Набор анти-вич- олигонуклеотидов и способ их применения для профилактики и лечения синдрома приобретенного иммунодефицита

Номер патента: 9290

Опубликовано: 28.12.2007

Авторы: Зуо Коньлин, Ли Юеюань, Жу Живен, Фень Юся

Есть еще 2 страницы.

Смотреть все страницы или скачать PDF файл.

Формула / Реферат

1. Набор последовательностей РНК или любого фрагмента таких последовательностей, демонстрирующих анти-ВИЧ активность и используемых для профилактики и лечения СПИДа, отличающихся тем, что нуклеотиды включают одноцепочечную РНК, любой фрагмент, полученный из данных последовательностей, или двухцепочечную РНК, полученную отжигом последовательностей с комплементарными им последовательностями, при этом последовательности представляют собой:

Рисунок 1

2. Последовательности РНК или их фрагменты по п.1, отличающиеся тем, что они являются модифицированными по 5'- или 3'-концам добавлением нуклеотидов с анти-ВИЧ активностью или используемыми для профилактики и лечения ВИЧ-инфекции.

3. Набор последовательностей РНК, демонстрирующих анти-ВИЧ активность или используемых для профилактики и лечения СПИДа, отличающихся наличием шпилькообразной РНК, состоящей из РНК по п.1 и комплементарной ей последовательности, отделенной не родственным спейсером.

4. Набор последовательностей ДНК, демонстрирующих анти-ВИЧ активность или используемых для профилактики и лечения СПИДа, отличающихся тем, что:

1) последовательности ДНК или их фрагменты корреспондируют соответствующим последовательностям РНК или их фрагментам по п.1, или двухцепочечной РНК по п.1 и её комплементарным последовательностям или фрагментами, или

2) последовательности ДНК или их фрагменты корреспондируют соответствующим последовательностям РНК или их фрагментам по п.1, измененным другими нуклеотидами по их 5'- или 3'-концам, либо по их 5'- или 3'-концам одновременно, или

3) одноцепочечная или двухцепочечная последовательность ДНК корреспондирует последовательности РНК по п.3.

5. Векторы экспрессии, направленные против ВИЧ инфекции или используемые для лечения или профилактики СПИД, отличающиеся тем, что они содержат любые последовательности РНК или ДНК или их фрагменты по пп.1-4 и включают векторы РНК и векторы ДНК.

6. Липосомы анти-ВИЧ, направленные против ВИЧ инфекции или используемые для лечения или профилактики СПИД, отличающиеся тем, что в липосомы заключаются ДНК, РНК или их фрагменты по пп.1-4, а также векторы по п.5.

7. Способ лечения и/или профилактики ВИЧ-инфекции или СПИД, отличающийся тем, что РНК, ДНК или их фрагменты по пп.1-4, а также векторы экспрессии по п.5, липосомы по п.6, вводят в эукариотические линии клеток человека и животных.

8. Применение анти-ВИЧ-нуклеотидов, отличающееся тем, что наборы последовательностей РНК или ДНК по пп.1-4, векторы экспрессии по п.5, липосомы по п.6 и протоколы по п.7 используют для приготовления лекарственных препаратов против ВИЧ-инфекции или для диагностики, лечения или профилактики СПИДа.

 

