубликовано: 30.08.2013

Авторы: Мустер Томас, Егоров Андрей, Волшек Маркус

Есть еще 6 страниц.

Смотреть все страницы или скачать PDF файл.

Формула / Реферат

1. Способ получения вирусов с негативным сегментированным РНК-геномом, включающий стадии:

a) обеспечения линейного экспрессирующего конструкта, который не содержит каких-либо последовательностей для амплификации и/или отбора, и который содержит промотор РНК-полимеразы I (polI) и сигнал терминации транскрипции для polI, которые оба вставлены между промотором РНК-полимеразы II (polII) и сигналом полиаденилирования, и который дополнительно содержит HA- и/или NA-генный сегмент, вставленный между polI-промотором и сигналом терминации для polI,

b) трансфецирования клетки-хозяина указанным линейным экспрессирующим конструктом,

c) инфицирования указанных клеток-хозяев вирусом-помощником, имеющим белки вируса помощника HA и/или NA,

d) культивирования указанной клетки-хозяина для размножения вирусных частиц,

e) отбора вирусных частиц, которые содержат:

(i) белки HA и/или NA, полученные из линейного экспрессирующего конструкта, но не

(ii) белки HA и NA вируса-помощника или их сегменты, где указанный отбор основан на фенотипических, генотипических или антигенных свойствах белков HA и/или NA, и необязательно

f) где отсутствие белков HA и NA вируса-помощника определяют анализом нуклеотидной или аминокислотной последовательности.

2. Способ по п.1, в котором клетку-хозяин трансфецируют линейными конструктами, которые кодируют белки, выбранные из группы, состоящей из PB1, PB2, PA, NS, М и NP.

3. Способ по любому из пп.1 или 2, в котором частицы вирусов-потомков, содержащие белок HA, полученный из вируса-помощника, отделяют от частиц вируса-кандидата обработкой частиц вирусов-потомков протеазой, и в котором протеаза не расщепляет белок HA, полученный из вируса-помощника, но расщепляет белок HA частиц вируса-кандидата.

4. Способ по любому из пп.1-3, в котором протеазу выбирают из группы, состоящей из трипсина, эластазы, химотрипсина, папаина.

5. Способ по п.1 или 2, в котором белок HA вируса-помощника модифицируют для того, чтобы он был расщепляемым протеазой, где трипсин не является указанной протеазой.

6. Способ по п.1 или 3, в котором частицы вирусов-потомков, содержащие белки HA и NA из вируса-помощника, отделяют от частиц вируса-кандидата путем обеспечения условий с низким значением pH.

7. Способ по любому из пп.1-6, в котором частицы вирусов-потомков, содержащие белки HA и/или NA из вируса-помощника, отделяют от частиц вируса-кандидата путем контакта вируса-потомка с антителами, связывающими указанные белки HA и/или NA.

8. Способ по любому из пп.1-7, в котором частицы вируса-помощника содержат белок NA со сниженной активностью или в которых отсутствует функциональный белок NA.

9. Способ по любому из пп.1-8, в котором вирус-помощник содержит белок HEF вируса гриппа С.

10. Способ по п.9, в котором белок HEF вируса-помощника модифицируют для того, чтобы он был расщепляемым протеазой, где трипсин не является указанной протеазой.

11. Способ по любому из пп.1-8, в котором вирус-помощник содержит белок HA коронавируса.

12. Способ по любому из пп.1-11, в котором указанной частицей вируса является частица вируса гриппа.

13. Способ по любому из пп.1-12, в котором указанной частицей вируса является ослабленная частица вируса гриппа.

14. Способ по любому из пп.1-13, отличающийся тем, что указанный вирус содержит делецию или модификацию в гене NS1.

15. Способ по любому из пп.1-14, в котором вирус-помощник содержит модифицированный или удаленный ген NS и является дефицитным по росту в интерферон-компетентных клетках.

16. Способ по любому из пп.1-15, в котором вирус-помощник содержит по меньшей мере 4, предпочтительно по меньшей мере 5, предпочтительно по меньшей мере 6 сегментов? идентичных вирусу, который будет производиться.

17. Фрагмент полипептида HA, содержащий нижеследующую последовательность PSIQPIGLFGA (SEQ ID NO: 7).

18. Фрагмент нуклеотидной последовательности HA, содержащий последовательность CCATCCATTCAACCCATTGGTTTGTTTGGAGCC (SEQ ID NO: 9).