Текст

Смотреть все

009290 Настоящее изобретение относится к набору анти-ВИЧ-олигонуклеотидов и к способу их применения для профилактики и лечения синдрома приобретенного иммунодефицита (СПИД). Недавние исследования показали, что короткая двухцепочечная РНК функционирует как интерференционная РНК в разных клетках млекопитающих и может подавлять экспрессию генов. Экспрессия вирусных генов (включая ВИЧ) может быть подавлена этим путем. Вследствие высокой частоты мутаций в геноме ВИЧ, большинство интерференционных РНК способна подавлять экспрессию генов специфических изолятов, но не может использоваться как универсальное средство в генной терапии СПИДа. Задачей настоящего изобретения является разработка набора нуклеотидов для профилактики ВИЧинфекции и лечения СПИДа. Другой задачей изобретения является разработка способа применения вышеупомянутых олигонуклеотидов. Задачи изобретения выполняются посредством разработки следующих подходов. В профилактике и лечении СПИДа применяют набор последовательностей РНК, показанных ниже или любых фрагментов таких последовательностей, которые демонстрируют анти-ВИЧ активность. Нуклеотиды включают одноцепочечную РНК, любой фрагмент, полученный из указанных последовательностей, или двухцепочечную РНК, полученную отжигом последовательностей с комплементарными им последовательностями: Согласно изобретению последовательности олигонуклеотидов, как и все опубликованные ВИЧгены, получают методом гомологического сравнения. Когда подобную РНК вводят в клетки млекопитающих, экспрессия генов ВИЧ подавляется, а ВИЧ геном разрушается. Фармацевтические препараты,полученные из указанных последовательностей, могут значительно уменьшить проблемы резистентности (результирующей из геномного мутагенеза) к лекарственным средствам. Изобретение предусматривает также набор последовательностей РНК, модифицированные другими нуклеотидами по 5'-концу или 3'-концу. Как правило, чтобы удостовериться в гомологичности РНК с мРНК, на которую она направлена, UU добавляют на 3'-конце фрагмента РНК. Изобретение предусматривает также набор последовательностей шпилькообразных РНК для контроля ВИЧ-инфекции и для профилактики и лечения СПИДа, который получают гибридизацией последовательностей (последовательность 1 и последовательность 9) или фрагментов этих последовательностей путем связывания 5'-конца через некомплементарную последовательность с комплементарными последовательностями. Шпилькообразная РНК сохраняет активность интерференционной РНК и используется для экспрессии интерференционной РНК в клетке, е в частности применяют для ускорения интерференции РНК в клетку, так как РНК является молекулярной по структуре. В профилактике и лечении СПИДа используют следующий набор анти-ВИЧ последовательностей ДНК и их фрагментов: 1. Последовательности ДНК или их фрагменты, которые соответствуют последовательностям РНК,показанным выше, или их фрагментам (последовательность 1, последовательность 9 в табл. 1); либо соответствуют двухцепочечной РНК, сформированной гибридизацией вышеупомянутых РНК с комплементарными им последовательностями или,2. Последовательности ДНК или их фрагменты, которые соответствуют последовательностям РНК по п.1) или их фрагментам, которые были изменены на 5'-концах или 3'-концах добавлением нуклеотидов; или 3. Одноцепочечные или двухцепочечные последовательности ДНК, которые соответствуют шпилькообразной последовательности РНК, как описано выше. Для профилактики или лечения СПИДа используют набор векторов экспрессии анти-ВИЧ, включая ДНК-векторы и РНК-векторы, в которых содержатся вышеописанные последовательности РНК или ДНК. Интерференция РНК ускоряется, когда векторы, содержащие вышеупомянутые ДНК и РНК последовательности вводят в клетки под контролем регуляторных элементов. Эти векторы включают РНКвекторы и ДНК-векторы. РНК-векторы включают (не ограничиваясь указанным) ретровирусный вектор,ДНК-векторы, несущие вышеупомянутые последовательности ДНК, и регуляторные элементы, включая плазмидные и вирусные векторы, такие как аденовирус-ассоциированный вирус (AAV).-1 009290 В состав анти-ВИЧ липосом для профилактики и лечения СПИДа входят РНК и ДНК последовательности, так же как и векторы экспрессии, обозначенные выше. Интерференционную РНК или векторы, ее содержащие, вводят в клетку посредством вышеуказанных липосом. В рамках разработки способа борьбы против ВИЧ инфекции и для профилактики и лечения СПИДа вышеобозначенные РНК, ДНК, векторы экспрессии и липосомы вводят в эукариотические клетки животных или людей (пример: способы с использованием липосомных и вирусных векторов). Нуклеотиды применяют в профилактике ВИЧ инфекции и лечении СПИДа. Фармацевтические препараты для диагностики, профилактики и лечения ВИЧ инфекции и СПИДа получают из вышеупомянутых РНК, ДНК,векторов экспрессии, липосом. На фиг. 1 представлена структура контрольной плазмиды pEGFP-gp120. На фиг. 2 показано подавление экспрессии EGFP-gp120 двухцепочечной интерференционной РНК. На фиг. 3 показано подавление экспрессии EGFP-gp120 двухцепочечной интерференционной РНК,что продемонстрировано при помощи автоматического анализатора модели "Вестерн-Блот". На фиг. 4 представлена структура плазмиды p-H1-gp120i для экспрессии шпилькообразной РНК в клетках. На фиг. 5 представлена структура плазмиды pAAV-120i. На фиг. 6 показано подавление экспрессиии GFP-GP120 шпилькообразной двухцепочечной РНК,введенной через рекомбинантный аденовирус-ассоциированный вирус. Предпочтительные варианты воплощения изобретения. Все протоколы изобретения базируются на протоколах из журнала "Молекулярное Клонирование",3-ем издании (Molecular Cloning, 3rd edition). Пример 1. Поражение наиболее консервативной последовательности РНК ВИЧ. Известные из публикаций последовательности генома ВИЧ отбирали и, основываясь на функционирующих генах ВИЧ,делили на 70 фрагментов. Гомология каждого фрагмента с более чем 140 000 последовательностями изGenebank (Национального Центра Биологической Информации, США), EMBL (Базы Данных Последовательностей Нуклеотидов в Европейской Лаборатории Молекулярной Биологии), DDBJ (Базы данных нуклеотидов Японии) и GDB (Базы Данных Генов) проанализировали при помощи программного обеспечения и баз данных BlastN 2.2.4/2.2.5. Консервативные последовательности рибонуклеиновой кислоты отбирали по следующим критериям: 1) последовательность равнялась или была длиннее 19 нуклеотидов; 2) последовательность была 100%-но гомологична по крайней мере с 1000 последовательностями базы данных ВИЧ; 3) если 100%-но гомологичные фрагменты не могли быть найдены, включали последовательности, содержащие один отличный нуклеотид. Результаты анализа показаны в табл. 1-2. Таблица 1. Наиболее консервативные последовательности РНК ВИЧ, найденные анализом гомологии-2 009290 Таблица 2. Анализ гомологии консервативных последовательностей РНК с последовательностями в базе данных Пример 2. Экспрессию гена env-ВИЧ подавляли химически синтезированной двухцепочечной РНК. Позитивную и негативную (комплементарные) цепи РНК синтезировали согласно последовательности 1 с модификацией UU на 3'-конце. Как показано на фиг. 1, плазмиду pEGFPC1 (Clontech, CA) дважды обрабатывали с EcoRI и BamHI при температуре 37 С в