Текст

Смотреть все

НОВЫЙ СПОСОБ ПОЛУЧЕНИЯ РНК-ВИРУСА Изобретение обеспечивает способ получения вирусов с сегментированным негативным РНКгеномом с помощью линейных экспрессирующих конструктов в присутствии вируса-помощника.(71)(73) Заявитель и патентовладелец: АВИР ГРИН ХИЛЗ БАЙОТЕКНОЛОДЖИ РИСЕРЧ ДИВЕЛОПМЕНТ ТРЕЙД АГ (AT) Изобретение обеспечивает способ получения вирусов с сегментированным, негативным РНКгеномом с помощью линейных экспрессирующих конструктов в присутствии вируса-помощника. Предшествующий уровень техники Вирусы с негативным РНК-геномом - это группа вирусов животных, содержащая несколько важных патогенов человека, включая вирусы гриппа, кори, эпидемического паротита, бешенства, респираторносинцитиальный вирус, вирус Эбола и хантавирусы. Геномы этих РНК-вирусов могут быть мономолекулярными или сегментированными, одноцепочечными с (-) полярностью. На эти вирусы распространяются два основных требования: геномная РНК должна эффективно копироваться в вирусную РНК, форму, которая может быть использована для включения в частицы вируса-потомка; и должна транскрибироваться в мРНК, которая транслируется в вирусные белки. Эукариотические клетки-хозяева, как правило, не содержат механизм для репликации РНКматриц или для трансляции полипептидов с антисмысловой РНК матрицы. Поэтому вирусы с негативным РНК-геномом кодируют и несут РНК-зависимую РНК-полимеразу для катализа синтеза новой геномной РНК для включения в потомков и мРНК для трансляции в вирусные белки. Для передачи вируса геномная вирусная РНК должна быть упакована в вирусные частицы. Процесс, при котором собираются вирусные частицы потомства и осуществляются белок-белковые взаимодействия в течение сборки, является общим для РНК-вирусов. Образование вирусных частиц обеспечивает эффективный перенос РНК-генома от одной клетки-хозяина к другой в пределах одного организмахозяина или между различными организмами-хозяевами. Вирусные семейства, содержащие одноцепочечную РНК с негативным геномом в оболочке, разделяют на группы, имеющие несегментированные геномы (Paramyxoviridae, Rhabdoviridae, Filoviridae и вирус болезни Борна, Togaviridae) или имеющие сегментированные геномы (Orthomyxoviridae, Bunyaviridae и Arenaviridae). Семейство Orthomyxoviridae включает вирусы гриппа серотипов А, В и С, а также вирусы Тогото, Дхори и вирус инфекционной анемии лососевых. Вирионы гриппа состоят из внутреннего рибонуклеопротеинового кора (спирального нуклеокапсида), содержащего одноцепочечный РНК-геном, и внешней липопротеиновой оболочки, покрытой изнутри матриксным белком (Ml). Сегментированный геном вируса гриппа А состоит из 8 молекул линейных, одноцепочечных РНК с негативной полярностью, которые кодируют одиннадцать (некоторые штаммы гриппа А десять) полипептидов, включая: белки РНК-зависимой РНК-полимеразы (PB2, PB1 и РА), нуклеопротеин (NP) формирующий нуклеокапсид; матриксные мембранные белки (M1, M2); два поверхностных глико протеина,выступающих из липидосодержащей оболочки: гемагглютинин (HA) и нейраминидазу (NA); неструктурный белок (NS1) и белок ядерного экспорта (NEP). Большинство штаммов гриппа А кодируют также одиннадцатый белок (PB1-F2), по-видимому, обладающий проапоптотическими свойствами. Транскрипция и репликация генома происходят в ядре, а сборка происходит путем почкования на плазматической мембране. Вирусы могут перемешивать гены во время смешанных инфекций. Вирус гриппа адсорбируется с помощью HA на сиалилолигосахаридах гликопротеинов и гликолипидов клеточной мембраны. При последующем эндоцитозе вириона внутри клеточной эндосомы в молекуле HA происходят конформационные изменения, что облегчает слияние мембран, вызывая утрату вирусом оболочки. Нуклеокапсид мигрирует в ядро, где вирусная мРНК транскрибируется. Вирусная мРНК транскрибируется с помощью уникального механизма, в котором вирусная эндонуклеаза отрезает кэпированные 5'концы от клеточных гетерологичных мРНК, которые затем служат праймерами для транскрипции вирусной транскриптазой вирусных РНК-матриц. Транскрипты терминируются на участках от 15 до 22 оснований от концов их матриц, где олиго-U последовательности действуют как сигналы для добавления поли-А трактов. Из восьми производимых таким образом вирусных молекул РНК, шесть моноцистронны и транслируются непосредственно в белки HA, NA, NP и белки вирусной полимеразы, PB2, PB1 и РА. Два других транскрипта подвергаются сплайсингу, и каждый дает по две мРНК, транслирующихся с различными рамками считывания для получения M1, М 2, NS1 и NEP. Другими словами, восемь вирусных РНКсегментов кодируют одиннадцать белков: девять структурных и 2 неструктурных белка (NS1 и недавно идентифицированный PB1-F2). Создание современных вакцин против вируса гриппа, особенно против высокопатогенных вирусов птичьего гриппа, основывается на использовании обратной генетики, которая позволяет получать вирусы гриппа из ДНК. Первые обратногенетические системы для конструирования вирусов гриппа с негативным РНК-геномом предусматривают трансфекцию единичного вирусного гена, смешанного с in vitro реконструированными рибонуклеопротеиновыми (РНП) комплексами, и последующую инфекцию с хэлперным вирусом гриппа (вирусом-помощником). РНП-комплексы были созданы путем инкубации синтетических РНК-транскриптов с очищенными из вирусов гриппа белком NP и полимеразными белками(PB1, PB2 и PA), а вирус-помощник был использован в качестве внутриклеточного источника вирусных белков и других вирусных РНК (Luytjes et al., 1989, Cell, 59, 1107-1113).Neumann et al. (1994, Virology, 202, 477-479) получили РНП с вирусной модельной РНК в инфицированных гриппом клетках после экспрессии РНК с плазмиды с промотором, респонсивным к мышиной РНК полимеразе I. Pleschka et al. (1996, J. Virol., 4188-4192) описали способ, в котором РНП-комплексы были восстановлены из экспрессирующих векторов на основе плазмид. Экспрессия вирусного РНКподобного транскрипта была получена с плазмиды, содержащей укороченный промотор полимеразы I(polI) человека и рибозимную последовательность, которая образует 3'-конец с помощью автокаталитического гидролиза. PolI-зависимую плазмиду котрансфецировали в линию человеческих клеток 293 вместе с polI-респонсивными плазмидами, которые экспрессируют вирусные белки PB1, PB2, РА и NP. Однако эффективность трансфекции была очень низкой, с примерно 10 трансфектантными вирусными частицами на трансфекцию. Кроме того, эта плазмидзависимая стратегия зависела от содействия вирусапомощника. В WO 01/04333 вирусы, содержащие сегментированный негативный РНК-геном, были созданы с помощью набора из 12 экспрессирующих плазмид для экспрессии геномных сегментов вирусной РНК и РНП-белков. Вектора, описанные в WO 01/04333, базировались на широко известных плазмидах pUC19 или pUC18. В соответствии с описанием этой системе необходим набор из 8 плазмид, экспрессирующих все 8 сегментов вируса гриппа, вместе с дополнительным набором из 4 плазмид, экспрессирующих нуклеопротеин и субъединицы РНК-зависимой РНК полимеразы (PB1, PB2, РА и NP). В WO 00/60050 охватывается набор, по меньшей мере, из двух векторов, содержащих промотор,функционально связанный с кДНК сегментов вируса гриппа (РА, PB1, PB2, HA, NP, NA, М), связанных с последовательностью терминации транскрипции и, по меньшей мере, из двух векторов, содержащих промотор, функционально связанный с ДНК сегментов вируса гриппа (PA, PB1, PB2, NP). С помощью этой системы предпринималась попытка преодолеть проблемы при использовании большого числа различных векторов путем применения плазмид с восемью транскрипционными кассетами под контролем РНКполимеразы I для синтеза вирусных РНК в одной плазмиде. В WO 01/83794 раскрываются кольцевые экспрессирующие плазмиды, содержащие промотор РНКполимеразы I (polI) и сигнал терминации для polI, вставленные между промотором РНК-полимеразы II(polI) и сигналом полиаденилирования. Целевой вектор в соответствии с этой заявкой описывается как плазмида, которая обычно является самодостаточной молекулой двухцепочечной ДНК, которая может принять дополнительную чужеродную ДНК и которая может быть легко введена в подходящую клетку. В WO 2009/00891 описан линейный экспрессирующий конструкт и его применение для экспрессии сегментов с генами вируса гриппа.Ozawa M. et al (J.Virol, 2007, vol. 81, pp. 9556-9559) описывают систему обратной генетики для получения вируса гриппа А с помощью аденовирусных векторов. Hoffmann E. et al (Virology, 2000, 267, pp. 310-317) раскрывают систему для создания вируса гриппа путем образования вирусной РНК и мРНК из одной матрицы с помощью двунаправленного транскрипционного конструкта. Восстановление вируса гриппа В из восьми плазмид также раскрыто в работе Hoffmann et al. (Proc. Natl. Acad. Sci., 2002, 99, pp. 11411-11416). Вызванные вирусными заболеваниями эпидемии и пандемии по-прежнему уносят человеческие жизни и влияют на мировую экономику. Грипп ответственен за миллионы потерянных рабочих дней и за миллионы посещений врача, за сотни тысяч госпитализаций по всему миру (Couch 1993, Ann. NY. Acad.Sci 685;803,), десятки тысяч скоропостижных смертей (CollinsLehmann 1953 Public Health Monographs 213:1; Glezen 1982 Am J. Public Health 77:712) и за расходы на здравоохранение, исчисляемые в миллиардах евро (Williams et al. 1988, Ann. Intern. Med. 108:616). Если иммунизировать здоровых взрослых, то имеющиеся в настоящее время вакцины предотвращают клинические заболевания в 70-90% случаев. Этот уровень снижается до 30-70% у возрастной группы старше 65 лет и падает еще ниже у возрастной группы старше 65 лет, проживающей в домах престарелых (Strategic Perspective 2001: The Antiviral Market. Datamonitor. p. 59). Частые вирусные антигенные изменения способствуют большому общему числу погибших, т.к. даже ежегодная вакцинация не гарантирует защиты. Следовательно, в США общее число погибших возросло с 16 363 тысяч человек в 1976/77 годах до в 4 раза большего количества смертей в 1998/99 годах (Wall Street Journal, Flu-related deaths in US despite vaccine researches, January 7, 2003). Крайне важно обеспечить вакцинацию или лечение сразу после вспышки заболевания, особенно в случае вспышки пандемических вирусных заболеваний. В свете настоятельной необходимости обеспечения эффективной защиты и лечения вирусных заболеваний, также существует высокая потребность в разработке экономных, быстрых и эффективных систем экспрессии для получения вирусов, способных преодолеть недостатки и трудности существующих в настоящее время систем и обеспечить альтернативный способ для экспрессии вируса. Задача достигается обеспечением воплощений настоящей заявки. Краткое описание изобретения Настоящее изобретение обеспечивает альтернативную технологию, в которой линейные экспрессирующие конструкты применяют для экспрессии РНК-вирусов в присутствии вируса-помощника. К удивлению было обнаружено, что применение по меньшей мере одного линейного экспрессирующего конструкта без каких-либо последовательностей для амплификации и отбора, содержащего промотор РНК-полимеразы I (polI) и сигнал терминации транскрипции для polI, которые вставлены между промотором РНК-полимеразы II (pol II) и сигналом полиаденилирования, и содержащего генный сегмент HA или NA, который вставлен между polI-промотором и сигналом терминации для polI, в присутствии вируса-помощника обеспечивает эффективный инструмент для быстрого восстановления вирус-2 018564 ных частиц. В отличие от способов, примененных в известных методах, отсутствует необходимость проведения стадий клонирования в бактериальных клетках, и не требуется трансфецировать клетки-хозяева всеми сегментами вирусного генома. В частности, для экспрессии целого вируса может быть достаточно трансфекции только одним или двумя сегментами, т.е. генами, кодирующими белки HA и/или NA. Следовательно, может быть сильно сокращено время, необходимое для трансфекции и экспрессии достаточных количеств вирусных частиц. Например, линейный экспрессирующий конструкт, такой как описан в РСТ/EP2008/058182, включенной в данный документ ссылкой, может быть применен для разработки вакцин, содержащих РНКвирусы, в частности, содержащих вирусы гриппа либо дикого типа, либо мутантные или реассортантные штаммы, в присутствии вируса-помощника. Таким образом, обеспечивается инструмент для быстрого получения любой вирусной вакцины, необходимой в случае возникновения эпидемии или пандемии гриппа. Кроме того, настоящее изобретение обеспечивает улучшенный способ для удаления вирусапомощника и обеспечивает НА-сегменты с модифицированными сайтами расщепления для улучшенного отбора и очистки. Чертежи Фиг. 1a и 1b являются схематической диаграммой, иллюстрирующей образование линейных двунаправленных экспрессирующих конструктов. На фиг. 1 а показаны фрагменты F1, F2 и F3, созданные отдельно амплификацией ПЦР. На фиг. 1b показан фрагмент F4, созданный перекрывающейся ПЦР, с помощью олигонуклеотидов Р 4 и Р 6. Подробное описание изобретения Настоящее изобретение охватывает способ получения вирусов с негативным сегментированным РНК-геномом, включающий стадии:a) обеспечение линейного экспрессирующего конструкта без каких-либо последовательностей для амплификации и/или селекции, где конструкт содержит промотор РНК-полимеразы I (polI) и сигнал терминации транскрипции для polI, которые оба вставлены между промотором РНК-полимеразы II (polII) и сигналом полиаденилирования, где конструкт дополнительно содержит генный сегмент HA и/или NA,вставленный между промотором polI и сигналом терминации polI,b) трансфецирование клетки-хозяина указанным линейным экспрессирующим конструктом,c) инфицирование указанных клеток-хозяев вирусом-помощником, имеющим белки HA и/или NA вируса помощника,d) культивирование указанной клетки-хозяина для размножения вирусных частиц,e) отбор вирусных частиц, которые содержат(i) белки HA и/или NA, полученные из линейного экспрессирующего конструкта, но не(ii) белки HA и NA вируса помощника, или их сегменты, в котором указанный отбор основан на фенотипических, генотипических или антигенных свойств белков HA и/или NA, и необязательно в котором отсутствие белков HA и NA вируса помощника определяют анализом нуклеотидной или аминокислотной последовательности. Более конкретно способ получения частицы вируса с негативным, сегментированным РНК-геномом может включать стадии обеспечения линейного экспрессирующего конструкта без последовательностей для амплификации, без последовательностей для отбора, или без последовательностей для амплификации и отбора, где конструкт содержит