течение 1 ч. Большой фрагмент извлекали и использовали как вектор. Ген ВИЧgр 120 получали методом PCR (ПЦР), в качестве матрицы использовали 2 нг фрагмента ВИЧ cDNA(штамм Bru) с gp120 праймерами (А:5' cggaattctaaagagcacaaga cagtggac, В: 5' cggatcctactctaccgtcagcgtcattga 100 нг каждый) в буфере, содержащем 2.5 ед Pfu высоконадежной ДНК полимеразы нуклеотидов 250 мкмоль/л, 2,5 ммоль/л MgCl2, 25 ммоль/л Трис-HCl (рН 8,3). Полимеразную цепную реакцию (PCR) проводили, используя термоциклер "Перкин Элмер-9700" (при температуре 94 С - 30 с, при 50 С - 30 с, при 72 С - 90 с, проводили 30 циклов). Фрагмент ДНК получали методом PCR (ПЦР) и обрабатывали с EcoRI и BamHI (Biolabs) после очистки Набором Извлечения Геля "Qiagen" и легировали с вектором, описанным выше. Легированную смесь преобразовывали в E.coli JM109 (Promega), получали плазмиду pEGFPgp120. Экспрессия белка, полученного слиянием GFP и ВИЧ gр 120, проявлялась в клетках млекопитающих через трансфекцию плазмиды. Клетки НЕК 293 (из АТСС) были котрансфицированы посредством 1 мкг плазмиды pEGFP-gp120 и 1 мкг двухцепочечной РНК (вышеописанной), используя LIPOFECT-амин (rf. Manul из "Invitrogen"). Спустя 36 ч после трансфекции клетки анализировали методом флуоресцентной микроскопии; а лизат клеток анализировали посредством иммуноблоттинга с анти-GFP антителом (Clontech). Контрольную двухцепочечную РНК (rf. двухцепочечная РНК соответствовала ВИЧ гену GAG, см. пример 3) использовали в качестве регуляторного элемента. В результате, как показано на фиг. 2, экспрессия белка слияния была подавлена env-специфичной двухцепочечной РНК в сравнении с регуляторным элементом. Эксперимент повторяли дважды и обозначали соответственно как DsRNA1 и DsRNA2. Как отображено на фиг. 3, уровень экспрессии GFP-ВИЧ GP120 белка был подавлен на 80%. Пример 3. Экспрессию гена ВИЧ gag подавляли посредством синтезированной двухцепочечной РНК. Базируясь на консервативной последовательности РНК гена gag (последовательность 2 в табл. 1),из 21 нуклеотида и комплементарных им последовательностей синтезировали олигонуклеотиды. Последовательности содержали 19 нуклеотидов из последовательности 2 и два U на 3'-конце ка-3 009290 ждого фрагмента. Двухцепочечную РНК получали отжигом. Ген ВИЧ gag (LAV-1, Bru изолят) внедряли и клонировали в pEGFP C1 вектор (Clontech, CA) как описано в примере 2, экспрессия GFP-ВИЧ gag белка, как ожидалось, должна была проявиться плазмидой при трансфекции в клетках. Плазмиду, так же как и двухцепочечную РНК котрансфицировали в клетки НЕК 293 в соответствии с протоколом LIPOFECTамина; было продемонстрировано, что экспрессия GFP-ВИЧ gag белка была подавленна двухцепочечной РНК в сравнении с ложной двойной цепью, что было подтверждено флуоресцентной микроскопией клеток через 36 ч после трансфекции. Пример 4. Экспрессию гена Nef подавляли синтезированной двухцепочечной РНК. Согласно консервативной последовательности nef (последовательность 7 в табл. 1), олигонуклеотид синтезировали из 21 нуклеотидов с комплементарной последовательностью РНК, в которой 19 нуклеотидов с 5'-концом были получены из последовательности 7, и два U были добавлены к 3'-концу каждого олигонуклеотида. Двухцепочечную РНК получали при помощи отжига. Ген-кодирующий белок nef клонировали и включали в pEGFPC1 согласно примеру 2, и GFP-Nef белок, как ожидалось, должен был проявляться клетками, содержащими рекомбинантную плазмиду. Клетки НЕК 293 котрансфицировали посредством полученной плазмиды и синтезированной двухцепочечной РНК. В результате было продемонстрировано, что экспрессия белка GFP-ВИЧ nef была подавлена nef-специфичной