промотор РНК-полимеразы I (polI) и промотор терминации транскрипции для polI, где polI-промотор и polI-терминатор транскрипции вставлены между промотором РНКполимеразы II и сигналом полиаденилирования, где линейный экспрессирующий конструкт дополнительно содержит генный сегмент HA, генный сегмент NA, или генные сегменты HA и NA, вставленные между промотором polI и сигналом терминации для polI; трансфецирование клетки-хозяина линейным экспрессирующим конструктом; инфицирование клетки-хозяина вирусом-помощником, где вируспомощник содержит геномную РНК, кодирующую генный сегмент HA, генный сегмент NA, или генные сегменты HA и NA, культивирование клетки-хозяина, что тем самым приводит к продуцированию частиц вирусов-потомков, где, по меньшей мере, некоторые из частиц вируса-потомка содержат белок HA или белок NA, полученный из линейного экспрессирующего конструкта; и отбор частицы вирусакандидата среди частиц вирусов-потомков, где частица вируса-кандидата содержит:i) белок HA, полученный из линейного экспрессирующего конструкта, а не белок HA, полученный из вируса-помощника, если линейный экспрессирующий конструкт содержит генный сегмент HA; иii) белок NA, полученный из линейного экспрессирующего конструкта, а не белок NA, полученный из вируса-помощника, если линейный экспрессирующий конструкт содержит генный сегмент NA. В соответствии с изобретением клетку-хозяин трансфецируют, по меньшей мере, одним линейным экспрессирующим конструктом, содержащим генный сегмент HA или NA. Предпочтительно клеткухозяин трансфецируют, по меньшей мере, двумя линейными экспрессирующими конструктами, где один линейный экспрессирующий конструкт содержит генный сегмент HA, а второй линейный экспрессирующий конструкт содержит генный сегмент NA. Стадия отбора частицы вируса-кандидата может дополнительно содержать анализ аминокислотных последовательностей частицы вируса-кандидата в целях определения того, что частица вируса-кандидата не содержит аминокислотные последовательности HA или аминокислотные последовательности NA вируса-помощника или может дополнительно содержать анализ молекул нуклеиновой кислоты частицы вируса-кандидата в целях определения того, что частица вируса-кандидата не содержит нуклеотидные последовательности HA или нуклеотидные последовательности NA вируса-помощника. В соответствии с изобретением "линейные экспрессирующие конструкты" определены как свободные от любых последовательностей для амплификации и/или отбора, содержащие промотор РНКполимеразы I (polI) и сигнал терминации для polI, которые вставлены между промотором РНКполимеразы II (polII) и сигналом полиаденилирования и которые содержат генный сегмент, вставленный между промотором polI и сигналом терминации для polI. Линейные экспрессирующие конструкты не содержат каких-либо последовательностей для отбора или амплификации, необходимых для амплификации плазмид в бактериальных клетках. Не требуется наличие ни последовательности ori (точки начала репликации), ни генов устойчивости к антибиотикам или ни генов любых других селекционных маркеров. При необходимости линейный экспрессирующий конструкт может быть циркуляризован с помощью коротких линкерных последовательностей. В соответствии с конкретным воплощением изобретения линейный экспрессирующий конструкт может содержать отличные от молекул ДНК молекулы, такие как дополнительные защитные последовательности на N- и/или С-концах конструкта. Например, защитные последовательности могут быть последовательностями пептиднуклеиновой кислоты (ПНК), как описано в WO 00/56914. Эти ПНК являются аналогами нуклеиновой кислоты, в которых внутренний деоксирибозидфосфатный каркас заменен на химически полностью отличный, но структурно гомологичный полиамидный (пептидный) каркас, содержащий 2-аминоэтилглициновые звенья. Было показано, что "фиксаторы" из ПНК повышают стабильность, когда две идентичные ПНК-последовательности соединены гибким линкером-"шпилькой", содержащим три звена из 8-амино-3,6-диоксаоктановой кислоты. Если ПНК смешать с целевыми комплементарными гомопуриновыми или гомопиримидиновыми последовательностями ДНК, то может образоваться чрезвычайно стабильный ПНК-ДНК-ПНК триплексный гибрид (Bentin et al, 1996, Biochemistry, 35,8863-8869, Egholm et al., 1995, Nucleic Acids Res., 23, 217-222, Nielsen et al., Science, 1991 , 254, 14971500, Demidov et al., Proc.Natl.Acad.Sci., 1995, 92, 2637- 2641). Было показано, что они устойчивы к нуклеазному и протеазному гидролизу (Demidov et al., Biochem.Pharm., 1994, 48, 1010-1013). Вирусный генный сегмент может быть кДНК-копией или продуктом амплификации ОТ-ПЦР указанного сегмента. В частности, настоящее изобретение обеспечивает способ экспрессии и производства РНК-вируса,который включает стадии a) трансфекции клеток-хозяев линейным экспрессирующим конструктом, содержащим генный сегмент HA и/или линейным экспрессирующим конструктом, содержащим генный сегмент NA и необязательно линейными экспрессирующими конструктами, содержащими дополнительные генные сегменты или, по меньшей мере, их часть, выбранные из PB1, PB2, PA, NS, M, NP,b) инфицирование указанных клеток-хозяев вирусом помощником;d) отбор вирусных частиц содержащих, по меньшей мере, белки HA и/или NA, полученные из указанных линейных экспрессирующих конструктов. Указанный отбор может быть осуществлен на основе генотипических, фенотипических или антигенных свойств белков HA или NA, происходящих из вируса, который не является помощником. Могут быть применены любые способы отбора, которые известны для различения белков, содержащих различные последовательности, имеющих различные фенотипические или антигенные характеристики. В частности, могут быть применены критерии отбора, которые описаны в настоящем изобретении. Белки HA иNA из вируса-помощника и из вируса, не являющегося помощником, отличаются по нуклеотидной и аминокислотной последовательности, следовательно, способы сравнения последовательностей, которые хорошо известные в данной области, могут быть применены для идентификации вирусов, содержащих последовательности HA или NA, полученные из линейных экспрессирующих конструктов. Молекулы нуклеиновой кислоты, которые являются "полученными из" экспрессирующего конструкта или вируса являются теми, которые содержат нуклеотидную последовательность экспрессирующего конструкта или вируса или комплементарной последовательности, и, как правило, продуцируются в результате наличия экспрессирующего конструкта или вируса в клеточной культуре или другой среде для получения молекул. Белки, которые являются "полученными из" экспрессирующего конструкта или вируса являются белками, которые транслированы из нуклеотидной последовательности экспрессирующего конструкта или вируса или комплементарной последовательности, и, как правило, продуцируются в результате наличия экспрессирующего конструкта или вируса в клеточной культуре или другой среде для получения белков. Дополнительно к применению, по меньшей мере, одного линейного экспрессирующего конструкта,для экспрессии вирусных белков и/или дополнительных сегментов вирусного генома могут быть применены плазмиды, известные в данной области для осуществления методов обратной генетики. Такие плазмиды, например, описаны в работе Hoffmann et al. (Vaccine 2002, 20(25-26), 3165-3170, которая включена в настоящий документ ссылкой). Конкретно, такие экспрессирующие плазмиды содержат сег-4 018564 менты, кодирующие PB1, PB2, PA, NS, NA, HA, М или NP или их части. Термин "белок HA и белок NA" определены в соответствии с настоящим изобретением как полная аминокислотная последовательность белка HA или NA соответственно, или как часть указанной последовательности, где указанная часть является существенной для индукции иммунного ответа против указанного белка HA или NA похожего или равного ответу, продуцируемому белком HA или NA дикого типа. Предпочтительно, если белок HA или NA содержит по меньшей мере 70% аминокислотной последовательности HA или NA полного белка, предпочтительно по меньшей мере 90%, более предпочтительно по меньшей мере 95%. Функциональный эквивалент по показателю иммуногенности может быть проверен, например, в моделях на животных, как описано в работе Lu et al. (J. Virol., 1999, 5903-5911) или Boyd M. R. andBeeson M. F. (J. Antimicrobial Chemotherapy, 1975, 43-47). Вирусом-помощником является вирус, применяемый для продуцирования копий зависящего от помощника вирусного вектора, который не обладает способностью реплицироваться самостоятельно. Вирус-помощник применяется для совместной инфекции вместе с вирусным вектором, и он обеспечивает необходимые ферменты для репликации генома вирусного вектора. Термин "вирус-помощник" определяют как любой вирус, который содержит, по меньшей мере,один генный сегмент идентичный вирусу, который будет продуцироваться, и который может поддержать образование вируса путем обеспечения, по меньшей мере, одного вирусного сегмента и/или, по меньшей мере, одного вирусного белка, необходимого для продуцирования целых вирусных частиц. Вирус-помощник в настоящем способе, как правило, добавляют к клеткам-хозяевам после трансфекции линейными экспрессирующими конструктами, но в соответствии с альтернативным способом,вирус-помощник может быть добавлен к клеткам-хозяевам для инфекции перед трансфекцией клетокхозяев экспрессирующим конструктом, содержащим генные сегменты HA и/или NA. РНК-вирусы, которые могут экспрессироваться указанным способом, могут быть любым РНКвирусом, содержащим генные сегменты HA и/или NA, или структуры, функционально эквивалентные этим структурам. Термин "функционально эквивалентные структуры" означает вирусные белки, которые обладают рецепторсвязывающей активностью и активностью слияния. РНК-вирусы могут быть выбраны из группы, состоящей из вирусов гриппа, в частности, из вирусов гриппа A, B или C, коронавируса, респираторно-синцитиального вируса, вируса болезни Ньюкастла. Клетки, которые могут быть применены в способе по изобретению для культивирования вирусов,могут быть любым требуемым типом клеток, которые можно культивировать и которые можно инфицировать покрытыми оболочкой вирусами, в частности вирусами гриппа. В частности, это могут быть клетки BSC-1, LLC-MK, CV- 1, CHO, COS, мышиные клетки, человеческие клетки, клетки HeLa, 293,VERO, MDBK, MDCK, CEK (клетки почек куриных эмбрионов), CEF (куриные эмбриональные фибробласты), MDOK, CRFK, RAF, TCMK, LLC-PK, PK15, WI-38, MRC-5, T-FLY, BHK, SP2/0, NSO, PerC6 (человеческие клетки сетчатки). В соответствии со способом изобретения клетки-хозяева могут быть транфецированы известными способами, например, электропорацией. Культуру клеток-хозяев можно культивировать в стандартных условиях, известных в данной области для репликации вирусов, в частности, до обнаружения максимального цитопатического эффекта, или максимального количества вирусного антигена. В ином случае сбор может быть проведен в любой временной точке в ходе культивирования.pH для культивирования клеток-хозяев, может, например, находиться в диапазоне от 6,5 до 7,5. pH для культивирования зависит от pH-стабильности клеток-хозяев, использованных для культивирования. Значение может быть определено тестированием жизнеспособности клеток-хозяев в условиях с различным pH. В данной области хорошо известно, что вирусы дикого типа, используемые при получении вакцинных штаммов для ежегодной вакцинации против эпидемического гриппа, рекомендуются ежегодно Всемирной Организацией Здравоохранения (ВОЗ). Эти штаммы могут быть затем применены для получения реассортантных вирусных штаммов, которые, как правило, объединяют гены NA и/или HA вирусов дикого типа, с остальными генными сегментами, полученными из донорного вируса (часто называемого исходный донорный вирус или MDV (master donor virus, который обладает некоторыми требуемыми характеристиками. Например, MDV-штамм может быть холодоадаптированным и/или температурочувствительным, и/или ослабленным и/или обладать высокой скоростью роста. В соответствии с настоящим изобретением, вирусные частицы предпочтительно содержат белки HA и/или NA вирусных штаммов,рекомендованных для целей сезонной вакцинации или вирусных штаммов, которые показали себя как высокоиммуногенные, в частности в случае пандемических вирусов. Отбор вирусов, содержащих указанные поверхностные белки, может быть осуществлен на основе генотипических, фенотипических или антигенных свойств, которые отличают указанные белки от белковHA и NA из вируса-помощника. Фенотипические свойства белков HA и NA из вируса-помощника отличают указанные белки от белков HA и NA из вируса, не являющегося помощником, так, например, выбранный вирус содержит отличия в сайте расщепления для активации или отличается по стабильности при низком pH. HA вируса помощника может содержать сайт расщепления, который зависит от протеолитической активации протеазой, отличной от протеазы, активирующей HA в вакцинном вирусе. Вирус-помощник в условиях с низким значением pH также может демонстрировать более низкую, чем вакцинный вирус, стабильность. Отбор вирусов, содержащих HA и NA вакцинного вируса, может также быть основан на антигенных свойствах. При использовании вируса-помощника (например, H3N2) подтипа отличного от вакцинного вируса (например, H1N1) рост вируса-помощника может быть замедлен антисывороткой, специфичной к подтипу вируса-помощника, например, H3N2. Генотипические характеристики, которые могут быть использованы для отбора, включают различия в нуклеотидной или аминокислотной последовательности между HA и/или NA сегментами из вирусапомощника и белками HA и NA не из вируса-помощника. Способы для проведения анализа последовательности хорошо известны в данной области. На основании отличий по нуклеотидной последовательности, например, могут быть сконструированы siRNA и антисмысловые олигонуклеотиды конкретно для HA и/или NA вируса-помощника. Рост вируса помощника может быть подавлен трансфекцией этих siRNA или антисмысловых олигонуклеотидов. Один вариант может заключаться в том, что вирусные частицы, содержащие белки HA из вирусапомощника, отделяют от частиц вируса-кандидата обработкой протеазами, которые не расщепляют белок HA из вируса-помощника, но расщепляют и посредством этого активируют белок HA вирусареассортанта. Например, протеаза может быть выбрана из группы, состоящей из трипсина, эластазы, химотрипсина, папаина или термолизина. Например, белок HA вируса-помощника может быть модифицирован так, чтобы быть активированным, например, расщеплением, протеазой, где указанная протеаза не является