двухцепочечной РНК в сравнении с ложной двухцепочечной РНК, что подтверждалось флуоресцентной микроскопией через 36 часов после трансфекции. Пример 5. Экспрессию других белков ВИЧ подавляли синтезированной двухцепочечной РНК (табл. 3). Таблица 3. Экспрессия других ВИЧ генов, подавленной de novo синтезированной двухцепочечной РНК 60-80%ингибирования;80-100% ингибирования. Пример 6. Экспрессию гена ВИЧ подавляли интерференционной РНК, введенной в клетку эукариотическим вектором, содержащим фрагменты двухцепочечной ДНК, кодирующей консервативную шпилькообразную SiPHK. Синтезировали ДНК, соответствующую фрагменту последовательности РНК 5 согласно табл. 1,а также их гибридную последовательность (выделена жирный курсив). Путм отжига получали фрагмент ДНК. BamHl и Hindlll были включены в 5'- и 3'-концы соответственно. Между консервативной последовательностью и ее гибридной последовательностью наблюдался промежуток в 9 пар оснований. Фрагмент В был комплементарен последовательности фрагмента А: Как показано на фиг. 4, человеческий Н 1 промоутер усиливали с помощью праймера 1CCGTGGTCTCATACAGAACTTATAAGATTCCC-3'), используя 1g человеческую геномную ДНК в качестве матрицы, затем клонировали по сайтам Asel и Xbal плазмиды pEGFP (Clontech). Легированную смесь трансформировали в E.coli JM109 и получали рекомбинантную плазмиду рН 1. Полученный отжигом двухцепочечный (вышеописанный) фрагмент ДНК клонировали по сайтам BamHI и HindIII рН 1. В результате получали новую рекомбинантную плазмиду pH1-gp120i. Шпилькообразную РНК транскрибировали РНК полимеразой III в клетках трансфицированных pH1-gp120i. Клетки НЕК 293 котрансфицировали с g pH1-gp120i плазмидой. В качестве регуляторного элемента использовали то же количество рН 1 и то же количество плазмид использовалось для экспрессииEGFP-ВИЧ GP120. Дифференциальную экспрессию EGFP-ВИЧ GP120 анализировали согласно Примеру 2. Полученные результаты продемонстрировали, что интерференционная РНК, кодируемая плазмидосодержащим фрагментом ДНК, кодирующим шпилькообразную РНК, может эффективно ингибировать экспрессию генов ВИЧ. Пример 7. Экспрессию ВИЧ GP120 подавляли интерференционной РНК, транскрибированной в клетках, зараженных аденовирусом-ассоциированным вирусом (AAV), который содержал промоутер Н 1 и соответствующий фрагмент ДНК, кодирующий шпилькообразную РНК, как описано в примере 6. Как показано на фиг. 5, плазмиды pAAV-MCS (Stratagene) обрабатывали посредством NotI и HindIII. Фрагмент ДНК, содержащий промоутер Н 1, и фрагмент ДНК, кодирующий шпилькообразную РНК,корреспондирующий gр 120, получали путм обработки рН 1-gp120 посредством Notl и Hindlll. Фрагмент легировали в вектор посредством Т 4 ДНК-лигазы, и получали плазмиду pAAV-gp120i. Клетки НЕК 293FT котрансфицировали плазмидой (4g), вспомогательной плазмидой pHelper (1g - Stratagene) и плазмидой pAAV-RC (2g Stratagene) при помощи LIPOFECTамина, а пустой вектор (pAAV-MCS) использовали в качестве регуляторного элемента. Рекомбинантный AAV и контрольный AAV выделяли спустя 48 ч после трансфекции. Клетки НЕК 293 трансфицировали посредством pEGFP-GP120 (1g), как описывалось ранее, и инфицировали рекомбинантным AAV, кодирующим интерференционную РНК или пустым AAV. Через 24 ч после инфицирования при помощи флуоресцентного микроскопа анализировали флуоресценцию GFP(зеленых флуоресцирующих протеинов). Как показано на фиг. 6, экспрессия GFP-GP120 была значительно подавлена рекомбинантным AAV,который кодировал шпилькообразную РНК. Таким образом, настоящее изобретение превосходит известные технологии, а именно, высоко консервативные фрагменты РНК всех опубликованных генов ВИЧ получают анализом гомологии. Посредством двухцепочечной РНК, полученной из высоко консервативной РНК, эффективно подавляют экспрессию ВИЧ-генов. Экспрессию генов ВИЧ также подавляют двухцепочечной РНК, кодируемой плазмидой, так же как аденовирус-ассоциированным вирусом, содержащим соответствующую последовательность ДНК.