трипсином и где белок HA конечного вакцинного вируса расщепляется трипсином. Таким образом, обеспечивается простая и действующая система отбора. Ее можно осуществить путем модификации сайта расщепления. Сегмент HA вирусного штамма, полезного в качестве вируса-помощника, может быть изменен мутагенезом, таким как ПЦР-мутагенез, для того чтобы содержать сайт расщепления, который является протеолитически активируемым эластазой вместо трипсина. Например, аминокислотная последовательность окружающая сайт расщепления может быть PSIQPI/GLFGA (сайт расщепления указан с помощью). Для минимизации событий нежелательной реверсии, кодоны выбираются таким образом, чтобы для вызова реверсии назад к исходной аминокислоте были предпочтительно необходимы, по меньшей мере,два нуклеотидных изменения на кодон. В ином случае, вирусные частицы, содержащие белки HA и NA из вируса-помощника могут быть отделены от частиц вируса-кандидата, содержащих белки NA или HA, которые экспрессируются линейными конструктами, путем обеспечения условий с низким значением pH. Вирусные частицы, культивируемые в клеточной культуре несколько пассажей, в частности, в культуре клеток Vero, демонстрируют пониженную стабильность при низком значении pH из-за модификаций в белках HA по сравнению со штаммами из клинических изолятов, содержащих белки HA и/или NA дикого типа. Таким образом, обработка вируса-помощника в условиях с низким значением pH, т.е. между 5,2 и 6,2 приводит к снижению скорости размножения вируса-помощника и, следовательно, к отбору частиц вируса-кандидата, содержащих немодифицированные белки HA и/или NA. В качестве дополнительного альтернативного воплощения изобретения вирусные частицы, содержащие белки HA и/или NA из вируса-помощника отделяют от частиц вируса-кандидата обработкой антисывороткой, содержащей антитела, нейтрализующие или связывающие указанные белки HA и/или NA из вируса-помощника. Также в соответствии с изобретением может быть осуществлена комбинация различных способов удаления нежелательных белков HA и NA. В соответствии с конкретным воплощением изобретения, частицы вируса-помощника могут содержать белок NA с пониженной активностью по сравнению с белком NA вируса дикого типа. В этом воплощении вирус-помощник может потерять функциональный белок NA, т.е. белок NA, который позволяет вирусу высвободиться из клетки-хозяина, или может полностью потерять белок NA. В соответствии с дополнительным альтернативным воплощением, вирус-помощник содержит белокHEF вируса гриппа С. Вирус гриппа С имеет только один основной поверхностный гликопротеин, HEF(hemagglutinin esterase fusion), который является функциональным эквивалентом белку HA. Белок HEF может быть активирован, например, трипсином или ТРСК-трипсином, как описано в работе Gao et al.(J.Virol., 2008, 6419-6426), которая включена в данный документ ссылкой. В ином случае, настоящим изобретением конкретно заявляются модифицированные вирусы гриппа,содержащие вирусный гликопротеин HEF, который может быть модифицирован путем введения сайта расщепления для инородной протеазы, например, путем введения сайта расщепления для эластазы. В качестве дополнительного альтернативного воплощения изобретения вирусные частицы, содержащие белок HEF из вируса-помощника, удаляют обработкой антителами, нейтрализующими или связывающими указанный белок HEF. В качестве еще одной альтернативы вирус-помощник может содержать белок HA коронавируса. В случае получения вируса гриппа А, в качестве альтернативы могут быть применены белки HA и/или NA,происходящие из вируса гриппа В. Вирус для производства вакцин, а также вирус-помощник, в частности, могут происходить из вируса гриппа, более конкретно вирус может быть ослабленным вирусом гриппа. В соответствии с конкретным воплощением, вирусом гриппа является ослабленный вирус гриппа. В частности, вирус гриппа содержит делеции или модификации в факторах патогенности, которые ингибируют врожденный иммунный ответ клеток-хозяев. Ослабление, например, может быть получено из холодоадаптированных вирусных штаммов или в результате удаления или модификации в пределах гена NS1(NS1-вирус) как описано в WO 99/64571 и WO 99/64068, которые включены в данный документ полностью ссылкой. "Модификация" относится к замене или делеции одной или нескольких нуклеиновых кислот по сравнению с последовательностью NS1 дикого типа. Модификация в пределах гена NS может приводить к появлению вирусных частиц, которые являются дефицитными по росту в интерферонкомпетентных клетках. Дефицитные по росту означает, что эти вирусы являются репликативнонекомпетентными, поскольку они подвергаются абортивной репликации в дыхательном пути животных. В ином случае, вирусы могут содержать делецию или модификацию гена PB1-F2. Способ по изобретению может быть конкретно применен для получения вируса гриппа, содержащего делецию функционального белка NS1. В соответствии с изобретением вирус-помощник может содержать по меньшей мере 4, по меньшей мере 5, предпочтительно 6 сегментов, идентичных вирусу который будет производиться. В частности,этими сегментами являются PB1, PB2, PA, NP, M, NS. Вирус-помощник может быть получен известными способами обратной генетики или альтернативными методами, такими как вирусная реассортация. Термин "реассортант", когда речь идет о вирусе, указывает на то, что вирус включает генетические и/или полипептидные компоненты, полученные из более чем одного родительского вирусного штамма или источника. Например, реассортант 7:1 включает 7 вирусных геномных сегментов (или генных сегментов), полученных из первого родительского вируса, и один комплементарный вирусный геномный сегмент, например, кодирующий гемагглютинин или нейраминидазу, из второго родительского вируса. Реассортант 6:2 включает 6 геномных сегментов, чаще всего 6 внутренних генов из первого родительского вируса, и два комплементарных сегмента, например, с гемагглютинином и нейраминидазой, из другого родительского вируса. Способ получения вируса-помощника, содержащего делеции в NS1, был описан Egorov et al. (1998J. Virol. 1998 Aug; 72(8):6437-41; Egorov et al., Vopr. Virusol., 39:201 -205). Таким образом, в качестве основного вируса был применен вирус гриппа А, содержащий температурочувствительную мутацию в генеNS, который был дополнительно модифицирован для полного удаления гена NS, так, чтобы вирус мог расти только в дефицитных по интерферону клетках. Настоящее изобретение также охватывают полипептид HA, содержащий последовательностьPSIQPIGLFGA (SEQ ID. NO. 7). Также настоящим изобретением покрывается нуклеотидная последовательность HA, содержащая представленную ниже последовательность или ее часть: В частности, в настоящее изобретение включен нуклеотид HA, содержащий представленную ниже последовательность: Примеры Пример 1. Получение линейного экспрессирующего конструкта с HA из H3N2. НА-сегмент вируса гриппа A H3N2, полученного из культуры клеток Vero, амплифицировали с помощью олигонуклеотидов P1 и P2 (F1 на фиг. 1 а). Затем с помощью перекрывающейся ПЦР с HA ПЦРпродуктом были слиты два фрагмента ДНК (F2 и F3 на фиг. 1), полученные из pHW2000 (Hoffmann et al. 2000, Proc Natl Acad Sci U S A. 97:6108-13) (см. фиг. 1b). Первый линейный фрагмент (F2) содержитCMV-промотор и PolI-терминатор, второй фрагмент (F3) содержит человеческий PolI-промотор и сигнал полиаденилирования БГР. Для облегчения получения перекрывающихся ПЦР-продуктов, олигонуклеотиды, примененные для амплификации HA, были удлинены на 5' концах, в том смысле, что Р 1 содержит последовательность, комплементарную PolI-терминатору, а Р 2 содержит последовательность, комплементарную PolI-промотору (см. фиг. 1 а). Подобным образом, праймеры Р 3 и Р 5, использованные для получения фрагментов F1 и F2, были удлинены на их 5' концах так, чтобы они содержали последовательности комплементарные 5' и 3' концам HA (см. фиг. 1 а). Фрагменты F2 и F3 содержат защитные последовательности, полученные из последовательности каркаса pHW2000. Эти последовательности не вовлечены прямо в транскрипцию мРНК и вирусной РНК,но уменьшают деградацию двунаправленной экспрессирующей кассеты экзонуклеазами. Вирусную РНК экстрагировали из вируса гриппа A H3N2, полученного из культуры клеток Vero с помощью набора "Qiagen ViralAmp" и обратно транскрибировали с помощью олигонуклеотида Uni12 как описано ранее (Hoffmann et al. 2001, Arch Virol. 146:2275-89). НА-сегмент амплифицировали с помощью представленных в таблице 1 олигонуклеотидов смесью ДНК полимераз Pfu Turbo и Taq: Таблица 1 Нуклеотиды, соответствующие последовательности H3 выделены жирным курсивом, нуклеотиды гомологичные PolI-терминатору (Р 1) и PolI-промотору (Р 2) показаны стандартными заглавными буква-8 018564 ми. ПЦР-продукт HA F4 очищали с помощью набора для очистки продуктов ПЦР "Qiaquick" (Qiagen). ПЦР-фрагменты F2 и F3 амплифицировали из ДНК плазмиды pHW2000 парами праймеров Р 3+Р 4 и Р 5+Р 6 (см. таблицу 2 и фиг. 1 а), соответственно, с помощью смеси ДНК-полимераз Pfu Turbo и Taq. Продукты ПЦР F2 и F3 очищали с помощью набора для очистки продуктов ПЦР "Qiaquick" (Qiagen). Таблица 2 В Р 3 и Р 5 нуклеотиды, соответствующие последовательности H3, показаны жирным курсивом, а нуклеотиды, комплементарные pHW2000, показаны стандартными заглавными буквами. В Р 4 и Р 6 все нуклеотиды, за исключением четырх нуклеотидов на 5' концах, соответствуютpHW2000. Для получения полноразмерного ПЦР-продукта (F4), содержащего HA, CMV промотор, PolIтерминатор, PolI-промотор и сигнал полиаденилирования БГР, фрагменты F1, F2 и F3 сшивали и амплифицировали перекрывающейся ПЦР с помощью праймеров Р 4 и Р 6 и смеси ДНК полимераз Pfu Turbo иTaq. На фиг. 1 представлена схематическая диаграмма получения линейных двунаправленных экспрессирующих конструктов. На фиг. 1 а) схематически показаны фрагменты F1, F2 и F3, полученные отдельно амплификацией ПЦР. Фрагмент F1 содержит соответствующий вирусный сегмент и удлиняющие сегменты, комплементарные PolI-промотору и PolI-терминатору. Фрагмент F2 содержит CMV-промотор и polI-терминатор, а также удлиняющий сегмент, комплементарный соответствующему вирусному сегменту. Фрагмент F3 содержит polI-промотор и сигнал полиаденилирования БГР, а также удлиняющий сегмент, комплементарный соответствующему вирусному сегменту. Олигонуклеотиды P1 и P2, использованные для амплификации с помощью ПЦР фрагментов F1, являются комплементарными соответствующему вирусному сегменту. Р 1 на 5'-конце содержит удлиняющий сегмент, комплементарный PolI-терминатору, Р 2 на 5'конце содержит удлиняющий сегмент, комплементарный PolI-промотору. Для амплификации ПЦР фрагментов F2 использовали олигонуклеотиды P3 и Р 4, при этом P3 содержит на 5' конце удлиняющий сегмент, комплементарный соответствующему вирусному сегменту. Для амплификации ПЦР фрагмента F3 использовали олигонуклеотиды Р 5 и Р 6, при этом Р 5 содержит на 5' конце удлиняющий сегмент, комплементарный соответствующему вирусному сегменту. Защитные последовательности получены из каркаса pHW2000 и не содержат последовательностей прямо вовлеченных в транскрипцию мРНК или вирусной РНК. Пример 2. Получение зависимого от эластазы вируса-помощника. Сегмент HA штамма вируса гриппа A/New Caledonia/20/99-like (H1N1) изменяли ПЦР-мутагенезом для того, чтобы он содержал сайт расщепления, который протеолитически активируется эластазой, а не трипсином. Аминокислотная последовательность, окружающая сайт расщепления изменяется сPSIQSR/GLFGA на PSIQPI/GLFGA (сайт расщепления указан с помощью). Аналогично примеру 1, 10-20 мкг линейного двунаправленного экспрессирующего конструкта F4 получали ПЦР и очищали набором"Qiaquick kit" (Qiagen), а затем с помощью набора "Qiagen Endofree Plasmid kit". Клетки Vero культивировали при 37C и в атмосфере с 5% CO2 в среде DMEM/F12, содержащей 10% фетальной телячьей сыворотки и 1% добавки "Glutamax-I". Для получения вирусов при трансфекции в клетки Vero применяли модифицированный F4 HA ДНК-фрагмент либо отдельно, либо вместе с четырьмя белокэкспрессирующими плазмидами, кодирующими белки PB1, PB2, РА и NP. Через 24 ч после трансфекции клетки инфицировали с MOI от 0,001 до 1 штаммом вируса гриппа A IVR-116, который не экспрессирует функциональный NS1 (IVR-116-delNS1). После инфекции, для поддержки репликации вируса, клетки Vero культивировали в бессывороточной среде (Opti-Pro; Invitrogen) в присутствии эластазы в концентрации 5 мкг/мл. При наблюдении 50100% ЦПЭ высвобожденный зависимый от эластазы вирус IVR-116-delNS1(IVR-116-delNS1-EL) замораживали или очищали из бляшек на клетках Vero. Пример 3. Получение реассортантного вируса гриппа A H3N2 с помощью зависимого от эластазы вируса-помощника H1N1. Линейные двунаправленные экспрессирующие конструкты (F4) для сегментов HA и NA вирусаA/Bhsbane/10/2007(H3N2)-like получали ПЦР как описано в примере 1. После очистки, как описано в примере 2, HA и NA F4 ПЦР-продукты применяли для трансфекции клеток Vero отдельно или вместе с четырьмя белокэкспрессирующими плазмидами, кодирующими PB1, PB2, РА и NP. Через 24 ч после трансфекции клетки инфицировали с MOI от 0,001 до 1 вирусом гриппа A IVR-116-delNS1-EL (вируспомощник). После инфекции клетки инкубировали в бессывороточной среде (Opti-Pro; Invitrogen) в присутствии 5 мкг/мл трипсина. Вирус собирали при наблюдении 10-100% ЦПЭ. Отборочный пассаж осу-9 018564 ществляли обработкой вирусного сбора в течение 24 ч при 4C соответствующими концентрациями (например, 10% об./об.) антисыворотки (предварительно обработанной нейраминидазой из Vibrio cholerae) или очищенным препаратом IgG специфичным к HA и NA из A/New Caledonia/20/99 для нейтрализации вируса-помощника. Затем клетки Vero в течение 30 мин при комнатной температуре инкубировали с предварительно обработанным вирусом, отмывали PBS, а затем инкубировали при 37C в бессывороточной среде, содержащей 5 мкг/мл трипсина. Необязательно, к культуральной среде может быть добавлен очищенный IgG специфичный к HA и NA из A/Wisconsin/67/05. Вирус собирали и осуществляли второй селективный пассаж, как только наблюдали 10-100% ЦПЭ. После развития ЦПЭ вирус замораживали или очищали из бляшек. Пример 4. Получение реассортантного вируса гриппа A H3N2 с помощью зависимого от эластазы вируса-помощника H1N1 в сочетании с обработкой низким значением pH. Линейные двунаправленные экспрессирующие конструкты (F4) для сегментов HA и NA вирусаA/Bhsbane/10/2007(H3N2)-like получали ПНР как описано в примере 1. После очистки, как описано в примере 2, HA и NA F4 ПЦР-продукты применяли для трансфекции