-6 009290 ФОРМУЛА ИЗОБРЕТЕНИЯ 1. Набор последовательностей РНК или любого фрагмента таких последовательностей, демонстрирующих анти-ВИЧ активность и используемых для профилактики и лечения СПИДа, отличающихся тем,что нуклеотиды включают одноцепочечную РНК, любой фрагмент, полученный из данных последовательностей, или двухцепочечную РНК, полученную отжигом последовательностей с комплементарными им последовательностями, при этом последовательности представляют собой: 2. Последовательности РНК или их фрагменты по п.1, отличающиеся тем, что они являются модифицированными по 5'- или 3'-концам добавлением нуклеотидов с анти-ВИЧ активностью или используемыми для профилактики и лечения ВИЧ-инфекции. 3. Набор последовательностей РНК, демонстрирующих анти-ВИЧ активность или используемых для профилактики и лечения СПИДа, отличающихся наличием шпилькообразной РНК, состоящей из РНК по п.1 и комплементарной ей последовательности, отделенной не родственным спейсером. 4. Набор последовательностей ДНК, демонстрирующих анти-ВИЧ активность или используемых для профилактики и лечения СПИДа, отличающихся тем, что: 1) последовательности ДНК или их фрагменты корреспондируют соответствующим последовательностям РНК или их фрагментам по п.1, или двухцепочечной РНК по п.1 и е комплементарным последовательностям или фрагментами, или 2) последовательности ДНК или их фрагменты корреспондируют соответствующим последовательностям РНК или их фрагментам по п.1, измененным другими нуклеотидами по их 5'- или 3'-концам, либо по их 5'- или 3'-концам одновременно, или 3) одноцепочечная или двухцепочечная последовательность ДНК корреспондирует последовательности РНК по п.3. 5. Векторы экспрессии, направленные против ВИЧ инфекции или используемые для лечения или профилактики СПИД, отличающиеся тем, что они содержат любые последовательности РНК или ДНК или их фрагменты по пп.1-4 и включают векторы РНК и векторы ДНК. 6. Липосомы анти-ВИЧ, направленные против ВИЧ инфекции или используемые для лечения или профилактики СПИД, отличающиеся тем, что в липосомы заключаются ДНК, РНК или их фрагменты по пп.1-4, а также векторы по п.5. 7. Способ лечения и/или профилактики ВИЧ-инфекции или СПИД, отличающийся тем, что РНК,ДНК или их фрагменты по пп.1-4, а также векторы экспрессии по п.5, липосомы по п.6, вводят в эукариотические линии клеток человека и животных. 8. Применение анти-ВИЧ-нуклеотидов, отличающееся тем, что наборы последовательностей РНК или ДНК по пп.1-4, векторы экспрессии по п.5, липосомы по п.6 и протоколы по п.7 используют для приготовления лекарственных препаратов против ВИЧ-инфекции или для диагностики, лечения или профилактики СПИДа.

МПК / Метки

МПК: C12N 15/63, A61P 31/18, C07H 21/00, A61K 48/00, C12N 15/88

Метки: иммунодефицита, олигонуклеотидов, синдрома, профилактики, анти-вич, набор, применения, способ, приобретенного, лечения

Код ссылки

<a href="http://easpatents.com/10-9290-nabor-anti-vich-oligonukleotidov-i-sposob-ih-primeneniya-dlya-profilaktiki-i-lecheniya-sindroma-priobretennogo-immunodeficita.html" rel="bookmark" title="База патентов Евразийского Союза">Набор анти-вич- олигонуклеотидов и способ их применения для профилактики и лечения синдрома приобретенного иммунодефицита</a>

Похожие патенты