клеток Vero отдельно или вместе с четырьмя белокэкспрессирующими плазмидами, кодирующими PB1, PB2, РА и NP. Через 24 ч после трансфекции клетки инфицировали с MOI от 0,001 до 1 вирусом гриппа A IVR-116-delNS I-EL (вируспомощник). После инфекции клетки инкубировали в бессывороточной среде (Opti-Pro; Invitrogen) в присутствии 5 мкг/мл трипсина. Вирус собирали при наблюдении 10-100% ЦПЭ. Вирусный сбор затем разводили 1:1 буфером, содержащим 150 мМ NaCl и 50 мМ MES pH 5,4-6,2 и инкубировали в течение 30 мин при 37C для предпочтительной инактивации белка HA вируса-помощника. После нейтрализацииpH для нейтрализации вируса-помощника может быть осуществлен отборочный пассаж путем инкубации вирусного сбора в течение 24 ч при 4C с соответствующими концентрациями (например, 10% об./об.) антисыворотки (предварительно обработанной нейрамидиназой из Vibrio cholerae) или с очищенным препаратом IgG специфичным к HA и NA A/New Caledonia/20/99. Клетки Vero затем инкубировали в течение 30 мин при комнатной температуре с предварительно обработанным вирусом, отмывалиPBS, после чего инкубировали при 37C в бессывороточной среде, содержащей 5 мкг/мл трипсина. Необязательно, к культуральной среде может быть добавлен очищенный IgG, специфичный к HA иNA из A/Wisconsin/67/05. Вирус собирали и осуществляли второй селективный пассаж, как только наблюдали 10-100% ЦПЭ. После развития ЦПЭ вирус замораживали или очищали от бляшек. Пример 5. Получение реассортантного вируса гриппа A H1N1 с помощью зависимого от эластазы вируса-помощника H3N2. Линейные двунаправленные экспрессирующие конструкты (F4) для сегментов HA и NA вирусаA/New Caledonia/20/99 (H1N1)-like получали ПЦР как описано в примере 1. После очистки, как описано в примере 2, HA и NA F4 ПЦР-продукты применяли для трансфекции клеток Vero отдельно или вместе с четырьмя белокэкспрессирующими плазмидами кодирующими PB1, PB2, РА и NP. Через 24 ч после трансфекции клетки инфицировали с MOI от 0,001 до 1 зависимым от эластазы вирусом гриппаA/Wisconsin/67/05 (H3N2)-like (вирус-помощник). После инфекции клетки инкубировали в бессывороточной среде (Opti-Pro; Invitrogen) в присутствии 5 мкг/мл трипсина. Вирус собирали при наблюдении 10-100% ЦПЭ. Отборочный пассаж осуществляли обработкой вирусного сбора в течение 24 ч при 4C соответствующими концентрациями (например, 10% об./об.) антисыворотки (предварительно обработанной нейрамидиназой из Vibrio cholerae) или очищенным препаратом IgG специфичным к HA и NAA/Wisconsin/67/05 для нейтрализации вируса-помощника. Клетки Vero затем инкубировали в течение 30 мин при комнатной температуре с предварительно обработанным вирусом, отмывали PBS и затем инкубировали при 37C в бессывороточной среде, содержащей 5 мкг/мл трипсина. Необязательно, к культуральной среде может быть добавлен очищенный IgG, специфичный к A/Wisconsin/67/05 HA и NA. Вирус собирали и осуществляли второй отборочный пассаж при наблюдении 10-100% ЦПЭ. После развития ЦПЭ вирус замораживали или очищали из бляшек. ФОРМУЛА ИЗОБРЕТЕНИЯ 1. Способ получения вирусов с негативным сегментированным РНК-геномом, включающий стадии:a) обеспечения линейного экспрессирующего конструкта, который не содержит каких-либо последовательностей для амплификации и/или отбора, и который содержит промотор РНК-полимеразы I (polI) и сигнал терминации транскрипции для polI, которые оба вставлены между промотором РНКполимеразы II (polII) и сигналом полиаденилирования, и который дополнительно содержит HA- и/илиNA-генный сегмент, вставленный между polI-промотором и сигналом терминации для polI,b) трансфецирования клетки-хозяина указанным линейным экспрессирующим конструктом,c) инфицирования указанных клеток-хозяев вирусом-помощником, имеющим белки вируса помощника HA и/или NA,d) культивирования указанной клетки-хозяина для размножения вирусных частиц,e) отбора вирусных частиц, которые содержат:(i) белки HA и/или NA, полученные из линейного экспрессирующего конструкта, но не(ii) белки HA и NA вируса-помощника или их сегменты, где указанный отбор основан на фенотипических, генотипических или антигенных свойствах белков HA и/или NA, и необязательноf) где отсутствие белков HA и NA вируса-помощника определяют анализом нуклеотидной или аминокислотной последовательности. 2. Способ по п.1, в котором клетку-хозяин трансфецируют линейными конструктами, которые кодируют белки, выбранные из группы, состоящей из PB1, PB2, PA, NS, М и NP. 3. Способ по любому из пп.1 или 2, в котором частицы вирусов-потомков, содержащие белок HA,полученный из вируса-помощника, отделяют от частиц вируса-кандидата обработкой частиц вирусовпотомков протеазой, и в котором протеаза не расщепляет белок HA, полученный из вируса-помощника,но расщепляет белок HA частиц вируса-кандидата. 4. Способ по любому из пп.1-3, в котором протеазу выбирают из группы, состоящей из трипсина,эластазы, химотрипсина, папаина. 5. Способ по п.1 или 2, в котором белок HA вируса-помощника модифицируют для того, чтобы он был расщепляемым протеазой, где трипсин не является указанной протеазой. 6. Способ по п.1 или 3, в котором частицы вирусов-потомков, содержащие белки HA и NA из вируса-помощника, отделяют от частиц вируса-кандидата путем обеспечения условий с низким значениемpH. 7. Способ по любому из пп.1-6, в котором частицы вирусов-потомков, содержащие белки HA и/илиNA из вируса-помощника, отделяют от частиц вируса-кандидата путем контакта вируса-потомка с антителами, связывающими указанные белки HA и/или NA. 8. Способ по любому из пп.1-7, в котором частицы вируса-помощника содержат белок NA со сниженной активностью или в которых отсутствует функциональный белок NA. 9. Способ по любому из пп.1-8, в котором вирус-помощник содержит белок HEF вируса гриппа С. 10. Способ по п.9, в котором белок HEF вируса-помощника модифицируют для того, чтобы он был расщепляемым протеазой, где трипсин не является указанной протеазой. 11. Способ по любому из пп.1-8, в котором вирус-помощник содержит белок HA коронавируса. 12. Способ по любому из пп.1-11, в котором указанной частицей вируса является частица вируса гриппа. 13. Способ по любому из пп.1-12, в котором указанной частицей вируса является ослабленная частица вируса гриппа. 14. Способ по любому из пп.1-13, отличающийся тем, что указанный вирус содержит делецию или модификацию в гене NS1. 15. Способ по любому из пп.1-14, в котором вирус-помощник содержит модифицированный или удаленный ген NS и является дефицитным по росту в интерферон-компетентных клетках. 16. Способ по любому из пп.1-15, в котором вирус-помощник содержит по меньшей мере 4, предпочтительно по меньшей мере 5, предпочтительно по меньшей мере 6 сегментов, идентичных вирусу,который будет производиться. 17. Фрагмент полипептида HA, содержащий нижеследующую последовательность PSIQPIGLFGA(SEQ ID NO: 7). 18. Фрагмент нуклеотидной последовательности HA, содержащий последовательность CCATCCATTCAACCCATTGGTTTGTTTGGAGCC (SEQ ID NO: 9).

МПК / Метки

МПК: C12N 15/86, C12N 15/09, C07K 14/11, C12N 7/02

Метки: получения, способ, новый, рнк-вируса

Код ссылки

<a href="http://easpatents.com/14-18564-novyjj-sposob-polucheniya-rnk-virusa.html" rel="bookmark" title="База патентов Евразийского Союза">Новый способ получения рнк-вируса</a>

Похожие патенты